Search Results

Search found 17195 results on 688 pages for 'input'.

Page 445/688 | < Previous Page | 441 442 443 444 445 446 447 448 449 450 451 452  | Next Page >

• Trying to issue a mouseclick event on a QWebElement in QWebView QtWebKit

  - by Bad Man

  I'm trying to send a mouse click event on a certain element in the QtWebKit DOM but I'm obviously doing it wrong: QWebElement el=this->page()->mainFrame()->findFirstElement("input[type=submit]"); el.setFocus(); QMouseEvent pressEvent(QMouseEvent::MouseButtonPress, el.geometry().center(), Qt::MouseButton::LeftButton, Qt::LeftButton, Qt::NoModifier); QCoreApplication::sendEvent(this->page()->mainFrame(), &pressEvent); QMouseEvent releaseEvent(QMouseEvent::MouseButtonRelease, el.geometry().center(), Qt::MouseButton::LeftButton, Qt::LeftButton, Qt::NoModifier); QCoreApplication::sendEvent(this->page()->mainFrame(), &releaseEvent); Any ideas? (p.s. I am extending QWebView if it wasn't obvious)

  Read the article

• .net activeX object

  - by Ali YILDIRIM

  Hi, I am trying to use my .net image editor user control as an activeX object in a web form. After internet search, I created a asp.net web site from VS2008 and added the following code <object classid="res/ImageEditor.dll#ImageEditor.Editor" height="400" width="400" id="myControl1" name="myControl1" > </object> <INPUT id="Button1" type="button" value="Btn" name="Btn" onclick="return Button1_onclick()"> </script> <script language=javascript> function Button1_onclick() { alert(document.getElementById("myControl1").WatermarkText); } </script> I have two problems 1-) When i first create the project i see the user control on browser but, after rebuilding the user control and changing the dll file at web site, the object no more appears on browser. Instead i see something like an error image. 2-) i can not access public properties. The user control is marked as "make com visible", and register for com is checked at properties.

  Read the article

• Issue with WIC image resizing on ASP.NET MVC 2

  - by Dave

  I am attempting to implement image resizing on user uploads in ASP.NET MVC 2 using a version of the method found: here on asp.net. This works great on my dev machine, but as soon as I put it on my production machine, I start getting the error 'Exception from HRESULT: 0x88982F60' which is supposed to mean that there is an issue decoding the image. However, when I use WICExplorer to open the image, it looks ok. I've also tried this with dozens of images of various sources and still get the error (though possible, I doubt all of them are corrupted). Here is the relevant code (with my debugging statements in there): MVC Controller [Authorize, HttpPost] public ActionResult Upload(string file) { //Check file extension string fx = file.Substring(file.LastIndexOf('.')).ToLowerInvariant(); string key; if (ConfigurationManager.AppSettings["ImageExtensions"].Contains(fx)) { key = Guid.NewGuid().ToString() + fx; } else { return Json("extension not found"); } //Check file size if (Request.ContentLength <= Convert.ToInt32(ConfigurationManager.AppSettings["MinImageSize"]) || Request.ContentLength >= Convert.ToInt32(ConfigurationManager.AppSettings["MaxImageSize"])) { return Json("content length out of bounds: " + Request.ContentLength); } ImageResizerResult irr, irr2; //Check if this image is coming from FF, Chrome or Safari (XHR) HttpPostedFileBase hpf = null; if (Request.Files.Count <= 0) { //Scale and encode image and thumbnail irr = ImageResizer.CreateMaxSizeImage(Request.InputStream); irr2 = ImageResizer.CreateThumbnail(Request.InputStream); } //Or IE else { hpf = Request.Files[0] as HttpPostedFileBase; if (hpf.ContentLength == 0) return Json("hpf.length = 0"); //Scale and encode image and thumbnail irr = ImageResizer.CreateMaxSizeImage(hpf.InputStream); irr2 = ImageResizer.CreateThumbnail(hpf.InputStream); } //Check if image and thumbnail encoded and scaled correctly if (irr == null || irr.output == null || irr2 == null || irr2.output == null) { if (irr != null && irr.output != null) irr.output.Dispose(); if (irr2 != null && irr2.output != null) irr2.output.Dispose(); if(irr == null) return Json("irr null"); if (irr2 == null) return Json("irr2 null"); if (irr.output == null) return Json("irr.output null. irr.error = " + irr.error); if (irr2.output == null) return Json("irr2.output null. irr2.error = " + irr2.error); } if (irr.output.Length > Convert.ToInt32(ConfigurationManager.AppSettings["MaxImageSize"]) || irr2.output.Length > Convert.ToInt32(ConfigurationManager.AppSettings["MaxImageSize"])) { if(irr.output.Length > Convert.ToInt32(ConfigurationManager.AppSettings["MaxImageSize"])) return Json("irr.output.Length > maximage size. irr.output.Length = " + irr.output.Length + ", irr.error = " + irr.error); return Json("irr2.output.Length > maximage size. irr2.output.Length = " + irr2.output.Length + ", irr2.error = " + irr2.error); } //Store scaled and encoded image and thumbnail .... return Json("success"); } The code is always failing when checking if the output stream is null (i.e. irr.output == null is true). ImageResizerResult and ImageResizer public class ImageResizerResult : IDisposable { public MemoryIStream output; public int width; public int height; public string error; public void Dispose() { output.Dispose(); } } public static class ImageResizer { private static Object thislock = new Object(); public static ImageResizerResult CreateMaxSizeImage(Stream input) { uint maxSize = Convert.ToUInt32(ConfigurationManager.AppSettings["MaxImageDimension"]); try { lock (thislock) { // Read the source image var photo = ByteArrayFromStream(input); var factory = (IWICComponentFactory)new WICImagingFactory(); var inputStream = factory.CreateStream(); inputStream.InitializeFromMemory(photo, (uint)photo.Length); var decoder = factory.CreateDecoderFromStream(inputStream, null, WICDecodeOptions.WICDecodeMetadataCacheOnDemand); var frame = decoder.GetFrame(0); // Compute target size uint width, height, outWidth, outHeight; frame.GetSize(out width, out height); if (width > height) { //Check if width is greater than maxSize if (width > maxSize) { outWidth = maxSize; outHeight = height * maxSize / width; } //Width is less than maxSize, so use existing dimensions else { outWidth = width; outHeight = height; } } else { //Check if height is greater than maxSize if (height > maxSize) { outWidth = width * maxSize / height; outHeight = maxSize; } //Height is less than maxSize, so use existing dimensions else { outWidth = width; outHeight = height; } } // Prepare output stream to cache file var outputStream = new MemoryIStream(); // Prepare JPG encoder var encoder = factory.CreateEncoder(Consts.GUID_ContainerFormatJpeg, null); encoder.Initialize(outputStream, WICBitmapEncoderCacheOption.WICBitmapEncoderNoCache); // Prepare output frame IWICBitmapFrameEncode outputFrame; var arg = new IPropertyBag2[1]; encoder.CreateNewFrame(out outputFrame, arg); var propBag = arg[0]; var propertyBagOption = new PROPBAG2[1]; propertyBagOption[0].pstrName = "ImageQuality"; propBag.Write(1, propertyBagOption, new object[] { 0.85F }); outputFrame.Initialize(propBag); outputFrame.SetResolution(96, 96); outputFrame.SetSize(outWidth, outHeight); // Prepare scaler var scaler = factory.CreateBitmapScaler(); scaler.Initialize(frame, outWidth, outHeight, WICBitmapInterpolationMode.WICBitmapInterpolationModeFant); // Write the scaled source to the output frame outputFrame.WriteSource(scaler, new WICRect { X = 0, Y = 0, Width = (int)outWidth, Height = (int)outHeight }); outputFrame.Commit(); encoder.Commit(); return new ImageResizerResult { output = outputStream, height = (int)outHeight, width = (int)outWidth }; } } catch (Exception e) { return new ImageResizerResult { error = "Create maxsizeimage = " + e.Message }; } } } Thoughts on where this is going wrong? Thanks in advance for the effort.

  Read the article

• WPF Keyboard Remapping

  - by m1dst

  Hello, I am trying to remap the input of a textbox. For example. If a user enters a N then I would like to change it to a 9. I thought it might be best to try and catch it in the PreviewKeyDown event although I will also need to process paste attempts (I can solve that bit I think). Is PreviewKeyDown a good place to start? If so, how do I send the replacement key. I know that e.Handled = true will stop the original key being processed. Thanks.

  Read the article

• C# Pragma to suppress break on thrown error

  - by Courtney de Lautour

  First off I run my applications with exceptions thrown on any error (handled or not). Second I am using a TypeConverter to convert from a user input string to the actual object. Third TypeConverter offers no TryConvert method so I'm stuck using exceptions for validation, using this rather ugly bit of code here: try { this._newValue = null; #pragma Magic_SuppressBreakErrorThrown System.Exception this._newValue = this.Converter.ConvertFromString(this._textBox.Text); #pragma Magic_ResumeBreakErrorThrown System.Exception this.HideInvalidNotification(); } catch (Exception exception) { if (exception.InnerException is FormatException) { this.ShowInvalidNotification(this._textBox.Text); } else { throw; } } I'm finding it rather distracting to have VS break execution every-time I type the - of -1, or some other invalid character. I could use something similar to this but not all the types I'm converting to have a TryParse method either. I'm hoping there may be some way to disable breaking for the section of code within the try without changing my exception settings.

  Read the article

• Integer Linear Programming Java: Multiple Open Source and Commercial tools are available. Which one

  - by Sandeep Jindal

  Hi, I need to use Integer Linear Programming API/Tool for my application. Though my application is in Java but I don’t mind calling an EXE (Tool) from Java providing input using file (MPS, etc). My search analysis is as follows: There are multiple Open Source and Commercial tools available to solve ILP Following I found and think are useful for my needs. 1. Gnu LP Kit(GLPK): I think this is the oldest and probably most stable and efficient 2. IP_Solve: Has good reviews about it. 3. JavaILP: Found this, but not much reviews about it 4. Apache Common-Math: Supports LP but not ILP, so ruled out. 5. Coin-OR Can you please suggest which one shall be the best in terms of stability, efficiency, acceptance, etc Regards Sandeep Jindal

  Read the article

• WPF DataGridTextColumn Can't type point for float data

  - by Alvin

  I had a WPF DataGrid and use DataGridTextColumn Binding to a Collection. The items in Collection had some float property. When my program launched, I modify the value of float property in DataGrid, if I type a integer value, it works well. But if I type char . for a float value, char . can't be typed. I had to type all the numbers first, and then jump to the . position to type char . to finish my input. So how can I type . in my situation? Thanks.

  Read the article

• Python-daemon doesn't kill its kids

  - by Brian M. Hunt

  When using python-daemon, I'm creating subprocesses likeso: import multiprocessing class Worker(multiprocessing.Process): def __init__(self, queue): self.queue = queue # we wait for things from this in Worker.run() ... q = multiprocessing.Queue() with daemon.DaemonContext(): for i in xrange(3): Worker(q) while True: # let the Workers do their thing q.put(_something_we_wait_for()) When I kill the parent daemonic process (i.e. not a Worker) with a Ctrl-C or SIGTERM, etc., the children don't die. How does one kill the kids? My first thought is to use atexit to kill all the workers, likeso: with daemon.DaemonContext(): workers = list() for i in xrange(3): workers.append(Worker(q)) @atexit.register def kill_the_children(): for w in workers: w.terminate() while True: # let the Workers do their thing q.put(_something_we_wait_for()) However, the children of daemons are tricky things to handle, and I'd be obliged for thoughts and input on how this ought to be done. Thank you.

  Read the article

• Extending Code Igniter Model functions to external PHP Scripts

  - by Fábio Antunes

  Hello everybody. I'm doing a small web app, which uses CKeditor for user input, and CKfinder for file management (images/flash). Those who know CKFinder, also know that the config file for CKFinder as a function named CheckAuthentication() that returns false or true, giving or not permissions to use CKFinder. This is were a Custom PHP Code checks if the user as authorization to access CKFinder or not. Well for my app I'm using Code Igniter, and of course I've created a model were i handle everything about User Permissions, Loggin, Session Cookies, etc. And i also have a function witch its propose is just to check if the user is Logged in. So I would like to know if someone knows a way that i can call the function isLoggedIn() inside the model security from inside the function CheckAuthentication() in CKFinder config file. Thanks in advance.

  Read the article

• InvokeMember("click") webBrowser help

  - by Tom

  I am trying to automate a web page via the weBrowser and the button that i'm trying to click has no ID only a value. here's the html code for it: Accept I can't useGetElementById as the button has no ID. If I do HtmlElement goButton = this.webBrowser1.Document.All["Accept"]; goButton.InvokeMember("click"); My script stops showing a nullreference error highlighting the "goButton.InvokeMember("click");" If I do var inputControls = (from HtmlElement element in webBrowser1.Document.GetElementsByTagName("input") select element).ToList(); HtmlElement submitButton = inputControls.First(x = x.Name == "Accept"); My script give me an "Sequence contains no matching element" error at the "HtmlElement submitButton" line and sometimes the page has more than one of these Accept buttons, so I would need to be able to tell the difference between each one as well or at least be able to click on one without the script breaking Any help with this will be greatly appreciated

  Read the article

• POJO's versus Cursors in Android

  - by Kilnr

  I usually tend to define the model layer of my apps using POJO's, such as Article, Comment, etc. I was about to implement an AlphabetIndexer in the adapter of one of my ListViews. Right now this adapter accepts a Collection of Articles, which I normally get from my wrapper around an SQLiteDatabase. The signature of the AlphabetIndexer constructer is as follows: public AlphabetIndexer (Cursor cursor, int sortedColumnIndex, CharSequence alphabet) Since this doesn't accept a Collection or something similar, just a Cursor, it got me wondering: maybe I shouldn't be creating objects for my model, and just use the Cursors returned from the database? So the question is, I guess: what should I do, represent data with Collections of POJO's, or just work with Cursors throughout my app? Any input?

  Read the article

• ASP.NET MVC ajax - data transfer

  - by Grienders

  How can I get result from action? I need to show the commentID on the page (aspx) after successes comment insert. controller [AcceptVerbs(HttpVerbs.Post )] public ActionResult ShowArticleByAjax(Guid id, string commentBody) { Guid commentID = Comment.InsertComment(id, commentBody); //How can I tranfer commentID to the aspx page ??? return PartialView("CommentDetails",Article.GetArticleByID(id)); } ascx <%using (Ajax.BeginForm("ShowArticleByAjax", new { id = Model.ID }, new AjaxOptions { HttpMethod = "Post", UpdateTargetId = "divCommentDetails", OnSuccess = "successAddComment", OnFailure = "failureAddComment", OnBegin = "beginAddComment" })) { %> <p> <%=Html.TextArea("commentBody", new { cols = "100%", rows = "10" })%> </p> <p> <input name="submit" type="image" src="../../Content/Images/Design/button_s.gif" id="submit" /> </p> <%} %> aspx doesn't matter

  Read the article

• Using chunked encoding in a POST request to an asmx web service on IIS 6 generates a 404

  - by user175869

  Hi, I'm using a CXF client to communicate with a .net web service running on IIS 6. This request (anonymised): POST /EngineWebService_v1/EngineWebService_v1.asmx HTTP/1.1 Content-Type: text/xml; charset=UTF-8 SOAPAction: "http://.../Report" Accept: */* User-Agent: Apache CXF 2.2.5 Cache-Control: no-cache Pragma: no-cache Host: uat9.gtios.net Connection: keep-alive Transfer-Encoding: chunked followed by 7 chunks of 4089 bytes and one of 369 bytes, generates the following output after the first chunk has been sent: HTTP/1.1 404 Not Found Content-Length: 103 Date: Wed, 10 Feb 2010 13:00:08 GMT Connection: Keep-Alive Content-Type: text/html Anyone know how to get IIS to accept chunked input for a POST? Thanks

  Read the article

• WF4 - Display workflow design in asp.net and highlight an activity

  - by jikan_the_useless

  i need to display current status of a document approval workflow task in asp.net web page with a specific activity highlighted. i have seen the visual workflow tracker example (in wf&wcf samples) but i have two issues, 1-i have to render workflow in asp.net not in a wpf app. 2-i don't need to display current status with workflow running, all activities that need to highlighted are the one that require user input. e.g. "waiting for approval from department head" etc. if i could just convert the workflow xaml to jpg after highlighting a specific activity by activity id that created a bookmark and waiting to resume the bookmark it would do the work.

  Read the article

• No-Model Formtastic Form

  - by Kevin Sylvestre

  I am looking to reproduce the following with Formtastic: <% form_tag '/search', :method => 'get' do %> <%= text_field_tag :q, params[:q] %> <% end %> So far I have: <% semantic_form_for :search, :html => { :method => :get } do |form| %> <% form.inputs do %> <%= form.input :q %> <% end %> <% end %> However, this requires access to the parameter hash using: params[:search][:q] Instead of my required: params[:q] I'd like to use Formtastic for all forms in the application I am working on, and so far I have only had problems with this one. Any ideas?

  Read the article

• Button inside text box

  - by user542719

  My code shows a button inside a textbox, but when the input value changes, the size of the text box also changes. That I don't like. Is there any solution such that the textbox size remains fixed? Or any other idea on how to create a button inside textbox? The following is my code: JPanel panel = new JPanel(); panel.setLayout( new FlowLayout(FlowLayout.CENTER, 0, 0) ); panel.add(textField); panel.add(button); panel.setBackground( textField.getBackground() ); panel.setBorder( textField.getBorder() ); textField.setBorder(null);

  Read the article

• Performing both client side and server side validation using jQuery and CodeIgniter

  - by Vasu

  What is the right way of doing both client side and server side validation using jQuery and CodeIgniter? I am using the jQuery form plugin for form submit. I would like to use jQuery validation plugin (http://docs.jquery.com/Plugins/Validation) for client side validation and CodeIgniter form validation on the server side. However the two don't seem to gel together (or I am unable to get my head around it). Can someone help please? Whether its a client side validation or server side validation, the user should see consistent UI displaying error messages next to the input fields.

  Read the article

• Django and floatformat tag

  - by Hellnar

  Hello, I want to modify / change the way the floatformat works. By default it changes the input decimal as such: {{ 1.00|floatformat }} -> 1 {{ 1.50|floatformat }} -> 1.5 {{ 1.53|floatformat }} -> 1.53 I want to change this abit as such: If there is a floating part, it should keep the first 2 floating digits. If no floating (which means .00) it should simply cut out the floating part. IE: {{ 1.00|floatformat }} -> 1 {{ 1.50|floatformat }} -> 1.50 {{ 1.53|floatformat }} -> 1.53

  Read the article

• jQuery datepicker getMinDate '+1d'

  - by Adrian Adkison

  Once I have set the minDate property of a datepicker with the convenient string syntax $(elem).datepicker('option','minDate','+1d +3m'); how can I get the date object of the minDate? To help illustrate, there is a method $(elem).datepicker('getDate'); which returns the date that is entered in the input in the format of a date object. I would like the same thing but for datepicker('getMinDate'). There is an option like this $(elem).datepicker('option','minDate'); but this returns '+1d +3m' which is not helpful. I need the actual date object to compare with another date object. Any ideas?

  Read the article

• Codeigniter and Paypal: How it works

  - by Abs

  Hello all, Two random question as I try to integerate Paypal IPN into my Codeigniter based web app. 1) Are these two lines the same? $data['pp_info'] = $this->input->post(); $data['pp_info'] = $_POST; 2) A user agrees to pay a monthly recurring fee to use your service using paypal - first payment you are aware they have paid as you get data returned from paypal. But how do you keep track if users has paid for the following months? How do you know the user has not cancelled from their paypal account? Thanks all for any help

  Read the article

• DualLayout for SharePoint 2010 WCM Quick Start

  - by svdoever

  DualLayout for SharePoint 2010 WCM is a solution to provide you with complete HTML freedom in your SharePoint Server 2010 publishing pages. In this post I provide a quick start guide to get you up and running quickly so you can try it out for yourself. This quick start creates a simple HTML5 site with a page to show-case the basics and the power of DualLayout. We will create the site in its own web application. Normally there are many things you have to do to create a clean start point for your SharePoint 2010 WCM site. All those steps will be provided in later posts. For now we want to give you the minimal set of steps to take to get DualLayout working on your machine. Create an authenticated web application with hostheader cms.html5demo.local on port 80 for the cms side of the site. Click the Create Site Collection link on the Application Created dialog box and create a Site Collection based on the Publishing Portal site template. Before we can click the site link in the Top-Level Site Successfully Created dialog we need to add the new host header cms.html5demo.local to the hosts file. Add the following line to the hosts file: 127.0.0.1        cms.html5demo.local Navigate to the site at http://cms.html5demo.local to see the out-of-the-box example Adventure Works publishing site. Download and add the DualLayout solution package designfactory.duallayout.sps2010.trial.1.2.0.0.wsp to the farm’s solution store: On the Start menu, click All Programs. Click Microsoft SharePoint 2010 Products. Click SharePoint 2010 Management Shell. At the Windows PowerShell command prompt, type the following command:Add-SPSolution -LiteralPath designfactory.duallayout.sps2010.trial.1.2.0.0.wsp In SharePoint 2010 Central Administration deploy the solution to the web application http://cms.html5demo.local. Navigate to the site at http://cms.html5demo.local, and in the Site Settings screen select Site Collection Administration > Site collection features and activate the following feature: Open the site http://cms.html5demo.local in SharePoint Designer 2010. Create a view-mode masterpage html5simple.master with the following code: html5simple.master <%@ Master language="C#" %> <%@ Register Tagprefix="SharePointWebControls" Namespace="Microsoft.SharePoint.WebControls" Assembly="Microsoft.SharePoint, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register TagPrefix="sdl" Namespace="DesignFactory.DualLayout" Assembly="DesignFactory.DualLayout, Version=1.2.0.0, Culture=neutral, PublicKeyToken=077f92bbf864a536" %>   <!DOCTYPE html> <html class="no-js">       <head>         <meta charset="utf-8" />         <meta http-equiv="X-UA-Compatible" content="IE=Edge" />         <title><SharePointWebControls:FieldValue FieldName="Title" runat="server"/></title>           <script type="text/javascript">             document.createElement('header');             document.createElement('nav');             document.createElement('article');             document.createElement('hgroup');             document.createElement('aside');             document.createElement('section');             document.createElement('footer');             document.createElement('figure');             document.createElement('time');         </script>           <asp:ContentPlaceHolder id="PlaceHolderAdditionalPageHead" runat="server"/>     </head>          <body>                  <header>             <div class="logo">Logo</div>             <h1>SiteTitle</h1>             <nav>                 <a href="#">SiteMenu 1</a>                 <a href="#">SiteMenu 2</a>                 <a href="#">SiteMenu 3</a>                 <a href="#">SiteMenu 4</a>                 <a href="#">SiteMenu 5</a>                 <sdl:SwitchToWcmModeLinkButton runat="server" Text="…"/>             </nav>             <div class="tagline">Tagline</div>             <form>                 <label>Zoek</label>                 <input type="text" placeholder="Voer een zoekterm in...">                 <button>Zoek</button>                             </form>           </header>                  <div class="content">             <div class="pageContent">                 <asp:ContentPlaceHolder id="PlaceHolderMain" runat="server" />             </div>         </div>              <footer>             <nav>                 <ul>                     <li><a href="#">FooterMenu 1</a></li>                     <li><a href="#">FooterMenu 2</a></li>                     <li><a href="#">FooterMenu 3</a></li>                     <li><a href="#">FooterMenu 4</a></li>                     <li><a href="#">FooterMenu 5</a></li>                 </ul>             </nav>             <small>Copyright &copy; 2011 Macaw</small>         </footer>     </body> </html> Note that if no specific WCM-mode master page is specified (html5simple-wcm.master), the default v4.master master page will be used in WCM-mode. Create a WCM-mode page layout html5simplePage-wcm.aspx with the following code: html5simplePage-wcm.aspx <%@ Page language="C#"     Inherits="DesignFactory.DualLayout.WcmModeLayoutPage, DesignFactory.DualLayout, Version=1.2.0.0, Culture=neutral, PublicKeyToken=077f92bbf864a536" %> <%@ Register Tagprefix="SharePointWebControls"              Namespace="Microsoft.SharePoint.WebControls"              Assembly="Microsoft.SharePoint, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register Tagprefix="WebPartPages"              Namespace="Microsoft.SharePoint.WebPartPages"              Assembly="Microsoft.SharePoint, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register Tagprefix="PublishingWebControls"              Namespace="Microsoft.SharePoint.Publishing.WebControls"              Assembly="Microsoft.SharePoint.Publishing, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register Tagprefix="PublishingNavigation" Namespace="Microsoft.SharePoint.Publishing.Navigation"              Assembly="Microsoft.SharePoint.Publishing, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <asp:Content ContentPlaceholderID="PlaceHolderPageTitle" runat="server">     <SharePointWebControls:FieldValue id="PageTitle" FieldName="Title" runat="server"/> </asp:Content> <asp:Content ContentPlaceholderID="PlaceHolderMain" runat="server"> </asp:Content> Notice the Inherits at line two. Instead of inheriting from Microsoft.SharePoint.Publishing.PublishingLayoutPage we need to inherit from DesignFactory.DualLayout.WcmModeLayoutPage. Create a view-mode page layout html5simplePage.aspx with the following code: html5simplePage.aspx html5simplePage.aspx <%@ Page language="C#"          Inherits="DesignFactory.DualLayout.ViewModeLayoutPage, DesignFactory.DualLayout,                     Version=1.2.0.0, Culture=neutral, PublicKeyToken=077f92bbf864a536" %> <%@ Register Tagprefix="SharePointWebControls"              Namespace="Microsoft.SharePoint.WebControls"              Assembly="Microsoft.SharePoint, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register Tagprefix="WebPartPages"              Namespace="Microsoft.SharePoint.WebPartPages"              Assembly="Microsoft.SharePoint, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register Tagprefix="PublishingWebControls"              Namespace="Microsoft.SharePoint.Publishing.WebControls"              Assembly="Microsoft.SharePoint.Publishing, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register Tagprefix="PublishingNavigation" Namespace="Microsoft.SharePoint.Publishing.Navigation"              Assembly="Microsoft.SharePoint.Publishing, Version=14.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <asp:Content ContentPlaceholderID="PlaceHolderAdditionalPageHead" runat="server" /> <asp:Content ContentPlaceholderID="PlaceHolderMain" runat="server">     The title of the page is: <SharePointWebControls:FieldValue id="PageTitleInContent" FieldName="Title" runat="server"/> </asp:Content> Notice the Inherits at line two. Instead of inheriting from Microsoft.SharePoint.Publishing.PublishingLayoutPage we need to inherit from DesignFactory.DualLayout.ViewModeLayoutPage. Set the html5simple.master master page as the Site Master Page Set the allowed page layouts to the Html5 Simple Page page layout and set the New Page Default Settings also to Html5 Simple Page so new created pages are also of this page layout. Note that the Html5 Simple Page page layout is initially not selectable for New Page Default Settings. Save this configuration page first after selecting the allowed page layouts, then open again and select the default new page. Under Site Actions select the New Page action. Create a page Home.aspx of the default page layout type Html5 Simple Page. Set the new created Home.aspx page as Welcome Page. Navigate to the site http://csm.html5demo.local and see the home page in the WCM display and edit mode. Select Switch to View Mode under Site Actions to see the resulting page in view-mode. Select the three dots (…) at the right side of the menu to switch back to WCM-mode. Have a look at the source view of the resulting web page and admire the clean HTML. No SharePoint specific markup or CSS files! Clean HTML in page <!DOCTYPE html> <html class="no-js">     <head>         <meta charset="utf-8" />         <meta http-equiv="X-UA-Compatible" content="IE=Edge" />         <title>Home</title>         <script type="text/javascript">             document.createElement('header');             document.createElement('nav');             document.createElement('article');             document.createElement('hgroup');             document.createElement('aside');             document.createElement('section');             document.createElement('footer');             document.createElement('figure');             document.createElement('time');         </script>              </head>          <body>                  <header>             <div class="logo">Logo</div>             <h1>SiteTitle</h1>             <nav>                 <a href="#">SiteMenu 1</a>                 <a href="#">SiteMenu 2</a>                 <a href="#">SiteMenu 3</a>                 <a href="#">SiteMenu 4</a>                 <a href="#">SiteMenu 5</a>                 <a href="/Pages/Home.aspx?DualLayout_ShowInWcmMode=true">…</a>             </nav>             <div class="tagline">Tagline</div>             <form>                 <label>Zoek</label>                 <input type="text" placeholder="Voer een zoekterm in...">                 <button>Zoek</button>                             </form>         </header>                  <div class="content">             <div class="pageContent">                      The title of the page is: Home             </div>         </div>              <footer>             <nav>                 <ul>                     <li><a href="#">FooterMenu 1</a></li>                     <li><a href="#">FooterMenu 2</a></li>                     <li><a href="#">FooterMenu 3</a></li>                     <li><a href="#">FooterMenu 4</a></li>                     <li><a href="#">FooterMenu 5</a></li>                 </ul>             </nav>             <small>Copyright &copy; 2011 Macaw</small>         </footer>     </body> </html> <!-- Macaw DesignFactory DualLayout for SharePoint 2010 Trial version --> Note the link at line 37, this link will only be rendered for authenticated users and is our way to switch back to WCM-mode. This concludes our quick start to get DualLayout up an running in a matter of minutes. And what is the result: You can have the full SharePoint 2010 WCM publishing page editing experience to manage the content in your pages. You don’t have to delve into large SharePoint specific master pages and page layouts with a lot of knowledge of the does and don'ts with respect to SharePoint controls, scripts and stylesheets. The end-user gets a clean and light HTML page. Get your fully functional, non-timebombed trial copy of DualLayout and start creating!

  Read the article

• JQuery dirtyForm not working on text boxes in ajaxToolkit:TabPanel

  - by dustinson

  I'm a newb to jQ so please forgive my ignorance. I'm using Asa Wilson's plugin jquery.dirtyform.js to prompt a user of unsaved changes before they nav away from a page (ASP.Net C# 3.5). It basically loops through all controls and appends a class and handler to each input. Controls w/i an ajaxToolkit:TabPanel are ignored, unfortunately. I'd appreciate if anyone knows of this type of error and how to resolve it short of manually manipulating each control (as I have this logic in the master page). Thank you.

  Read the article

• ASPX ajax form post help

  - by StealthRT

  Hey all, i have this peice of code that allows a user to select a jpg image, resize it and uploads it to the server driectory. The problem being is that it reloads the aspx page when it saves the image. My question is-is there any way to do this same thing but with ajax so that it doesn't leave the page after submitting it? I've done this pleanty of times with classic asp pages but never with a aspx page. Here is the code for the ASPX page: <%@ Page Trace="False" Language="vb" aspcompat="false" debug="true" validateRequest="false"%> <%@ Import Namespace=System.Drawing %> <%@ Import Namespace=System.Drawing.Imaging %> <%@ Import Namespace=System.Drawing.Text %> <%@ Import Namespace=System %> <%@ Import Namespace=System.IO %> <%@ Import Namespace=System.Web %> <%@ Import Namespace=System.ServiceProcess %> <%@ Import Namespace=Microsoft.Data.Odbc %> <%@ Import Namespace=System.Data.Odbc %> <%@ Import Namespace=MySql.Data.MySqlClient %> <%@ Import Namespace=MySql.Data %> <%@ Import Namespace=System.Drawing.Drawing2D %> <%@ Import Namespace="System.Data" %> <%@ Import Namespace="System.Data.ADO" %> <%@ Import Namespace=ADODB %> <SCRIPT LANGUAGE="VBScript" runat="server"> const Lx = 200 const Ly = 60 const upload_dir = "/img/avatar/" const upload_original = "tmpAvatar" const upload_thumb = "thumb" const upload_max_size = 256 dim fileExt dim newWidth, newHeight as integer dim l2 dim fileFld as HTTPPostedFile Dim originalimg As System.Drawing.Image dim msg dim upload_ok as boolean </script> <% Dim theID, theEmail, maleOrFemale theID = Request.QueryString("ID") theEmail = Request.QueryString("eMail") maleOrFemale = Request.QueryString("MF") randomize() upload_ok = false if lcase(Request.ServerVariables("REQUEST_METHOD"))="post" then fileFld = request.files(0) if fileFld.ContentLength > upload_max_size * 1024 then msg = "Sorry, the image must be less than " & upload_max_size & "Kb" else try fileExt = System.IO.Path.GetExtension(fileFld.FileName).ToLower() if fileExt = ".jpg" then originalImg = System.Drawing.Image.FromStream(fileFld.InputStream) if originalImg.Height > Ly then newWidth = Ly * (originalImg.Width / originalImg.Height) newHeight = Ly end if Dim thumb As New Bitmap(newWidth, newHeight) Dim gr_dest As Graphics = Graphics.FromImage(thumb) dim sb = new SolidBrush(System.Drawing.Color.White) gr_dest.SmoothingMode = System.Drawing.Drawing2D.SmoothingMode.HighQuality gr_dest.CompositingQuality = System.Drawing.Drawing2D.CompositingQuality.HighQuality gr_dest.FillRectangle(sb, 0, 0, thumb.Width, thumb.Height) gr_dest.DrawImage(originalImg, 0, 0, thumb.Width, thumb.Height) try originalImg.save(Server.MapPath(upload_dir & upload_original & fileExt), originalImg.rawformat) thumb.save(Server.MapPath(upload_dir & theID & fileExt), originalImg.rawformat) msg = "Uploaded " & fileFld.FileName & " to " & Server.MapPath(upload_dir & upload_original & fileExt) upload_ok = true File.Delete(Server.MapPath(upload_dir & upload_original & fileExt)) catch msg = "Sorry, there was a problem saving your avatar. Please try again." end try if not thumb is nothing then thumb.Dispose() thumb = nothing end if else msg = "That image does not seem to be a JPG. Upload only JPG images." end if catch msg = "That image does not seem to be a JPG." end try end if if not originalImg is nothing then originalImg.Dispose() originalImg = nothing end if end if %><head> <meta http-equiv="pragma" content="no-cache" /> </head> <html> <script type="text/javascript" src="js/jquery-1.3.min.js"></script> <form enctype="multipart/form-data" method="post" runat="server" id="sendImg"> <input type="file" name="upload_file" id="upload_file" style="-moz-opacity: 0; opacity:0; filter: alpha(opacity=0); margin-top: 5px; float:left; cursor:pointer;" onChange="$('#sendImg').submit();" > <input type="submit" value="Upload" style="visibility:hidden; display:none;"> </form> </body> </html> Any help would be great! :o) David

  Read the article

• ASP .NET: SQL Server Money Type and .NET Currency Type

  - by Rudi Ramey

  MS SQL Server's Money Data Type seems to accept a well formatted currency value with no problem (example: $52,334.50) From my research MS SQL Sever just ignores the "$" and "," characters. ASP .NET has a parameter object that has a Type/DbType property and Currency is an available option to set as a value. However, when I set the parameter Type or DbType to currency it will not accept a value like $52,334.50. I receive an error "Input string was not in a correct format." when I try to Update/Insert. If I don't include the "$" or "," characters it seems to work fine. Also, if I don't specify the Type or DbType for the parameter it seems to work fine also. Is this just standard behavior that the parameter object with its Type set to currency will still reject "$" and "," characters in ASP .NET? Here's an example of the parameter declaration (in the .aspx page): <asp:Parameter Name="ImplementCost" DbType="Currency" />

  Read the article

• String search and write into file in jython

  - by kdev

  hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

  Read the article

< Previous Page | 441 442 443 444 445 446 447 448 449 450 451 452  | Next Page >