Search Results

Search found 26977 results on 1080 pages for 'input device'.

Page 446/1080 | < Previous Page | 442 443 444 445 446 447 448 449 450 451 452 453 | Next Page >

<button type="submit"> compatibility?

- by Mark

I'd like to have a submit button that submits a different value than is displayed on the button. With <input type="submit"> you can't seem to do this. With <button type="submit"> however, these can be two different values. The question is, will it work in all browsers? Trying this test code here: <form method="get" action=""> <input type="text" name="txt"/> <button type="submit" name="btn" value="val">text</button> </form> In FF 3.6 it updates my address bar with both values appropriately (and responds to me pressing enter in the text box). In IE 8, it also accepts pressing enter, displays the text value in the address bar, but it show the button's value as a GET param at all... does that mean it's not submitting it?

Read the article
javascript ul button dropdown crashes after if doing more than 1 button

- by Apprentice Programmer

So i have a button drop down list that i want users to select a choice, and basically the button will return the users selection.Pretty straight forward, tested on jsFiddle and works great. Using ruby on rails btw, so i'm not sure if it might conflicting the way rails handle javascript actions. Heres the code: <%= form_for(@user, :html => {:class => 'form-horizontal'}) do |f| %> <fieldset> <p>Do you have experience in Business? If yes, select one of the following: <div class="input-group"> <div class="input-group-btn btn-group"> <button type="button" class="btn btn-default dropdown-toggle" data-toggle="dropdown">Select one <span class="caret"></span></button> <ul class="dropdown-menu"> <li ><a href="#">Entrepreneurship</a></li> <li ><a href="#">Investments</a></li> <li ><a href="#">Management</a></li> <li class="divider"></li> <li ><a href="#">All of the Above</a></li> </ul> </div> <%= f.text_field :years_business , :class => "form-control", :placeholder => "Years of experience" %> </div> Now there are 2 more of these, and basically what happens is that if I select an item for the first time from the dropdown list, everything works great. But the moment I select the same button/or new button, the page immediately kind of refreshes, they selected value will not show up after the list drops down and user selects a value. I viewed the page source and added additional javascript src and types, but still doesnt work. the jquery code: jQuery(function ($) { $('.input-group-btn .dropdown-menu > li:not(.divider)').click(function(){ $(this).closest('ul').prev().text($(this).text()) }) }); Any suggestions what is causing the problem?? The jsfiddle link is here: http://jsfiddle.net/w4s8u/7/

Read the article
how to use OR in jquery

- by user1493339

1st i would like to thanks all who view this and special thanks for those who answer this. today, i tested this out but it not working, so just want to know how should this code. multiple "OR" in one line $("input[name='ABC']or[name='DEF']or[name='GHI']or[name='JKL']").click(function (){ //do something }); or even put else for it like... $("input[name='ABC'][name='DEF'][name='GHI'][name='JKL']").click(function (){ //do something }else{ //do something else }); i know both code is invalid, so is that possible to code in that way? so far i code it all one by one, so my coding is very long.

Read the article
Why is Drupal writing to root and not sites/default/files?

- by Candland

I'm using Drupal 6.14 on Win7. Everything seems to work except files that should be written to sites/default/files are trying to be written to /. The site was moved from a linux installation, which is writing the files correctly. I have setup a web.config w/ the rewrite rules for drupal. Not sure what or where else I should check. Thanks for any help. <rule name="Drupal Clean URLs" stopProcessing="true"> <match url="^(.*)$" /> <conditions> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Rewrite" url="index.php?q={R:1}" appendQueryString="true" /> </rule>

Read the article
jQuery/Javascript problem with IE

- by Shadyn

I have two radio buttons each with a unique ID. When one is clicked, I would like to add $10 to a total. When the other is clicked, we go back to the original total price. My jquery looks like this: function check_ceu() { var price = <%= conference_price %>; if($('#ceu_yes').is(':checked')){ $('#total').val(parseFloat(price) + 10) } else{ $('#total').val(price) } } I have this function bound to document.ready (for page refreshes) and also the onchange handler of the radio buttons. In FF and Chrome this works fine. In IE, when the radio button with ID of "ceu_yes" is checked nothing happens, then when clicking back to the other radio button, 10 is added. So in essence, IE has the checkbox functionality reversed. Below is my code for the buttons: <input type="radio" name="ceu" id="ceu_yes" value="1" onchange="check_ceu()" /> $10 <input type="radio" name="ceu" id="ceu_no" value="0" checked="checked" onchange="check_ceu()" /> No, thank you Any ideas on this?

Read the article
IIS7 URL Redirect with Regex

- by andyjv

I'm preparing for a major overhaul of our shopping cart, which is going to completely change how the urls are structured. For what its worth, this is for Magento 1.7. An example URL would be: {domain}/item/sub-domain/sub-sub-domain-5-16-7-16-/8083770?plpver=98&categid=1027&prodid=8090&origin=keyword and redirect it to {domain}/catalogsearch/result/?q=8083710 My web.config is: <?xml version="1.0" encoding="UTF-8"?> <configuration> <system.webServer> <rewrite> <rules> <rule name="Magento Required" stopProcessing="false"> <match url=".*" ignoreCase="false" /> <conditions> <add input="{URL}" pattern="^/(media|skin|js)/" ignoreCase="false" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Rewrite" url="index.php" /> </rule> <rule name="Item Redirect" stopProcessing="true"> <match url="^item/([_\-a-zA-Z0-9]+)/([_\-a-zA-Z0-9]+)/([_\-a-zA-Z0-9]+)(\?.*)" /> <action type="Redirect" url="catalogsearch/result/?q={R:3}" appendQueryString="true" redirectType="Permanent" /> <conditions trackAllCaptures="true"> </conditions> </rule> </rules> </rewrite> <httpProtocol allowKeepAlive="false" /> <caching enabled="false" /> <urlCompression doDynamicCompression="true" /> </system.webServer> </configuration> Right now it seems the redirect is completely ignored, even though in the IIS GUI the sample url passes the regex test. Is there a better way to redirect or is there something wrong with my web.config?

Read the article
Color getAlpha() not working as intended

- by Arvy

I was making a program where I load an image and after that I do something with opaque pixels. Transparent pixels showed up as black pixels, but after some time I found the cause: Color c = new Color (input.getRGB(x, y)); Works-> if ((input.getRGB(x, y) & 0xFF000000) != 0x00000000) { do_smth();} Returns true at all times-> if (c.getAlpha() != 0) { do_smth(); } So why it does not work?

Read the article
Calling a webservice synchronously from a Silverlight 3 application?

- by Lasse V. Karlsen

I am trying to reuse some .NET code that performs some calls to a data-access-layer type service. I have managed to package up both the input to the method and the output from the method, but unfortunately the service is called from inside code that I really don't want to rewrite in order to be asynchronous. Unfortunately, the webservice code generated in Silverlight only produces asynchronous methods, so I was wondering if anyone had working code that managed to work around this? I tried the recipe found here: The Easy Way To Synchronously Call WCF Services In Silverlight, but unfortunately it times out and never completes the call. Or rather, what seems to happen is that the completed event handler is called, but only after the method returns. I am suspecting that the event handler is called from a dispatcher or similar, and since I'm blocking the main thread here, it never completes until the code is actually back into the GUI loop. Or something like that. Here's my own version that I wrote before I found the above recipe, but it suffers from the same problem: public static object ExecuteRequestOnServer(Type dalInterfaceType, string methodName, object[] arguments) { string securityToken = "DUMMYTOKEN"; string input = "DUMMYINPUT"; object result = null; Exception resultException = null; object evtLock = new object(); var evt = new System.Threading.ManualResetEvent(false); try { var client = new MinGatServices.DataAccessLayerServiceSoapClient(); client.ExecuteRequestCompleted += (s, e) => { resultException = e.Error; result = e.Result; lock (evtLock) { if (evt != null) evt.Set(); } }; client.ExecuteRequestAsync(securityToken, input); try { var didComplete = evt.WaitOne(10000); if (!didComplete) throw new TimeoutException("A data access layer web service request timed out (" + dalInterfaceType.Name + "." + methodName + ")"); } finally { client.CloseAsync(); } } finally { lock (evtLock) { evt.Close(); evt = null; } } if (resultException != null) throw resultException; else return result; } Basically, both recipes does this: Set up a ManualResetEvent Hook into the Completed event The event handler grabs the result from the service call, and signals the event The main thread now starts the web service call asynchronously It then waits for the event to become signalled However, the event handler is not called until the method above has returned, hence my code that checks for evt != null and such, to avoid TargetInvocationException from killing my program after the method has timed out. Does anyone know: ... if it is possible at all in Silverlight 3 ... what I have done wrong above?

Read the article
VC++ - Asynchronous Thread

- by JVNR

I am working on VC++ project, in that my application process a file from input path and generates 3 output "*.DAT" files in the destination path. I will FTP these DAT file to the destination server. After FTP, I need to delete only two output .DAT files the folder. I am able to delete those files, because there one Asynchronous thread running behind the process. Since the thread is running, while deleting it says, "Cannot delete, the file is used by another person". I need to stop that thread and delete the files. Multiple files can also be taken from the input path to process. Please help me in resolving this issue. Its very high priority issue for me. Please help me ASAP.

Read the article
Firefox Back Button is occaisionally breaking the back button.

- by Webjedi

Having a really frustrating time with Firefox and the back button...given this simple ASP form: <head> <title>Form 1</title> </head> <body> <form action="form2.asp" method="post"> Enter some text:<input type="text" name="thetext" id="thetext"> <input type="submit" id="submit" name="submit"> </form> </body> </html> Firefox (3.6.3) will occasionally clear the value of the text box after hitting submit and then the back button. It's unpredictable when it will strike. And it will work for dozens to hundreds of times, and then all of a sudden it stops working. Any ideas where I should start?

Read the article
Form POST or sessions?

- by eddienotizzard

If you have an item where you allow users to add comments, how can you pass which item the user is replying too? I've though of using a hidden field in a form, however this can be easily changed using plugins such as firebug: <form method="post" action="blah"> <input type="hidden" name="item_id" value="<?php echo $item_id; ?>">  <input type="submit" name="submit"> </form> Or just simply using a session: $_SESSION['item_id'] = $item_id Is there a safe way to send the item data in a form?

Read the article
Buttons created through jquery don't respond to clicks

- by Atrus

As I've come to understand using $('.whatever').click() only works for items created initially. Additional items won't respond in the correct fashion. I was then directed to using something like $('.whatever).on('click', myFunction()). However, I'm not detecting any difference, as newly created items are not called. Here is a JSFiddle demonstration my example code: http://jsfiddle.net/atrus6/zaKZN/ My initial input plus 'Kill' will work in the correct fashion, however any additional 'input + kill's will not not do anything. Am I incorrectly using .on() or is it something else?

Read the article
HTML5 Video Javascript

- by user373721

Hi, I am not experienced in Javascript, I have the following script to play video files on Andriod phone, and it works fine. <script type="text/javascript"> function PlayMyVideo(arg) { var myVideo = document.getElementById([arg]); myVideo.play(); } </script> <video id="what" src="what.mp4" poster="" /> <input type="button" onclick="PlayMyVideo('what')" value="Play" /> I am trying to write the tag on the fly: <script type="text/javascript"> function PlayVideo() { new_video = document.createElement('video'); new_video.setAttribute('scr', 'what.mp4'); new_video.play(); } </script> <input type="button" onclick="PlayVideo()" value="Play2" /> Nothing happen, would appreciate your suggestions. Thanks in advance

Read the article
preg_replace replacing with array

- by Scott

What I want to do is replace the "[replace]" in input string with the corresponding vaule in the replace array. The total number of values will change but there will always be the same number in the replace array as in input string. I have tried doing this with preg_replace and preg_replace_callback but I can't get the pattern right for [replace], I also tried using vsprintf but the % in <table width="100%"> was messing it up. All help is greatly appreciated! Replace Array: $array = array('value 1','value 2','value 3'); Input String $string = ' <table width="100%"> <tr> <td>Name:</td> <td>[replace]</td> </tr> <tr> <td>Date:</td> <td>[replace]</td> </tr> <tr> <td>Info:</td> <td>[replace]</td> </tr> </table> '; Desired Result <table width="100%"> <tr> <td>Name:</td> <td>value 1</td> </tr> <tr> <td>Date:</td> <td>value 2</td> </tr> <tr> <td>Info:</td> <td>value 3</td> </tr> </table>

Read the article
Javascript Function wont submit form..

- by Josh K

Here is my function: function processCheck() { var numberClicked = 0; var frm = document.getElementById('form'); for (var i=0; i<form.elements.length; i++) { if (frm.elements[i].checked) numberClicked++; } if(numberClicked != 8) alert('Must choose 8 Teams'); else frm.submit(); } My forms name is 'form', here is my input: echo "<input type='button' name='submit' value='Update' onclick='processCheck()' />"; When i click the button and there is anything but 8 boxes selected it displays the alert, if there is 8 boxes it does nothing (<-- The problem). I have the form action set to another page.

Read the article
How do I do Textbox Submit

- by Newb

Hello everyone, I have a search box and a buttion. currently a user enter some text and press the search button. But I want to add another feature that instead of clicking the search button people can hit enter to search. How can I do that? Here is my code sample: <form method="post" action=""> <input id="search" name="search" type="text" /> <input id="search_btn" name="search_btn" type="submit" /> </form> Thanks in advance

Read the article
move text from one div to another with javascript or mootools

- by Ke

Hi, I have two divs. I would like to move/populate the text from div id one to div id two using an onclick event. I am wondering how to do this? and also whether mootools can be used to accomplish the task or whether simple javascript is only necessary? <div id='one'> <ul> <input type="checkbox" onclick = "my_function()"/> <li>some text 1</li> <input type="checkbox" onclick = "my_function()"/> <li>some text 2</li> </ul> <div> <div id='two'> <div> Cheers in advance for any helps. Bangin my head against a brick wall here, because my javascript skillz are limited! Ke

Read the article
"Remember" last three MySql queries; Cookie, passed variable or other method?

- by Camran

I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

Read the article
Shell Sort problem

- by user191603

Show the result of running Shell Sort on the input 9,8,7,6,5,4,3,2,1 using increments { 1,3,7 }. I have done this part. the result is: 9 8 7 6 5 4 3 2 1 (original) 2 1 7 6 5 4 3 9 8 ( 7-sort ) 2 1 4 3 5 7 6 9 8 ( 3-sort ) 1 2 3 4 5 6 7 8 9 ( 1-sort ) Then the question requires me to determine the running time of Shell Sort using Shell's increments of N/2, N/4, ..., 1 for sorted input. I am not quite sure how to answer the second question as I don't understand the requirement of this question. So, would anyone give some hints to let me finish this question? Thank you for your help first!

Read the article
Unable to center text in IE but works in firefox

- by greenpool

Can somebody point out where I'm going wrong with the following code. Text inside td elements need to be centered except for Summary and Experience. This only appears to work in Firefox/chrome. In IE8 all td text are displayed as left-justified. No matter what I try it doesn't center it. Any particular reason why this would happen? Thanks. css #viewAll { font-family:"Trebuchet MS", Arial, Helvetica, sans-serif; width:100%; border-collapse:collapse; margin-left:10px; table-layout: fixed; } #viewAll td, #viewAll th { font-size:1.1em; border:1px solid #98bf21; word-wrap:break-word; text-align:center; overflow:hidden; } #viewAll tbody td{ padding:2px; } #viewAll th { font-size:1.1em; padding-top:5px; padding-bottom:4px; background-color:#A7C942; color:#ffffff; } table <?php echo '<table id="viewAll" class="tablesorter">'; echo '<thead>'; echo '<tr align="center">'; echo '<th style="width:70px;">Product</th>'; echo '<th style="width:105px;">Prob</th>'; echo '<th style="width:105px;">I</th>'; echo '<th style="width:60px;">Status</th>'; echo '<th style="width:120px;">Experience</th>'; echo '<th style="width:200px;">Technical Summary</th>'; echo '<th style="width:80px;">Record Created</th>'; echo '<th style="width:80px;">Record Updated</th>'; echo '<th style="width:50px;">Open</th>'; echo '</tr>'; echo '</thead>'; echo '<tbody>'; while ($data=mysqli_fetch_array($result)){ #limiting the summary text displayed in the table $limited_summary = (strlen($data['summary']) > 300) ? substr(($data['summary']),0,300) . '...' : $data['summary']; $limited_exp = (strlen($data['exp']) > 300) ? substr(($data['exp']),0,300) . '...' : $data['exp']; echo '<tr align="center"> <td style="width:70px; text-align:center;">'.$data['product'].'</td>'; //if value is '-' do not display as link if ($data['prob'] != '-'){ echo '<td style="width:105px;">'.$data['prob'].'</a></td>'; } else{ echo '<td style="width:105px; ">'.$data['prob'].'</td>'; } if ($data['i'] != '-'){ echo '<td style="width:105px; ">'.$data['i'].'</a></td>'; } else{ echo '<td style="width:105px; ">'.$data['i'].'</td>'; } echo'<td style="width:40px; " >'.$data['status'].'</td> <td style="width:120px; text-align:left;">'.$limited_cust_exp.'</td> <td style="width:200px; text-align:left;">'.$limited_summary.'</td> <td style="width:80px; ">'.$data['created'].'</td> <td style="width:80px; ">'.$data['updated'].'</td>'; if (isset($_SESSION['username'])){ echo '<td style="width:50px; "> <form action="displayRecord.php" method="get">'.' <input type="hidden" name="id" value="'. $data['id'].'" style="text-decoration: none" /><input type="submit" value="Open" /></form></td>'; }else{ echo '<td style="width:50px; "> <form action="displayRecord.php" method="get">'.' <input type="hidden" name="id" value="'. $data['id'].'" style="text-decoration: none" /><input type="submit" value="View" /></form></td>'; } echo '</tr>'; }#end of while echo '</tbody>'; echo '</table>'; ?>

Read the article
JavaScript not working with Chrome & Xampp!

- by Anonymous

Hi, I've been trying for a couple hours now to figure out why JavaScript wouldn't work. The code works, but here it is anyway. <script type="text/javascript"> function change(text) { document.f1.ta.value="Hi!"; } </script> <form name="f1"> <input type="textarea" id="ta"/> <input type="button" action='change("Hi!")'/> </form> When I click the button, it does nothing. When I write "document.f1.ta.value="Hi!";" in the Chrome's inspector console, it works. I am using XAMPP (for Windows) 1.7.3 Windows 7 Ultimate.

Read the article
Why does the compiler complain "while expected" when I try to add more code?

- by user1893578

Write a program with a word containing @ character as an input. If the word doesn't contain @, it should prompt the user for a word with @. Once a word with @ is read, it should output the word then terminate. This is what I have done so far: public class find { public static void main(String[] args) { System.out.println(" Please enter a word with @ "); Scanner scan = new Scanner(System.in); String bad = "@"; String word = scan.next(); do if (!word.contains(bad)) System.out.println(" Please try again "); else System.out.println(" " + word); while (!word.contains(bad)); } } I can get it to terminate after a word containing "@" is given as input, but if I try to add a Scanner to the line after "please try again", it says while expected.

Read the article
removeClass doesn't work on the second DIV tag

- by kwokwai

Hi all, I am learning JQuery and writing a simple data validation for the two fields in a HTML form: <FORM name="addpost" id="addpost" method="post" action="/add"> <TABLE BORDER=0 width="100%"> <TR> <TD>Topic</TD> <TD> <DIV ID="topic"> <INPUT type=text name="topic" id="topic" size="72" maxlength="108"/> </DIV> </TD> </TR> <TR> <TD>Comments</TD> <TD> <DIV ID="topiccontent"> <TEXTAREA rows="12" cols="48" name="content" ID="content"> </TEXTAREA> </DIV> </TD> </TR> <TR> <TD> <INPUT type="submit" value="Send"> </TD> </TR> </TABLE> </FORM> Here is the JQuery script for checking the data input from the form above: $('#addpost').submit(function(){ if($('#topic').val()==""){ $('#topic').addClass('hierror'); return false;} else{$('#topic').removeClass('hierror');} if($('#topiccontent').val()==""){ $('#topiccontent').addClass('hierror'); return false;} else{$('#topiccontent').removeClass('hierror');} }); Here is the CSS for the hierror class: .hierror{border-style:solid; border-width:12px; border-color:#FF0000;} ('#topic').removeClass('hierror') works but ('#topiccontent').removeClass('hierror') doesn't. Could you help me please?

Read the article
Splitting Nucleotide Sequences in JS with Regexp

- by TEmerson

I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

Read the article
Make a simulation using python

- by user3727759

I am new to programming and using python. What I am trying to do is create a simulation of a thermostat system by using python. Is there a way to create a program that I can input data, for example temperature and humidity values and then have python constantly plotting the data as I enter the values. This is to simulate a device gathering data and sending it to this program and having it being plotted. I have found ways to plot data by using matplotlib but I have not been able to find a way that I can input the data and have the plot upgrade constantly. Thanks any advise is appreciated.

Read the article

< Previous Page | 442 443 444 445 446 447 448 449 450 451 452 453 | Next Page >