Search Results

Search found 7647 results on 306 pages for 'mustache js'.

Page 44/306 | < Previous Page | 40 41 42 43 44 45 46 47 48 49 50 51  | Next Page >

  • js function to get filename from url

    - by Blankman
    Hi, I have a url like http://www.example.com/blah/th.html I need a javascript function to give me the 'th' value from that. All my urls have the same format (2 letter filenames, with .html extension). I want it to be a safe function, so if someone passes in an empty url it doesn't break. I know how to check for length, but I should be checking for null to right?

    Read the article

  • Understanding NoSQL Data Modeling - blog application

    - by Rushabh RajeshKumar Padalia
    I am creating an blogging application in Node.js + MongoDB Database. I have used relational Database like MySQL before but this is my first experience with NoSQL database. So I would like to conform my MongoDB data models before I move further. I have decided my blogDB to have 3 collections post_collection - stores information about that article comment_collection - store information about comments on articles user_info_collection - contains user inforamtion PostDB { _"id" : ObjectID(...), "author": "author_name", "Date": new Date(....), "tag" : ["politics" , "war"], "post_title": "My first Article", "post_content": "Big big article" "likes": 23 "access": "public" } CommentDB { "_id" : Objectid(...), "POST": "My First Article", "comment_by": "User_name", "comment": "MY comments" } UserInfoDB { "_id": ObjectID(...), "user": "User_name", "password": "My_password" } I would appreciate your comments.

    Read the article

  • A brief question about JS or AJAX

    - by Luke
    I have been finding ways around this for a long time but think it's time I addressed it. If I have a page that has a dropdown menu, is there anyway I can select a value which will subsequently load other values further down. Can this be done without a page reload? I will give you an example. Say I was making some tools for an admin panel, but first of all they needed to select a member to work with. They would select the member and then below, the fields about that member would be populated based on what was selected in the first menu. As I have already asked, can this be done without a page reload? Thanks for reading.

    Read the article

  • Toastr.js notifications as modal notfication

    - by Maxsteel
    I know it's not what toastr (or toast notifs in general) are meant to be used for, but I want to use them as a modal notification. My idea is following. On toast show: toastr.options.onShown = function() { //Create an overlay on the entire page} Overlay: #overlay { background-color: rgba(0, 0, 0, 0.8); z-index: 999; position: absolute; left: 0; top: 0; width: 100%; height: 100%; display: none; } And on toast close: toastr.options.onHidden = function() { //make overlay go away } Also, I'm setting timeout of toast to 0 so it won't disappear by itself. Question: I want the toast notification to stay atop the overlay and not behind it as overlay will cover everything. How can I do it?

    Read the article

  • JS variable scope missunderstanding

    - by meo
    I have a little problem: slideHelpers.total = 4 for (i=1;i <= slideHelpers.total; i++) { $('<a href="#">' + i + '</a>').bind('click', function(){ alert('go to the ' + i + ' slide')}).appendTo('.slideaccess') } the alert gives out 5 what is logic, because when the function click triggers i is actually 5. But i would like to have the same i as in my <a> tag. What is the best way to handle this? I could put i in the data() of the <a> tag for example but i am sure there is a easier way.

    Read the article

  • Query parameter using JS framework ?

    - by Maxim Veksler
    Hi, I seem to not be able to find implementation from the common Ajax libraries (JQuery, mootools, prototypejs...) that would allow the operation of parsing the window.location.href for request parameter. I would expect something like: $P{"param1"} == "param1_value" Am I missing something? p.s. The web does contains implementation examples for such operations

    Read the article

  • Backbone inheritance - deep copying

    - by Ed .
    I've seen this question regarding inheritance in Backbone: Backbone.js view inheritance. Useful but doesn't answer my question. The problem I'm experiencing is this: Say I have a class Panel (model in this example); var Panel = Backbone.Model.extend({ defaults : { name : 'my-panel' } }); And then an AdvancedPanel; var AdvancedPanel = Panel.extend({ defaults : { label : 'Click to edit' } }); The following doesn't work: var advancedPanel = new AdvancedPanel(); alert(advancedPanel.get('name')); // Undefined :( JSFiddle here: http://jsfiddle.net/hWmnb/ I guess I can see that I can achieve this myself through some custom extend function that creates a deep copy of the prototype, but this seems like a common thing that people might want from Backbone inheritance, is there a standard way of doing it?

    Read the article

  • html/js: Refresh 'Select' options

    - by framara
    Hi, There's a class 'Car' with brand and model as properties. I have a list of items of this class List<Car> myCars. I need to represent in a JSP website 2 ComboBox, one for brand and another for model, that when you select the brand, in the model list only appear the ones from that brand. I don't know how to do this in a dynamic way. Any suggestion where to start? Thanks Update Ok, what I do now is send in the request a list with all the brand names, and a list of the items. The JSP code is like: <select name="manufacturer" id="id_manufacturer" onchange="return getManufacturer();"> <option value=""></option> <c:forEach items="${manufacturers}" var="man"> <option value="${man}" >${man}</option> </c:forEach> </select> <select name="model" id="id_model"> <c:forEach items="${mycars}" var="car"> <c:if test="${car.manufacturer eq man_selected}"> <option value="${car.id}">${car.model}</option> </c:if> </c:forEach> </select> <script> function getManufacturer() { man_selected = document.getElementById('id_manufacturer').value; } </script> How do I do to refresh the 'model' select options according to the selected 'man_selected' ?

    Read the article

  • Kill unload function in JS?

    - by Newbie
    Hello! Is there a way to kill the unload function with javascript(jquery)? I am looking for something like this: window.onbeforeunload = function(){ confirm("Close?") } or in jquery: $(window).unload(function() { confirm("close?") }); Now, on window unload I get my confirm alert but it will continue in any case. Clicking cancel it won't stay on my page. Can U help me plz?

    Read the article

  • passing dynamic values in callback method

    - by swastican
    is there a way to pass dynamic values to callback function in js or jquery or nodejs. for(var i = 0; i < 10; i++) { filename = 'file'+i+'.html'; request(url, function(error, response, body) { test(error, response, body, filename); }); function test(error, response, body, filename) { console.log('file name ' + filename); if(response.statusCode == 200){ console.log('done'); } } I refered this so article for passing values to callback function. link: [JavaScript: Passing parameters to a callback function the output always seems to be 9 How can i pass values dynamically? The callback function always refers the last value of filename.

    Read the article

  • Force download through markup or JS

    - by mschoening
    Lets assume I have a file on a CDN (Cloud Files from Rackspace) and a static html page with a link to that file. Is there any way I can force download this file (to prevent it from opening in the browser -- for mp3s for example)? We could make our server read the file and set the corresponding header to: header("Content-Type: application/force-download") but we have about 5 million downloads per month so we would rather let the CDN take care of that. Any ideas?

    Read the article

  • Javascript object encapsulation that tracks changes

    - by Raynos
    Is it possible to create an object container where changes can be tracked Said object is a complex nested object of data. (compliant with JSON). The wrapper allows you to get the object, and save changes, without specifically stating what the changes are Does there exist a design pattern for this kind of encapsulation Deep cloning is not an option since I'm trying to write a wrapper like this to avoid doing just that. The solution of serialization should only be considered if there are no other solutions. An example of use would be var foo = state.get(); // change state state.update(); // or state.save(); client.tell(state.recentChange()); A jsfiddle snippet might help : http://jsfiddle.net/Raynos/kzKEp/ It seems like implementing an internal hash to keep track of changes is the best option. [Edit] To clarify this is actaully done on node.js on the server. The only thing that changes is that the solution can be specific to the V8 implementation.

    Read the article

  • Issue pushing object into an array JS

    - by Javacadabra
    I'm having an issue placing an object into my array in javascript. This is the code: $('.confirmBtn').click(function(){ //Get reference to the Value in the Text area var comment = $("#comments").val(); //Create Object var orderComment = { 'comment' : comment }; //Add Object to the Array productArray.push(orderComment); //update cookie $.cookie('order_cookie', JSON.stringify(productArray), { expires: 1, path: '/' }); }); However when I print the array this is the output: Array ( [0] => Array ( [stockCode] => CBL202659/A [quantity] => 8 ) [1] => Array ( [stockCode] => CBL201764 [quantity] => 6 ) [2] => TEST TEST ) I would like it to look like this: Array ( [0] => Array ( [stockCode] => CBL202659/A [quantity] => 8 ) [1] => Array ( [stockCode] => CBL201764 [quantity] => 6 ) [2] Array( [comment] => TEST TEST ) I added products to the array in a similar way and it worked fine: var productArray = []; // Will hold order Items $(".orderBtn").click(function(event){ //Check to ensure quantity > 0 if(quantity == 0){ console.log("Quantity must be greater than 0") }else{//It is so continue //Show the order Box $(".order-alert").show(); event.preventDefault(); //Get reference to the product clicked var stockCode = $(this).closest('li').find('.stock_code').html(); //Get reference to the quantity selected var quantity = $(this).closest('li').find('.order_amount').val(); //Order Item (contains stockCode and Quantity) - Can add whatever data I like here var orderItem = { 'stockCode' : stockCode, 'quantity' : quantity }; //Check if cookie exists if($.cookie('order_cookie') === undefined){ console.log("Creating new cookie"); //Add object to the Array productArray.push(orderItem);

    Read the article

  • PHP or JS to connect with fingerprint scanner save to database

    - by narong
    I have a project to set profile user and save all data to database include fingerprint also. i don't what i should start, I have USB finger scanner already to test. What i think: i should have a input box to read data from USB finger scanner than i should create a function to upload it database. but with this thinking i meet problem: i don't know data that get from USB finger scanner is image or data? if image, how i can read it to input box to save to database ? Anyone have any idea, please share me to resolve it. I am looking to see your helping soon! thanks

    Read the article

  • [DOM/JS] display table in IE

    - by budzor
    I have code like that: var xPola = 10, //how many cols yPola = 10, //how many cols bokPola = 30, //size of cell body = document.getElementsByTagName('body')[0]; var tablica = document.createElement('table'); body.appendChild(tablica); for( var y = 0; y < yPola; y++ ) { var rzad = document.createElement('tr'); tablica.appendChild(rzad); for( var x = 0; x < xPola; x++ ) { var pole = document.createElement('td'); pole.setAttribute('width', bokPola); pole.setAttribute('height', bokPola); rzad.appendChild(pole); } }; it works fine in FF, Chrome & Opera (it displays 10x10 table with 30px width&height rows). In IE nothing happens. I check in firebug lite and it is in HTML section, inside BODY tag but i see nothing. Whats wrong?

    Read the article

  • Angular.js: value() not injected in config()

    - by Nik
    I am having trouble getting the value() injected into the app.config(). Here's the code (coffeescript) window.app = angular.module("app", []) app.value("template_path", "assets/angular/templates/users") app.config(["$routeProvider","template_path" ($routeProvider, template_path) -> console.log template_path it is throwing an "Unknown provider: template_path from app" error Could it be that the config() method cannot be injected with value() set values? I am using 1.0.2 Thank you!

    Read the article

  • Get next key-value pair in an object

    - by captainclam
    So, given a key, I want to find the next property in an object. Then, I want to return the value of the NEXT property. I can not rely on the keys to be ordered or sequential (they're uuids). Please see below for trivial example of what I want: var db ={ a: 1, b: 2, c: 3 } var next = function(db, key) { // ??? } next(db, 'a'); // I want 2 next(db, 'b'); // I want 3 I also want a prev() function, but I'm sure it will be the same solution. This seems like such a trivial problem but I can't for the life of me figure out how to do it. Happy for the solution to use underscore.js or be written in coffeescript :)

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • JS Split ( ) to check if substring exists in Array

    - by Javacadabra
    I have an array of products that are stored as Strings in this format productname:quantity. The issue I am running into is that if a user adds one product with a quantity of x it is inserted into the array as it should. However, if they then decide to add more of a particular product a new entry is made into the array instead of checking if the product already exists and adjusting the quantity to the new value. oldQty + newQty. For example this is my array: ["CBL202659/A:1","OUTER9:1","PALLET CARDS:1"] If I add another PALLET CARDS product it creates a new entry rather than updating the quantity of the existing item to 2. New array ["CBL202659/A:1","OUTER9:1","PALLET CARDS:1","PALLET CARDS:1"] I would like the array to end up like this: - updating the quantity ["CBL202659/A:1","OUTER9:1","PALLET CARDS:2"] Currently this is my code: I use the split() method to seperate the String where a colon occurs and store the product name and quantity in two seperate variables. $(".orderBtn").click(function(event){ //Show the order Box $(".order-alert").show(); event.preventDefault(); //Create the Array var productArray = []; //Get reference to the product clicked var stockCode = $(this).closest('li').find('.stock_code').html(); //Get reference to the quantity selected var quantity = $(this).closest('li').find('.order_amount').val(); var item = stockCode + ":" + quantity; var itemCheck = stockCode + ":"; if(quantity == 0){ console.log("Quantity must be greater than 0") }else{ //If no Cookie exists, create one and add the Array if ($.cookie('order_cookie') === undefined) { console.log("CREATE NEW COOKIE"); //Add items to Array productArray.push(item); //Add Array to Cookie $.cookie('order_cookie', JSON.stringify(productArray), { expires: 1, path: '/' }); //If the Cookie already exists do this } else { productArray = JSON.parse($.cookie('order_cookie'));//get ref to array if(productArray.indexOf(itemCheck)!= -1){//It exists so update qty console.log("EXISTS... updating item: " + itemCheck); //var index = productArray.indexOf(item); //var update = productArray[index].split(":"); //var name = update[0]; //var oldQty = update[1]; //console.log(name + ":" + oldQty); //productArray[index] = item; }else{//It does not exist, so add to array console.log("Does not exist... adding new item: " + item); //Append items onto the Array productArray.push(item); } //Update the Cookie $.cookie('order_cookie', JSON.stringify(productArray), { expires: 1, path: '/' }); console.log($.cookie('order_cookie')); } //Display the number of items in the Array in the Order Box $('#order_counter').html(productArray.length); } }); I suppose the real question I am asking here, is if it is possible to search the array for a subString - containing productname: ??

    Read the article

< Previous Page | 40 41 42 43 44 45 46 47 48 49 50 51  | Next Page >