Search Results

Search found 20088 results on 804 pages for 'binary search trees'.

Page 445/804 | < Previous Page | 441 442 443 444 445 446 447 448 449 450 451 452  | Next Page >

  • Escape characters in MySQL, in Ruby

    - by Swards
    I have a couple escaped characters in user-entered fields that I can't figure out. I know they are the "smart" single and double quotes, but I don't know how to search for them in mysql. The characters in ruby, when output from Ruby look like \222, \223, \224 etc irb> "\222".length => 1 So - do you know how to search for these in mysql? When I look in mysql, they look like '?'. I'd like to find all records that have this character in the text field. I tried mysql> select id from table where field LIKE '%\222%' but that did not work. Some more information - after doing a mysqldump, this is how one of the characters is represented - '\\xE2\\x80\\x99'. It's the smart single quote. Ultimately, I'm building an RTF file and the characters are coming out completely wrong, so I'm trying to replace them with 'dumb' quotes for now. I was able to do a gsub(/\222\, "'"). Thanks.

    Read the article

  • Android - Adding external library to project

    - by mmontalbo
    Hi, I am having a lot of trouble adding the WEKA library to a project I am working on. I have followed several tutorials that explain how to do this including the Android Developers guide: http://developer.android.com/guide/appendix/faq/commontasks.html#addexternallibrary and several of the postings on SO. I have created a folder in my project with the weka.jar file, created a new library (adding the weka.jar file to the library) and included this library in my build path. I have also added the library under the "Order and Export" tab in the project properties. I have also tried importing the jar file so that the actual contents of the jar are extracted into a directory in my project. The end result of all of this is that my project is able to build correctly and without error, but when it comes time to run my code on the emulator I get the following exception: 04-10 22:52:21.051: ERROR/dalvikvm(582): Could not find class 'weka.classifiers.trees.J48', referenced from method edu.usc.student.composure.classifier.GaitClassifierImpl. with J48 being the class I reference in my code. Does anyone have any additional suggestions that I may have overlooked? Thanks!

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Indexing table with duplicates MySQL/MSSQL with millions of records

    - by Tesnep
    I need help in indexing in MySQL. I have a table in MySQL with following rows: ID Store_ID Feature_ID Order_ID Viewed_Date Deal_ID IsTrial The ID is auto generated. Store_ID goes from 1 - 8. Feature_ID from 1 - let's say 100. Viewed Date is Date and time on which the data is inserted. IsTrial is either 0 or 1. You can ignore Order_ID and Deal_ID from this discussion. There are millions of data in the table and we have a reporting backend that needs to view the number of views in a certain period or overall where trial is 0 for a particular store id and for a particular feature. The query takes the form of: select count(viewed_date) from theTable where viewed_date between '2009-12-01' and '2010-12-31' and store_id = '2' and feature_id = '12' and Istrial = 0 In MSSQL you can have a filtered index to use for Istrial. Is there anything similar to this in MySQL? Also, Store_ID and Feature_ID have a lot of duplicate data. I created an index using Store_ID and Feature_ID. Although this seems to have decreased the search period, I need better improvement than this. Right now I have more than 4 million rows. To search for a particular query like the one above, it looks at 3.5 million rows in order to give me the count of 500k rows. PS. I forgot to add view_date filter in the query. Now I have done this.

    Read the article

  • can't run binaries or shell scripts

    - by hyperboreean
    I am running Debian testing and I am not able to run any binary or shell script. I keep getting "No such file or directory". The umask is the default one and I haven't fooled around with the paths. Also, I am aware of this question, but it doesn't work out for me - I compiled my code on this machine and trying to run it on the same machine. Also, all of my shell scripts have the correct shebang. Any advices?

    Read the article

  • How to setup Apache 2.2 (prefork) with mod_fcgid to test a C++ application?

    - by skyeagle
    I have written my first fastcgi application (C/C++), and I need to test it to ensure that it is behaving the way I expect it to. I have searched for examples on setting up Apache 2.2. with mod_fcgid, but all of teh tutorials etc I have seen, relate to PHP, Python, Perl etc. Is anyone aware of a resource that shows how I may setup Apache to use mod_fcgid (NOT mod_fastcgi) to test my binary? If no online resource is available (I'd be surprised), then could someone please point out the steps required to do the testing?

    Read the article

  • Hosting an Access DB

    - by Mitciv
    Hey, So I'm inexperienced in hosting DB's and I've always had the luxury of someone else getting the db setup. I was going to help a friend out with getting a webpage setup, I've got experience in Asp.Net MVC so I'm going with that. They want to setup a search page to query a db and display the results. My question I have is in getting the DB setup and hosted. They currently just have the Access DB on a local computer. There is basically only one table that would need to be queried for the search. What is the best approach to getting this table/db accessible? They would like to keep the main copy of the db on the local machine, so copying the entire db over to the hosted site would be time consuming, could the lone table needed be solely copied to the host? Should I try to convince them to make changes on the hosted db and just make copies of that for their local machines? Any suggestions are welcome, Again I'm a total noob when it comes to hosting databases. Thanks

    Read the article

  • Indexing table with duplicates MySQL/SQL Server with millions of records

    - by Tesnep
    I need help in indexing in MySQL. I have a table in MySQL with following rows: ID Store_ID Feature_ID Order_ID Viewed_Date Deal_ID IsTrial The ID is auto generated. Store_ID goes from 1 - 8. Feature_ID from 1 - let's say 100. Viewed Date is Date and time on which the data is inserted. IsTrial is either 0 or 1. You can ignore Order_ID and Deal_ID from this discussion. There are millions of data in the table and we have a reporting backend that needs to view the number of views in a certain period or overall where trial is 0 for a particular store id and for a particular feature. The query takes the form of: select count(viewed_date) from theTable where viewed_date between '2009-12-01' and '2010-12-31' and store_id = '2' and feature_id = '12' and Istrial = 0 In SQL Server you can have a filtered index to use for Istrial. Is there anything similar to this in MySQL? Also, Store_ID and Feature_ID have a lot of duplicate data. I created an index using Store_ID and Feature_ID. Although this seems to have decreased the search period, I need better improvement than this. Right now I have more than 4 million rows. To search for a particular query like the one above, it looks at 3.5 million rows in order to give me the count of 500k rows. PS. I forgot to add view_date filter in the query. Now I have done this.

    Read the article

  • object not getting released in iphone

    - by mohsinpathan
    NSString *strSql = @"select tblrecentsearch_id,xmlrequest,company,postcode,city,kilometer,date from tblrecentsearch"; returnValue = sqlite3_prepare_v2(database, [strSql UTF8String], -1, &selectStatement, NULL); if(returnValue == SQLITE_OK) { arrRecentSearch=[[NSMutableArray alloc] init]; while(sqlite3_step(selectStatement)==SQLITE_ROW) { Search *ObjSearch = [[Search alloc]init]; ObjSearch.intRecentSearchId = sqlite3_column_int(selectStatement, 0); ObjSearch.xmlRequest = [NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 1) encoding:NSUTF8StringEncoding]; ObjSearch.strCompnay=[NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 2) encoding:NSUTF8StringEncoding]; ObjSearch.strPostCode=[NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 3) encoding:NSUTF8StringEncoding]; ObjSearch.strPlace = [NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 4) encoding:NSUTF8StringEncoding]; ObjSearch.strKilometer = [NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 5) encoding:NSUTF8StringEncoding]; ObjSearch.strDate = [NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 6) encoding:NSUTF8StringEncoding]; [arrRecentSearch addObject:ObjSearch]; [ObjSearch release]; } } sqlite3_finalize(selectStatement); I want release arrRecentSearch but it will return from function . How can i realese this array. Please help me.I am fetching data from databse.

    Read the article

  • object not getting released in iphone

    - by Jaimin
    i m writing this code in my code to store the data in database.. Search *objSearchDetail = [[Search alloc] init]; objSearchDetail = [xmlResponseDetail objectAtIndex:i]; sql = "INSERT INTO tblsearchdetail(tblrecentsearch_id,name,address,email,url,street,postcode,city,telephone,mobile) VALUES(?,?,?,?,?,?,?,?,?,?)"; returnValue = sqlite3_prepare_v2(database, sql, -1, &insertStatement, NULL); if(returnValue == SQLITE_OK){ sqlite3_bind_int(insertStatement, 1, intLastRecentSearchId); sqlite3_bind_text(insertStatement, 2, [objSearchDetail.strName UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 3, [objSearchDetail.strAddress UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 4, [objSearchDetail.strEmail UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 5, [objSearchDetail.strUrl UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 6, [objSearchDetail.strStreet UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 7, [objSearchDetail.strPostCode UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 8, [objSearchDetail.strPlace UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 9, [objSearchDetail.strTelephone UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 10, [objSearchDetail.strMobile UTF8String], -1,SQLITE_TRANSIENT); if(sqlite3_step(insertStatement)==SQLITE_DONE) { //Data; } } NSLog(@"count %d",[objSearchDetail retainCount]); [objSearchDetail release]; now the nslog shows refrence count as 2 so even if i release the refrence count will still be one and the object will not be destroyed.. plz help me....

    Read the article

  • How to make checkboxes have the same submit behavior as other inputs?

    - by Tim Santeford
    I have a search form where several checkboxes are checked by default. When the form submits, as a GET, the url will only contain the list of checkboxes that were left checked. http://www.example.com/page/?checkbox1=yes&checkbox2=yes It is difficult with this scenario to determine the difference between when a user first arrives at this search page and when they submit the form with all checkboxes unchecked because the querystrings look the same. To combat this problem I have started injecting a hidden field before the checkbox with the same name and a 'no' value. When the checkbox is unchecked the browser will send the hidden field's no value and when the checkbox is set then the browser is overriding the hidden field with the checkbox's 'yes' value. <input type="hidden" name="checkbox1" value="no" /> <input type="checkbox" name="checkbox1" value="yes" /> when the user submits the form with all checkboxes unchecked I get this querystring: http://www.example.com/page/?checkbox1=no&checkbox2=no This seems to work on ff, chrome, ie5.5+ so I'am I safe in using this method or is there a better way to make checkboxes submit like inputs and selects?

    Read the article

  • Error: '$viewMap[...]' is null or not an object

    - by DK
    My jQuery/Javascript knowledge is limited I'm afraid. I have a "how did you hear about us" dropdown on a form. However, I get the following Javascript error on change: Error: '$viewMap[...]' is null or not an object My dropdown looks like this: <select onchange="setSourceID(this.value)" name="sourceID" id="sourceID" class="required"> <option value="" selected="selected">Please choose&#8230;</option> <option value="National Paper">National Paper</option> <option value="Magazine">Magazine</option> <option value="Regional Paper">Regional Paper</option> <option value="9682">Internet Search</option> <option value="9684">Recommendation</option> <option value="9683">Other</option> </select> <!-- some additional dropdowns below that appear based on what's selected above --> <select onchange="setSourceID(this.value)" name="referrerName[]" id="referrer1" class="smartField"> <option value="" selected="selected">Please choose&#8230;</option> <option value="The Times">The Times</option> etc... </select> and so on... My Javascript looks like this: $(document).ready(function() { $('.smartField').hide(); $.viewMap = { '' : $([]), 'National Paper' : $('#referrer1'), 'Magazine' : $('#referrer2'), 'Regional Paper' : $('#referrer3') //'Internet Search' : $('#referrer4'), //'Recommendation' : $('#referrer5'), //'Other' : $('#referrer6') }; $("#sourceID").bind(($.browser.msie ? "click" : "change"), function () { $.each($.viewMap, function() { this.hide(); }); // hide all $.viewMap[$(this).val()].show(); // show current }); }); Does anybody have any idea where I'm going wrong? Any help very much appreciated.

    Read the article

  • Computer Science taxonomy

    - by Bakhtiyor
    I am developing web application where users have collection of tags. I need to create a suggestion list for users based on the similarity of their tags. For example, when a user logs in to the system, system gets his tags and search these tags in the DB of users and showing users who have similar tags. For instance if User 1 has following tags [Linux, Apache, MySQL, PHP] and User 2 has [Windows, IIS, PHP, MySQL] it says that User 2 matchs User 1 with a weight of 50%, because he has 2 similar tags(PHP and MySQL). But imagine the situation where User 1 has [ASP, IIS, MS Access] and User 2 has [PHP, Apache, MySQL]. In this situation my system doesn't suggest User 2 as a "friend" to User 1 or vice versa. But we now that these two users has similarity on the the field of work, both works on Web Technology (or Web Programming, etc). So, that is why I need kind of taxonomy of computer science (right now, but probably I would need taxonomy of other fields also, like medicine, physics, mathematics, etc.) where these concepts are categorized and so that when I search for similarity of ASP and PHP, for example, it can say that they have similarity and belong into one group(or category). I hope I described my problem clearly, but if something wrong explained would be happy for your corrections. Thanks

    Read the article

  • How to autostart service in ANY linux?

    - by user329115
    I need to install the dumbest possible service (a binary) and have it reliably run as the current user at boot (or login, whatever) at as many platforms as possible (of the aging point-of-sale type). The app monitors another archives generated by another app in the user-session. Startup alternatives considered: init.d @reboot in crontab a .desktop file in ~/.config/autostart a myriad of other solutions including .profile and .bashrc All of the above break down at some point. The problems stem from not wanting to run as root (I want the files generated to be user-accessible), and not having a way to reliably get the current user name in sudo on all platforms. Ideally not even sudo can be assumed available. Hey, I just want to run something on boot and I have "root" power to do so. Windows get the job done easily enough. This isn't rocket science, is it?

    Read the article

  • case insenstive string replace that correctly works with ligatures like "ß" <=> "ss"

    - by usr
    I have build a litte asp.net form that searches for something and displays the results. I want to highlight the search string within the search results. Example: Query: "p" Results: a<b>p</b>ple, banana, <b>p</b>lum The code that I have goes like this: public static string HighlightSubstring(string text, string substring) { var index = text.IndexOf(substring, StringComparison.CurrentCultureIgnoreCase); if(index == -1) return HttpUtility.HtmlEncode(text); string p0, p1, p2; text.SplitAt(index, index + substring.Length, out p0, out p1, out p2); return HttpUtility.HtmlEncode(p0) + "<b>" + HttpUtility.HtmlEncode(p1) + "</b>" + HttpUtility.HtmlEncode(p2); } I mostly works but try it for example with HighlightSubstring("ß", "ss"). This crashes because in Germany "ß" and "ss" are considered to be equal by the IndexOf method, but they have different length! Now that would be ok if there was a way to find out how long the match in "text" is. Remember that this length can be != substring.Length. So how do I find out the length of the match that IndexOf produces in the presence of ligatures and exotic language characters (ligatures in this case)?

    Read the article

  • lists searches in SYB or uniplate haskell

    - by Chris
    I have been using uniplate and SYB and I am trying to transform a list For instance type Tree = [DataA] data DataA = DataA1 [DataB] | DataA2 String | DataA3 String [DataA] deriving Show data DataB = DataB1 [DataA] | DataB2 String | DataB3 String [DataB] deriving Show For instance, I would like to traverse my tree and append a value to all [DataB] So my first thought was to do this: changeDataB:: Tree -> Tree changeDataB = everywhere(mkT changeDataB') chanegDataB'::[DataB] -> [DataB] changeDataB' <add changes here> or if I was using uniplate changeDataB:: Tree -> Tree changeDataB = transformBi changeDataB' chanegDataB'::[DataB] -> [DataB] changeDataB' <add changes here> The problem is that I only want to search on the full list. Doing either of these searches will cause a search on the full list and all of the sub-lists (including the empty list) The other problem is that a value in [DataB] may generate a [DataB], so I don't know if this is the same kind of solution as not searching chars in a string. I could pattern match on DataA1 and DataB3, but in my real application there are a bunch of [DataB]. Pattern matching on the parents would be extensive. The other thought that I had was to create a data DataBs = [DataB] and use that to transform on. That seems kind of lame, there must be a better solution.

    Read the article

  • Speed/expensive of SQLite query vs. List.contains() for "in-set" icon on list rows

    - by kpdvx
    An application I'm developing requires that the app main a local list of things, let's say books, in a local "library." Users can access their local library of books and search for books using a remote web service. The app will be aware of other users of the app through this web service, and users can browse other users' lists of books in their library. Each book is identified by a unique bookId (represented as an int). When viewing books returned through a search result or when viewing another user's book library, the individual list row cells need to visually represent if the book is in the user's local library or not. A user can have at most 5,000 books in the library, stored in SQLite on the device (and synchronized with the remote web service). My question is, to determine if the book shown in the list row is in the user's library, would it be better to directly ask SQLite (via SELECT COUNT(*)...) or to maintain, in-memory, a List or int[] array of some sort containing the unique bookIds. So, on each row display do I query SQLite or check if the List or int[] array contains the unique bookId? Because the user can have at most 5,000 books, each bookId occupies 4 bytes so at most this would use ~ 20kB. In thinking about this, and in typing this out, it seems obvious to me that it would be far better for performance if I maintained a list or int[] array of in-library bookIds vs. querying SQLite (the only caveat to maintaining an int[] array is that if books are added or removed I'll need to grow or shrink the array by hand, so with this option I'll most likely use an ArrayList or Vector, though I'm not sure of the additional memory overhead of using Integer objects as opposed to primitives). Opinions, thoughts, suggestions?

    Read the article

  • WSO2 Installation Stops

    - by Nik
    I am only trying to get WSO2 Data Services to start up on an Ubuntu 10.04 LTS server. I have installed Java, set the JAVA_HOME environment variable, and download the binary distribution from WSO2. When I run /opt/wso2dataservices-2.6.2/bin/wso2server.sh, everything seems to start up fine and I can start to navigate to the page. The problem is a few seconds later, the console says Killed and everything stops. Does anybody have any ideas for how I can figure out what's going on? Edit: It seems to stop when I try to access the page, but not on its own.

    Read the article

  • Javascript Regex: Testing string for intelligent query

    - by Shyam
    Hi, I have a string that holds user input. This string can contain various types of data, like: a six digit id a zipcode that contains out of 4 digits and two alphanumeric characters a name (characters only) As I am using this string to search through a database, the query type is determined on the type of search, which i want to handle serverside using JavaScript (yes, I am using JavaScript serverside). Searching on StackOverflow, brought me some interesting information, like the .test-method, which seems perfect for my needs. The test-method returns either true or false based on the evaluation on the string using a regex object. I am using this page as a reference: http://www.javascriptkit.com/jsref/regexp.shtml So I am trying to determine the zipcode, by using the following very noobish regex. var r = /[A-Za-z]{2,2}/ As far I can understand, this should limit the amount of occurrences of alphanumeric characters to a maximum of two. See beneath the output of my JavaScript console. > var r = /[A-Za-z]{2,2}/ > var x = "2233AL" > r.test(x) true > var x = "2233A" > r.test(x) false > var x = "2233ALL" > r.test(x) true /* i want this to be false */ > A little help would be really appreciated!

    Read the article

  • Getting Values from fetched Core Data

    - by user571905
    Hi there, Thanks to the wonderful people on this forum, I have overcome most of my Core Data woes. However one persists, and I'm certain it is a simple fix. I have a recipe app that parses an XML doc on load and puts the data in Core Data. Then I search that Core Data for particular recipes, ingredients, etc. Everything is working with one exception... I cannot do anything with the data I retrieve. For example, I search the core data for "eggplant" and get this at the end of the process: "<RecipeData: 0x6112a40> (entity: RecipeData; id: 0x6113880 <x-coredata:///RecipeData/tCDE9A0EE-DA3F-4BD0-AEF8-3C038586991D4> ; data: {\n ingredients = \"Eggplant|Cheese|Tomatoes|\";\n name = \"Eggplant Parm\";\n time = 40;\n})" How do I get the info out of there? I tried looping through, but that causes the app to crash: for (NSString* key in selectedRecipe) { id value = [selectedRecipe objectForKey:key]; NSLog(@"IN LOOP: %@", value); } Any suggestions? Thank you for your time.

    Read the article

  • How to make simple dicitonary J2ME

    - by batosai_fk
    Hi, I am beginner in JavaME. I'd like to make simple dicitionary. The source data is placed on "data.txt" file in "res" directory. The structure is like this: #apple=kind of fruit; #spinach=kind of vegetable; The flow is so simple. User enters word that he want to search in a text field, e.g "apple", system take the user input, read the "data.txt", search the matched word in it, take corresponding word, and display it to another textfield/textbox. I've managed to read whole "data.txt" using this code.. private String readDataText() { InputStream is = getClass().getResourceAsStream("data.txt"); try { StringBuffer sb = new StringBuffer(); int chr, i=0; while ((chr = is.read()) != -1) sb.append((char) chr); return sb.toString(); } catch (Exception e) { } return null; } but I still dont know how to split it, find the matched word with the user input and take corresponding word. Hope somebody willing to share his/her knowledge to help me.. Add to batosai_fk's Reputation

    Read the article

  • Best way to copy large amount of data between partitions

    - by skinp
    I'm looking to transfer data across 2 lv of an HP-UX server. I have a couple of those transfers to do, some of which are mostly binary (Oracle tablespace...) and some others are more text files (logs...). Used data size of the volumes is between 100Gb and 1Tb. Also, I will be changing the block size from 1K to 8K on some of these partitions... Things I'm looking for: Guarantees data integrity Fastest data transfer speed Keeps file ownership and permissions Right now, I've thought about dd, cp and rsync, but I'm not sure on the best one to use and the best way to use them...

    Read the article

  • Run a script as root from apache

    - by Lord Loh.
    I would like to update my hosts file and restart dnsmasq from a web interface (php/apache2). I tried playing around with suid bits (the demonstaration). I have both apache and dnsmasq running on an EC2 instance. I understand that Linux ignores the setuid bit on text scripts, but works on binary files. (Have I got something wrong?). I added exec("whoami"); to the example C program in Wikipedia. Although the effective UID of the C program is 0, whoami does not return root :-( I would thoroughly like to avoid echo password | sudo service dnsmasq restart or adding apache to the sudoers without password! Is there a way out? How does webmin do such things?

    Read the article

  • Concept: Information Into Memory Location.

    - by Richeve S. Bebedor
    I am having troubles conceptualizing an algorithm to be used to transform any information or data into a specific appropriate and reasonable memory location in any data structure that I will be devising. To give you an idea, I have a JPanel object instance and I created another Container type object instance of any subtype (note this is in Java because I love this language), then I collected those instances into a data structure not specifically just for those instances but also applicable to any type of object. Now my procedure for fetching those data again is to extract the object specific features similar in category to all object in that data structure and transform it into a integer data memory location (specifically as much as possible) or any type of data that will pertain to this transformation. And I can already access that memory location without further sorting or applications of O(n) time complex algorithms (which I think preferable but I wanted to do my own way XD). The data structure is of any type either binary tree, linked list, arrays or sets (and the like XD). What is important is I don't need to have successive comparing and analysis of data just to locate information in big structures. To give you a technical idea, I have to an array DS that contains JLabel object instance with a specific name "HelloWorld". But array DS contains other types of object (in multitude). Now this JLabel object has a location in the array at index [124324] (which is if you do any type of searching algorithm just to arrive at that location is conceivably slow because added to it the data structure used was an array *note please disregard the efficiency of the data structure to be used I just want to explain to you my concept XD). Now I want to equate "HelloWorld" to 124324 by using a conceptually made function applicable to all data types. So that I can do a direct search by doing this DS[extractLocation("HelloWorld")] just to get that JLabel instance. I know this may sound crazy but I want to test my concept of non-sorting feature extracting search algorithm for any data structure wherein my main problem is how to transform information to be stored into memory location of where it was stored.

    Read the article

  • Python Webkit browser's inspector is missing a few things

    - by NoBugs
    I'm using a Webkit browser inspector like this. When I run it in Ubuntu 12.10, I'm getting errors when using the inspector. For example: ** Message: console message: file:///usr/share/webkitgtk-1.0/webinspector/UIString.js @42: Localized string "Go to line" not found. ** Message: console message: file:///usr/share/webkitgtk-1.0/webinspector/UIString.js @42: Localized string "Filter" not found. ** Message: console message: file:///usr/share/webkitgtk-1.0/webinspector/UIString.js @42: Localized string "Search Previous" not found. ** Message: console message: file:///usr/share/webkitgtk-1.0/webinspector/UIString.js @42: Localized string "Search Next" not found. ** Message: console message: file:///usr/share/webkitgtk-1.0/webinspector/UIString.js @42: Localized string "a:" not found. ** Message: console message: file:///usr/share/webkitgtk-1.0/webinspector/UIString.js @42: Localized string "%d of %d" not found. (geany:2487): Gdk-CRITICAL **: IA__gdk_error_trap_pop: assertion `gdk_error_traps != NULL' failed ** Message: console message: file:///usr/share/webkitgtk-1.0/webinspector/UIString.js @42: Localized string "Sources Panel" not found. ** Message: console message: file:///usr/share/webkitgtk-1.0/webinspector/UIString.js @42: Localized string "Toggle breakpoint" not found. ** Message: console message: file:///usr/share/webkitgtk-1.0/webinspector/UIString.js @42: Localized string "Painting" not found. I also noticed the breadcrumb/slider bar doesn't show when you have the console in the lower half: I don't remember this in earlier versions, and when I use the GTK3 version (from gi.repository import WebKit etc) it has similar problem, and is even worse, scrollbars don't have arrows at top and bottom. Am I missing a step on initializing the Webkit inspector or English locale for it? I would like to debug this issue, but since the inspector object isn't a webview object, I'm not sure I can add an inspector to the inspector? (like how you can use F12 when inspector is its own window in Chrome/Chromium, which lets you debug that inspector). It should be possible, but maybe not with pyGTK?

    Read the article

< Previous Page | 441 442 443 444 445 446 447 448 449 450 451 452  | Next Page >