Search Results

Search found 12601 results on 505 pages for 'z index'.

Page 441/505 | < Previous Page | 437 438 439 440 441 442 443 444 445 446 447 448  | Next Page >

  • Out-of-memory algorithms for addressing large arrays

    - by reve_etrange
    I am trying to deal with a very large dataset. I have k = ~4200 matrices (varying sizes) which must be compared combinatorially, skipping non-unique and self comparisons. Each of k(k-1)/2 comparisons produces a matrix, which must be indexed against its parents (i.e. can find out where it came from). The convenient way to do this is to (triangularly) fill a k-by-k cell array with the result of each comparison. These are ~100 X ~100 matrices, on average. Using single precision floats, it works out to 400 GB overall. I need to 1) generate the cell array or pieces of it without trying to place the whole thing in memory and 2) access its elements (and their elements) in like fashion. My attempts have been inefficient due to reliance on MATLAB's eval() as well as save and clear occurring in loops. for i=1:k [~,m] = size(data{i}); cur_var = ['H' int2str(i)]; %# if i == 1; save('FileName'); end; %# If using a single MAT file and need to create it. eval([cur_var ' = cell(1,k-i);']); for j=i+1:k [~,n] = size(data{j}); eval([cur_var '{i,j} = zeros(m,n,''single'');']); eval([cur_var '{i,j} = compare(data{i},data{j});']); end save(cur_var,cur_var); %# Add '-append' when using a single MAT file. clear(cur_var); end The other thing I have done is to perform the split when mod((i+j-1)/2,max(factor(k(k-1)/2))) == 0. This divides the result into the largest number of same-size pieces, which seems logical. The indexing is a little more complicated, but not too bad because a linear index could be used. Does anyone know/see a better way?

    Read the article

  • Converting "A* Search" code from C++ to Java [on hold]

    - by mr5
    Updated! I get this code from this site It's A* Search Algorithm(finding shortest path with heuristics) I modify most of variable names and some if conditions from the original version to satisfy my syntactic taste. It works in C++ (as I can't see any trouble with it) but fails in Java version. Java Code: String findPath(int startX, int startY, int finishX, int finishY) { @SuppressWarnings("unchecked") LinkedList<Node>[] nodeList = (LinkedList<Node>[]) new LinkedList<?>[2]; nodeList[0] = new LinkedList<Node>(); nodeList[1] = new LinkedList<Node>(); Node n0; Node m0; int nlIndex = 0; // queueList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = new Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[nlIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[nlIndex].isEmpty() ) { LinkedList<Node> pq = nodeList[nlIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = new Node( pq.peek().getX(), pq.peek().getY(), pq.peek().getIterCount(), pq.peek().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[nlIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions String path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; int c = '0' + ( j + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; path = (char)c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < Node.DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!(xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( gridMap.getData( ydy, xdx ) == GridMap.WALKABLE || gridMap.getData( ydy, xdx ) == GridMap.FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = new Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[nlIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; // replace the node // by emptying one queueList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while( !(nodeList[nlIndex].peek().getX() == xdx && nodeList[nlIndex].peek().getY() == ydy ) ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nodeList[nlIndex].pop(); // remove the wanted node // empty the larger size queueList to the smaller one if( nodeList[nlIndex].size() > nodeList[ 1 - nlIndex ].size() ) nlIndex = 1 - nlIndex; while( !nodeList[nlIndex].isEmpty() ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nlIndex = 1 - nlIndex; nodeList[nlIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output1: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Misleading path) Output2: Changing these lines: n0 = new Node( a, b, c, d ); m0 = new Node( e, f, g, h ); to n0.set( a, b, c, d ); m0.set( e, f, g, h ); I get (I'm really confused) C++ Code: std::string A_Star::findPath(int startX, int startY, int finishX, int finishY) { typedef std::queue<Node> List_Container; List_Container nodeList[2]; // list of open (not-yet-tried) nodes Node n0; Node m0; int pqIndex = 0; // nodeList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[pqIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[pqIndex].empty() ) { List_Container &pq = nodeList[pqIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = Node( pq.front().getX(), pq.front().getY(), pq.front().getIterCount(), pq.front().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[pqIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions std::string path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; char c = '0' + ( j + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; path = c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!( xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( pGrid->getData(ydy,xdx) == WALKABLE || pGrid->getData(ydy, xdx) == FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[pqIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; // replace the node // by emptying one nodeList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while ( !( nodeList[pqIndex].front().getX() == xdx && nodeList[pqIndex].front().getY() == ydy ) ) { nodeList[1 - pqIndex].push( nodeList[pqIndex].front() ); nodeList[pqIndex].pop(); } nodeList[pqIndex].pop(); // remove the wanted node // empty the larger size nodeList to the smaller one if( nodeList[pqIndex].size() > nodeList[ 1 - pqIndex ].size() ) pqIndex = 1 - pqIndex; while( !nodeList[pqIndex].empty() ) { nodeList[1-pqIndex].push(nodeList[pqIndex].front()); nodeList[pqIndex].pop(); } pqIndex = 1 - pqIndex; nodeList[pqIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Just right) From what I read about Java's documentation, I came up with the conclusion: C++'s std::queue<T>::front() == Java's LinkedList<T>.peek() Java's LinkedList<T>.pop() == C++'s std::queue<T>::front() + std::queue<T>::pop() What might I be missing in my Java version? In what way does it became different algorithmically from the C++ version?

    Read the article

  • Can't unwrap Optional.None tableviewcell

    - by Mathew Padley
    I've a table view that has a custom table view cell in it. My problem is that when i try and assign a value to a variable in the custom table view cell I get the stated error. Now, I think its because the said variable is not initialised, but its got me completely stumped. This is the custom table cell: import Foundation import UIKit class LocationGeographyTableViewCell: UITableViewCell { //@IBOutlet var Map : MKMapView; @IBOutlet var AddressLine1 : UILabel; @IBOutlet var AddressLine2 : UILabel; @IBOutlet var County : UILabel; @IBOutlet var Postcode : UILabel; @IBOutlet var Telephone : UILabel; var location = VisitedLocation(); func Build(location:VisitedLocation) -> Void { self.location = location; AddressLine1.text = "test"; } } My cell for row at index path is: override func tableView(tableView: UITableView!, cellForRowAtIndexPath indexPath: NSIndexPath!) -> UITableViewCell! { var addressCell = tableView.dequeueReusableCellWithIdentifier("ContactDetail") as? LocationGeographyTableViewCell; if !addressCell { addressCell = LocationGeographyTableViewCell(style: UITableViewCellStyle.Value1, reuseIdentifier: "ContactDetail"); } addressCell!.Build(Location); return addressCell; } As I say I'm completely baffled, the Build function calls the correct function in the tableviewcell. Any help will be gratefully appreciated. Ta

    Read the article

  • Windows Phone - failing to get a string from a website with login information

    - by jumantyn
    I am new to accessing web services with Windows Phone 7/8. I'm using a WebClient to get a string from a php-website. The site returns a JSON string but at the moment I'm just trying to put it into a TextBox as a normal string just to test if the connection works. The php-page requires an authentication and I think that's where my code is failing. Here's my code: WebClient client = new WebClient(); client.Credentials = new NetworkCredential("myUsername", "myPassword"); client.DownloadStringCompleted += new DownloadStringCompletedEventHandler(client_DownloadStringCompleted); client.DownloadStringAsync(new Uri("https://www.mywebsite.com/ba/php/jsonstuff.php")); void client_DownloadStringCompleted(object sender, DownloadStringCompletedEventArgs e) { try { string data = e.Result; this.jsonText.Text = data; } catch (Exception ex) { System.Diagnostics.Debug.WriteLine(ex.Message); } } This returns first a WebException and then a TargetInvocationException. If I replace the Uri with for example "http://www.google.com/index.html" the jsonText TextBox gets filled with html text from Google (oddly enough, this also works even when the WebClient credentials are still set). So is the problem in the setting of the credentials? I couldn't find any good results when searching for guides on how to access php-pages with credentials, only without them. Then I found a short mention somewhere to use the WebClient.Credentials property. But should it work some other way? Update: here's what I can get out of the WebException (sorry for the bad formatting): System.Net.WebException: The remote server returned an error: NotFound. ---System.Net.WebException: The remote server returned an error: NotFound. at System.Net.Browser.ClientHttpWebRequest.InternalEndGetResponse(IAsyncResult asyncResult) at System.Net.Browser.ClientHttpWebRequest.<c_DisplayClasse.b_d(Object sendState) at System.Net.Browser.AsyncHelper.<c_DisplayClass1.b_0(Object sendState) --- End of inner exception stack trace --- at System.Net.Browser.AsyncHelper.BeginOnUI(SendOrPostCallback beginMethod, Object state) at System.Net.Browser.ClientHttpWebRequest.EndGetResponse(IAsyncResult asyncResult) at System.Net.WebClient.GetWebResponse(WebRequest request, IAsyncResult result) at System.Net.WebClient.DownloadBitsResponseCallback(IAsyncResult result)

    Read the article

  • A little confused about MVC and where to put a database query

    - by jax
    OK, so my Joomla app is in MVC format. I am still a little confused about where to put certain operations, in the Controller or in the Model. This function below is in the controller, it gets called when &task=remove. Should the database stuff be in the Model? It does not seem to fit there because I have two models editapp (display a single application) and allapps (display all the applications), now which one would I put the delete operation in? /** * Delete an application */ function remove() { global $mainframe; $cid = JRequest::getVar( 'cid', array(), '', 'array' ); $db =& JFactory::getDBO(); //if there are items to delete if(count($cid)){ $cids = implode( ',', $cid ); $query = "DELETE FROM #__myapp_apps WHERE id IN ( $cids )"; $db->setQuery( $query ); if (!$db->query()){ echo "<script> alert('".$db->getErrorMsg()."');window.history.go(-1); </script>\n"; } } $mainframe->redirect( 'index.php?option=' . $option . '&c=apps'); } I am also confused about how the flow works. For example, there is a display() function in the controller that gets called by default. If I pass a task, does the display() function still run or does it go directly to the function name passed by $task?

    Read the article

  • CSS "Cover" - No scroll bars?

    - by Lynda
    I am using the cover property to create a background image that fills the background and resizes with the browser. But I run into one issue, the page has a lot of content and no scroll bars appear for me to scroll down! Here is the code I am using: body{ background: url(path.jpg) no-repeat center center fixed; -webkit-background-size: cover; -moz-background-size: cover; -o-background-size: cover; /* Cover for IE 7/8 */ filter: progid:DXImageTransform.Microsoft.AlphaImageLoader(src='path.jpg', sizingMethod='scale'); -ms-filter: progid:DXImageTransform.Microsoft.AlphaImageLoader(src='path.jpg', sizingMethod='scale'); /* End Cover for IE 7/8 */ background-size: cover; background-color: transparent !important; position:fixed; top: 0; left: 0; width: 100%; height:100%; max-width:2500px; max-height:1500px; z-index:1; } If I remove position:fixed; I get the scroll bars back but the background image disappears. What is the best way to tackle this and have both scroll bars and the background cover image? Note: I am using jQuery and would use a JS answer if it works (though I prefer a CSS only answer.)

    Read the article

  • structDelete doesn't effect the shallow copy?

    - by Travis
    I was playing around onError so I tried to create an error using a large xml document object. <cfset variables.XMLByRef = variables.parsedXML.XMLRootElement.XMLChildElement> <cfset structDelete(variables.parsedXML, "XMLRootElement")> <cfset variables.startXMLShortLoop = getTickCount()> <cfloop from = "1" to = "#arrayLen(variables.XMLByRef)#" index = "variables.i"> <cfoutput>#variables.XMLByRef[variables.i].id.xmltext#</cfoutput><br /> </cfloop> <cfset variables.stopXMLShortLoop = getTickCount()> I expected to get an error because I deleted the structure I was referencing. From LiveDocs: Variable Assignment - Creates an additional reference, or alias, to the structure. Any change to the data using one variable name changes the structure that you access using the other variable name. This technique is useful when you want to add a local variable to another scope or otherwise change a variable's scope without deleting the variable from the original scope. instead I got 580df1de-3362-ca9b-b287-47795b6cdc17 25a00498-0f68-6f04-a981-56853c0844ed ... ... ... db49ed8a-0ba6-8644-124a-6d6ebda3aa52 57e57e28-e044-6119-afe2-aebffb549342 Looped 12805 times in 297 milliseconds <cfdump var = "#variables#"> Shows there's nothing in the structure, just parsedXML.xmlRoot.xmlName with the value of XMLRootElement. I also tried <cfset structDelete(variables.parsedXML.XMLRootElement, "XMLChildElement")> as well as structClear for both. More information on deleting from the xml document object. http://help.adobe.com/en_US/ColdFusion/9.0/Developing/WSc3ff6d0ea77859461172e0811cbec22c24-78e3.html Can someone please explain my faulty logic? Thanks.

    Read the article

  • using facelet1.1.15 (external facelet) in JSF2

    - by Odelya
    Hi! I have upgrated to JSF2 but still running with facelet1.1.15. I have these parameters in web.xml: <context-param> <param-name>org.ajax4jsf.VIEW_HANDLERS</param-name> <param-value>com.sun.facelets.FaceletViewHandler</param-value> </context-param> <context-param> <param-name>javax.faces.DISABLE_FACELET_JSF_VIEWHANDLER</param-name> <param-value>true</param-value> </context-param> I am trying to create my own componet step by step of this example : http://www.ibm.com/developerworks/java/library/j-jsf2fu2/index.html#tip3 everything looks fine but i get an error that it doesn't recognize the tag. Has it got to do with the facelet 1.1.15? and it works only with VDL? it there a way to use 1.1.15 and custom components in JSF2? As well - I use tomcat 6

    Read the article

  • Django Datetime field question

    - by Shehzad009
    Hello I have been having a problem with django while trying to work with datetime. In my webapp I have a table like so when I run server. ID Owing 1 -100 (All the same value) 2 -100 3 -100 . . . . . . It has in one column Invoice id and the other owing. One-one relationship as well. sow for example owing value for 1 is 100. Unfortunately, this is where it all goes wrong because throughout column (Owing), it is giving me the owing value for ID=1. I want each ID to give me their owing value. Here is my view. I also wonder if I may need a for loop somewhere as well. def homepage(request): invoices_list = Invoice.objects.all() invoice_name = invoices_list[0].client_contract_number.client_number.name invoice_gross = invoices_list[0].invoice_gross payment_date = invoices_list[0].payment_date if payment_date <= datetime.now(): owing = invoice_gross if payment_date > datetime.now(): owing = 0 else: owing= 0 return render_to_response(('index.html', locals()), {'invoices_list': invoices_list ,'invoice_number':invoice_number, 'invoice_name':invoice_name, 'invoice_gross':invoice_gross, 'payment_date':payment_date, 'owing': owing}, context_instance=RequestContext(request)) EDIT: Here is my template. The thing is the function owing is not in my models so saying {{invoices.owing}} wont work. {% for invoices in invoices_list %} <tr> <td>{{invoices.invoice_number}}</td> <td>{{invoices.invoice_contact}}</td> <td>{{invoices.client_contract_number}}</td> <td>{{invoices.payment_date|date:"d M Y"}}</td> <td>{{invoices.invoice_gross}}</td> <td>{{owing}}</td> {% endfor %}

    Read the article

  • qTip pop ups come in from top left of screen (on first load)

    - by franko75
    Hi, not sure if i'm set things up incorrectly - I don't seem to see anyone else with this problem, but my qTip popups (all ajax loaded content) are loading quite erratically, in that they are often animating in from off screen before appearing in the correct position. Is there a simple solution to this which I may have missed? Thanks again for your help. HTML markup: <span class="formInfo"> <a href="http://localhost/httpdocs/index.php/help/kc_dob" class="jTip" name="" id="dob_help">?</a> </span> qTip initialisation.. //set up for qtip function initQtip() { $('a.jTip').each(function() { $(this).qtip( { content: { // Set the text to an image HTML string with the correct src URL to the loading image you want to use text: '<img src="/media/images/wait.gif" alt="Loading..." />', url: $(this).attr('href') // Use the rel attribute of each element for the url to load }, position: { adjust: { screen: true // Keep the tooltip on-screen at all times } }, show: { when: 'click', solo: true // Only show one tooltip at a time }, hide: 'unfocus', style: { tip: true, // Apply a speech bubble tip to the tooltip at the designated tooltip corner border: { width: 10, radius: 10 }, width: { min: 200, max: 500 }, name: 'light' // Use the default light style } }); //prevent default event on click }).bind('click', function(event){ event.preventDefault(); return false; }); }

    Read the article

  • Why doesn't this PHP execute?

    - by cam
    I copied the code from this site exactly: http://davidwalsh.name/web-service-php-mysql-xml-json as follows, /* require the user as the parameter */ if(isset($_GET['user']) && intval($_GET['user'])) { /* soak in the passed variable or set our own */ $number_of_posts = isset($_GET['num']) ? intval($_GET['num']) : 10; //10 is the default $format = strtolower($_GET['format']) == 'json' ? 'json' : 'xml'; //xml is the default $user_id = intval($_GET['user']); //no default /* connect to the db */ $link = mysql_connect('localhost','username','password') or die('Cannot connect to the DB'); mysql_select_db('db_name',$link) or die('Cannot select the DB'); /* grab the posts from the db */ $query = "SELECT post_title, guid FROM wp_posts WHERE post_author = $user_id AND post_status = 'publish' ORDER BY ID DESC LIMIT $number_of_posts"; $result = mysql_query($query,$link) or die('Errant query: '.$query); /* create one master array of the records */ $posts = array(); if(mysql_num_rows($result)) { while($post = mysql_fetch_assoc($result)) { $posts[] = array('post'=>$post); } } /* output in necessary format */ if($format == 'json') { header('Content-type: application/json'); echo json_encode(array('posts'=>$posts)); } else { header('Content-type: text/xml'); echo '<posts>'; foreach($posts as $index => $post) { if(is_array($post)) { foreach($post as $key => $value) { echo '<',$key,'>'; if(is_array($value)) { foreach($value as $tag => $val) { echo '<',$tag,'>',htmlentities($val),'</',$tag,'>'; } } echo '</',$key,'>'; } } } echo '</posts>'; } /* disconnect from the db */ @mysql_close($link); } And the php doesn't execute, it just displays as plain text. What's the dealio? The host supports PHP, I use it to run a Wordpress blog and other things.

    Read the article

  • Codeigniter only loads the default controller

    - by fh47331
    I am very new to CodeIgniter, but have been programming PHP for ages. I'm writing some software at the moment and using CI for the first time with it. The default controller is set to the first controller I want to action call 'login' (the controller is login.php, the view is login.php. When the form is submitted it calls the 'authenticate' controller. This executes fine, process the login data correctly and then does a redirect command (without any output to the screen prior) to the next page in this case 'newspage'. The problem is that the redirect, never reaches 'newspage' but the default controller runs again. It doesn't matter what I put ... ht tp://domain.name/anything ... (yes im using .htaccess to remove the index.php) the anything never gets called, just the default controller. I have left the standard 'welcome.php' controller and 'welcome_message.php' in the folders and even putting ht tp://domain.name/welcome all I get is the login screen! (Obviously there shouldn't be a space between the http - thats just done so it does not show as a hyperlink!) Can anyone tell me what i've done wrong!

    Read the article

  • "Function object is unsubscriptable" in basic integer to string mapping function

    - by IanWhalen
    I'm trying to write a function to return the word string of any number less than 1000. Everytime I run my code at the interactive prompt it appears to work without issue but when I try to import wordify and run it with a test number higher than 20 it fails as "TypeError: 'function' object is unsubscriptable". Based on the error message, it seems the issue is when it tries to index numString (for example trying to extract the number 4 out of the test case of n = 24) and the compiler thinks numString is a function instead of a string. since the first line of the function is me defining numString as a string of the variable n, I'm not really sure why that is. Any help in getting around this error, or even just help in explaining why I'm seeing it, would be awesome. def wordify(n): # Convert n to a string to parse out ones, tens and hundreds later. numString = str(n) # N less than 20 is hard-coded. if n < 21: return numToWordMap(n) # N between 21 and 99 parses ones and tens then concatenates. elif n < 100: onesNum = numString[-1] ones = numToWordMap(int(onesNum)) tensNum = numString[-2] tens = numToWordMap(int(tensNum)*10) return tens+ones else: # TODO pass def numToWordMap(num): mapping = { 0:"", 1:"one", 2:"two", 3:"three", 4:"four", 5:"five", 6:"six", 7:"seven", 8:"eight", 9:"nine", 10:"ten", 11:"eleven", 12:"twelve", 13:"thirteen", 14:"fourteen", 15:"fifteen", 16:"sixteen", 17:"seventeen", 18:"eighteen", 19:"nineteen", 20:"twenty", 30:"thirty", 40:"fourty", 50:"fifty", 60:"sixty", 70:"seventy", 80:"eighty", 90:"ninety", 100:"onehundred", 200:"twohundred", 300:"threehundred", 400:"fourhundred", 500:"fivehundred", 600:"sixhundred", 700:"sevenhundred", 800:"eighthundred", 900:"ninehundred", } return mapping[num] if __name__ == '__main__': pass

    Read the article

  • Issue with transparent texture on 3D primitive, XNA 4.0

    - by Bevin
    I need to draw a large set of cubes, all with (possibly) unique textures on each side. Some of the textures also have parts of transparency. The cubes that are behind ones with transparent textures should show through the transparent texture. However, it seems that the order in which I draw the cubes decides if the transparency works or not, which is something I want to avoid. Look here: cubeEffect.CurrentTechnique = cubeEffect.Techniques["Textured"]; Block[] cubes = new Block[4]; cubes[0] = new Block(BlockType.leaves, new Vector3(0, 0, 3)); cubes[1] = new Block(BlockType.dirt, new Vector3(0, 1, 3)); cubes[2] = new Block(BlockType.log, new Vector3(0, 0, 4)); cubes[3] = new Block(BlockType.gold, new Vector3(0, 1, 4)); foreach(Block b in cubes) { b.shape.RenderShape(GraphicsDevice, cubeEffect); } This is the code in the Draw method. It produces this result: As you can see, the textures behind the leaf cube are not visible on the other side. When i reverse index 3 and 0 on in the array, I get this: It is clear that the order of drawing is affecting the cubes. I suspect it may have to do with the blend mode, but I have no idea where to start with that.

    Read the article

  • get path of Array (PHP)

    - by Kawah Grafis
    i have an array input like this .. Array ( [0] => Array ( [0] => 42 ) [**42**] => Array ( [0] => 12 [1] => 14 ) [**14**] => Array ( [0] => 317 ) [317] => Array ( [0] => 319 ) [**12**] => Array ( [0] => 306 [1] => 307 ) [307] => Array ( [0] => 311 ) [306] => Array ( [0] => 309 ) ) and i want to get result array like bellow : $paths[]=array(42,12,306,309); $paths[]=array(42,12,307,311); $paths[]=array(42,14,317,319); see array input root in array input = 42 (index of array 0) 42 have child = 12, 14 12 have child = 306, 307 14 have child = 317 306 have child = 309 307 have child = 311 317 have child = 319 like this.. and output array insert into $paths $paths[0]=array(42,12,306,309); $paths[1]=array(42,12,307,311); $paths[2]=array(42,14,317,319);

    Read the article

  • Have something loaded only when JList item is visibile

    - by elvencode
    Hello, i'm implementing a Jlist populated with a lot of elements. Each element corresponds to a image so i'd like to show a resized preview of them inside each row of the list. I've implemented a custom ImageCellRenderer extending the Jlabel and on getListCellRendererComponent i create the thumbnail if there'snt any for that element. Each row corresponds to a Page class where i store the path of the image and the icon applied to the JLabel. Each Page object is put inside a DefaultListModel to populate the JList. The render code is something like this: public Component getListCellRendererComponent( JList list, Object value, int index, boolean isSelected, boolean cellHasFocus) { Page page = (Page) value; if (page.getImgIcon() == null) { System.out.println(String.format("Creating thumbnail of %s", page.getImgFilename())); ImageIcon icon = new ImageIcon(page.getImgFilename()); int thumb_width = icon.getIconWidth() > icon.getIconHeight() ? 128 : ((icon.getIconWidth() * 128) / icon.getIconHeight()); int thumb_height = icon.getIconHeight() > icon.getIconWidth() ? 128 : ((icon.getIconHeight() * 128) / icon.getIconWidth()); icon.setImage(getScaledImage(icon.getImage(), thumb_width, thumb_height)); page.setImgIcon(icon); } setIcon(page.getImgIcon()); } I was thinking that only a certain item is visibile in the List the cell renderer is called but i'm seeing that all the thumnails are created when i add the Page object to the list model. I've tried to load the items and after set the model in the JList or set the model first and after starting appending the items but the results are the same. Is there any way to load the data only when necessary or do i need to create a custom control like a JScrollPanel with stacked items inside where i check myself the visibility of each elements? Thanks

    Read the article

  • Is there a better way to change user password in cakephp using Auth?

    - by sipiatti
    Hi, I am learning cakephp by myself. I tried to create a user controller with a changepassword function. It works, but I am not sure if this is the best way, and I could not googled up useful tutorials on this. Here is my code: class UsersController extends AppController { var $name = 'Users'; function login() { } function logout() { $this->redirect($this->Auth->logout()); } function changepassword() { $session=$this->Session->read(); $id=$session['Auth']['User']['id']; $user=$this->User->find('first',array('conditions' => array('id' => $id))); $this->set('user',$user); if (!empty($this->data)) { if ($this->Auth->password($this->data['User']['password'])==$user['User']['password']) { if ($this->data['User']['passwordn']==$this->data['User']['password2']) { // Passwords match, continue processing $data=$this->data; $this->data=$user; $this->data['User']['password']=$this->Auth->password($data['User']['passwordn']); $this->User->id=$id; $this->User->save($this->data); $this->Session->setFlash('Password changed.'); $this->redirect(array('controller'=>'Toners','action' => 'index')); } else { $this->Session->setFlash('New passwords differ.'); } } else { $this->Session->setFlash('Typed passwords did not match.'); } } } } password is the old password, passwordn is the new one, password2 is the new one retyped. Is there any other, more coomon way to do it in cake?

    Read the article

  • integrating jquery with AJAX using MVC for ddl/html.dropdownlist

    - by needhelp
    the situation: a user on the page in question selects a category from a dropdown which then dynamically populates all the users of that category in a second dropdown beside it. all the data is being retrieved using LinqtoSQL and i was wondering if this can be done a) using html.dropdownlist in a strongly typed view? b) using jquery to trigger the ajax request on selected index change instead of a 'populate' button trigger? sorry i dont have code as what i was trying really wasnt working at all. I am having trouble with how to do it conceptually and programatically! will appreciate any links to examples etc greatly! thanks in advance! EDIT: this is kind of what i was trying to achieve.. first the ViewPage: <script type="text/javascript"> $(document).ready function TypeSearch() { $.getJSON("/Home/Type", null, function(data) { //dont know what to do here }); } </script> <p> <label for="userType">userType:</label> <%= Html.DropDownList("userType") %> <%= Html.ValidationMessage("userType", "*") %> <input type="submit" runat="server" onclick="TypeSearch()" /> <label for="accountNumber">accountNumber:</label> <%= Html.DropDownList("accountNumber") %> <%= Html.ValidationMessage("accountNumber", "*") %> </p> Then home controller action: public ActionResult Type() { string accountType = dropdownvalue; List<Account> accounts = userRep.GetAccountsByType(accountType).ToList(); return Json(accounts); }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Show iPad keyboard on select, focus or always (jQuery)

    - by Ryan
    I have a web app that is using jQuery to replace the RETURN key with TAB so that when I user presses return the form is not submitted but rather the cursor moves to the next text field. This works in all browsers but only 1/2 works on the iPad. On the iPad the next field is highlighted but the keyboard is hidden. How can I keep the keyboard visible or force it somehow? Here's my code (thanks to http://thinksimply.com/blog/jquery-enter-tab): function checkForEnter (event) { if (event.keyCode == 13) { currentBoxNumber = textboxes.index(this); if (textboxes[currentBoxNumber + 1] != null) { nextBox = textboxes[currentBoxNumber + 1] nextBox.focus(); nextBox.select(); event.preventDefault(); return false; } } } Drupal.behaviors.formFields = function(context) { $('input[type="text"]').focus(function() { $(this).removeClass("idleField").addClass("focusField"); }); $('input[type="text"]').blur(function() { $(this).removeClass("focusField").addClass("idleField"); }); // replaces the enter/return key function with tab textboxes = $("input.form-text"); if ($.browser.mozilla) { $(textboxes).keypress (checkForEnter); } else { $(textboxes).keydown (checkForEnter); } };

    Read the article

  • Why does my floating div push around other divs?

    - by Meke
    I have a div which has a table which has a google map. I want to place a info box within the google map external to the map, just floating on top But I can't seem to get it right, the info div just pushes around the google map despite being on top of the map... CSS .google_map { height: 270px; width: 100%; } #flightMapInfo { position: relative; float: left; z-index: 100; color: #FFFFFF; top: 30px; left: 50px; background:#5a85a5; padding: 5px; -moz-border-radius: 10px; -webkit-border-radius: 10px; } div.tabContent { border: 1px solid #c9c3ba; padding: 0.5em; background-color: #f1f0ee; min-height: 300px; } .tableLeft { width: 75%; float: left; border-right: dotted 2px black; } HTML <div class="mapBlock tabContent"> <div id="flightMapInfo">WHARGL</div> <table class="tableLeft"> <tr><td><div id="flightMap" class="google_map"></div> </table></td></tr></div>

    Read the article

  • [LaTeX] positions of page numbers, position of chapter headings, chapters AND Table of Contents, Ref

    - by kaikanmonaco
    I am writing my PhD thesis (120+ pages) in latex, the deadline is approaching and I am struggling with layout problems. I am using the documentstyle book. I am posting both problems in this one thread because I am not sure if the solution might be related to both problems or not. Problems are: 1.) The page numbers are mostly located on the top-right of each page (this is correct and where I want them to be). However, only on the first page of chapters and on the first page of what I call "special chapters", the page number is located bottom-centered. With "special chapters" I mean: List of Contents, List of Figures, List of Tables, References, Index. My university will not accept the thesis like this. The page number must ALWAYS be top-right one each page, even if the page is the first page of a chapter or the first page of something like the List of Contents. How can I fix this? 2.) On the first page of chapters and "special chapters" (List of Contents...), the chapter title is located far too low on the page. This is the standard layout of LaTeX with documentstyle book I think. However, the chapter title must start at the very top of the page! I.e. the same height as the normal text on the pages that follow. I mean the chapter title, not the header. I.e., if there is a chapter called "Chapter 1 Dynamics of foobar under mechanical stress" then that text has to start from the top the page, but right now it starts several centimeters below the top. How can I fix this? Have tried all kinds of things to no effect, I'd be very thankful for a solution! Thanks.

    Read the article

  • No event is firing when placing a custom data bound control in DataRepeater control in Windows forms

    - by Remo
    Hi, Custom events in a custom data bound control are not firing in DataRepeater control. When I debug it I found that the DataRepeater Control recreates the control using Activator.CreateInstance and Copies the Properties and Events. In my case copying events doesn't copy the custom events that I hooked in. For example public class MyClass : Control { public event EventHandler MyEvent; protected virtual void OnMyEvent() { if(this.MyEvent != null) { this.MyEvent(this,EventArgs.Empty); } } private int selectedIndex= -1; public int SelectedIndex { get { return this.selectedIndex; } set { if(this.selectedIndex != value) { this.selectedIndex = value; this.OnMyEvent(); } } } // // DataBinding stuff goes here // } public Form1() { InitialiseComponent(); ArrayList list = new ArrayList(); list.Add("one"); this.dataRepeater1.DataSource = list; // One Repeater MyClass test = new Myclass(); test.DataSource = GetDataTable(); this.dataRepeater1.ItemTemplate.Controls.Add(test); test.MyEvent +=new EventHandler(test_MyEvent); } // This Event should fire when selected index of Datatable is changed and is firing when placed directly in the form and not firing when place in DataRepeater control/////////////////////// private void test_MyEvent(object sender, EventArgss e) { // This event is not fired/////////////////////// } private DataTable GetDataTable() { ..// Create a data Table and return } Any help Appreciated. Thanks,

    Read the article

  • Echoing users by group name in PHP

    - by BobSapp
    What I want to do is click a name of a group(every group what I create other than poweruser and admin groups) and that will echo all of the users in that group from the database. I have figured out the code so far but now my problem is how will I print it all out when clicking the name of the group? My code so far is: <h3>Groups</h3> <?php include('db.php'); if (isset($_GET["groupID"])) { $sql="SELECT `group`.*, `user`.* FROM `user` inner join `group` on group.groupID=user.groupID where group.groupID= " . mysql_real_escape_string($_GET["groupID"]) ; } else { $sql="SELECT * FROM `group` WHERE groupName <> 'admin' AND groupName <> 'poweruser'" ; } $result=mysql_query($sql,$connection); while($line=mysql_fetch_array($result)){ echo "<a href='index.php?page=groups&group=".$line['groupID']."'>".$line['groupName'].'</a><br />'; } mysql_free_result($result); mysql_close($connection); ?>

    Read the article

  • OCaml delimiters and scopes

    - by Jack
    Hello! I'm learning OCaml and although I have years of experience with imperative programming languages (C, C++, Java) I'm getting some problems with delimiters between declarations or expressions in OCaml syntax. Basically I understood that I have to use ; to concatenate expressions and the value returned by the sequence will be the one of last expression used, so for example if I have exp1; exp2; exp3 it will be considered as an expression that returns the value of exp3. Starting from this I could use let t = something in exp1; exp2; exp3 and it should be ok, right? When am I supposed to use the double semicol ;;? What does it exactly mean? Are there other delimiters that I must use to avoid syntax errors? I'll give you an example: let rec satisfy dtmc state pformula = match (state, pformula) with (state, `Next sformula) -> let s = satisfy_each dtmc sformula and adder a state = let p = 0.; for i = 0 to dtmc.matrix.rows do p <- p +. get dtmc.matrix i state.index done; a +. p in List.fold_left adder 0. s | _ -> [] It gives me syntax error on | but I don't get why.. what am I missing? This is a problem that occurs often and I have to try many different solutions until it suddently works :/ A side question: declaring with let instead that let .. in will define a var binding that lasts whenever after it has been defined? What I basically ask is: what are the delimiters I have to use and when I have to use them. In addition are there differences I should consider while using the interpreter ocaml instead that the compiler ocamlc? Thanks in advance!

    Read the article

< Previous Page | 437 438 439 440 441 442 443 444 445 446 447 448  | Next Page >