Search Results

Search found 26977 results on 1080 pages for 'input device'.

Page 446/1080 | < Previous Page | 442 443 444 445 446 447 448 449 450 451 452 453  | Next Page >

• How do I do Textbox Submit

  - by Newb

  Hello everyone, I have a search box and a buttion. currently a user enter some text and press the search button. But I want to add another feature that instead of clicking the search button people can hit enter to search. How can I do that? Here is my code sample: <form method="post" action=""> <input id="search" name="search" type="text" /> <input id="search_btn" name="search_btn" type="submit" /> </form> Thanks in advance

  Read the article

• Couldn't match expected type - Haskell Code

  - by wvyar

  I'm trying to learn Haskell, but the small bit of sample code I tried to write is running into a fairly large amount of "Couldn't match expected type" errors. Can anyone give me some guidance as to what I'm doing wrong/how I should go about this? These are the errors, but I'm not really sure how I should be writing my code. toDoSchedulerSimple.hs:6:14: Couldn't match expected type `[t0]' with actual type `IO String' In the return type of a call of `readFile' In a stmt of a 'do' block: f <- readFile inFile In the expression: do { f <- readFile inFile; lines f } toDoSchedulerSimple.hs:27:9: Couldn't match expected type `[a0]' with actual type `IO ()' In the return type of a call of `putStr' In a stmt of a 'do' block: putStr "Enter task name: " In the expression: do { putStr "Enter task name: "; task <- getLine; return inFileArray : task } toDoSchedulerSimple.hs:34:9: Couldn't match expected type `IO ()' with actual type `[a0]' In a stmt of a 'do' block: putStrLn "Your task is: " ++ (inFileArray !! i) In the expression: do { i <- randomRIO (0, (length inFileArray - 1)); putStrLn "Your task is: " ++ (inFileArray !! i) } In an equation for `getTask': getTask inFileArray = do { i <- randomRIO (0, (length inFileArray - 1)); putStrLn "Your task is: " ++ (inFileArray !! i) } toDoSchedulerSimple.hs:41:9: Couldn't match expected type `[a0]' with actual type `IO ()' In the return type of a call of `putStr' In a stmt of a 'do' block: putStr "Enter the task you would like to end: " In the expression: do { putStr "Enter the task you would like to end: "; task <- getLine; filter (endTaskCheck task) inFileArray } toDoSchedulerSimple.hs:60:53: Couldn't match expected type `IO ()' with actual type `[String] -> IO ()' In a stmt of a 'do' block: schedulerSimpleMain In the expression: do { (getTask inFileArray); schedulerSimpleMain } In a case alternative: "get-task" -> do { (getTask inFileArray); schedulerSimpleMain } This is the code itself. I think it's fairly straightforward, but the idea is to run a loop, take input, and perform actions based off of it by calling other functions. import System.Random (randomRIO) import Data.List (lines) initializeFile :: [char] -> [String] initializeFile inFile = do f <- readFile inFile let parsedFile = lines f return parsedFile displayHelp :: IO() displayHelp = do putStrLn "Welcome to To Do Scheduler Simple, written in Haskell." putStrLn "Here are some commands you might find useful:" putStrLn " 'help' : Display this menu." putStrLn " 'quit' : Exit the program." putStrLn " 'new-task' : Create a new task." putStrLn " 'get-task' : Randomly select a task." putStrLn " 'end-task' : Mark a task as finished." putStrLn " 'view-tasks' : View all of your tasks." quit :: IO() quit = do putStrLn "We're very sad to see you go...:(" putStrLn "Come back soon!" createTask :: [String] -> [String] createTask inFileArray = do putStr "Enter task name: " task <- getLine return inFileArray:task getTask :: [String] -> IO() getTask inFileArray = do i <- randomRIO (0, (length inFileArray - 1)) putStrLn "Your task is: " ++ (inFileArray !! i) endTaskCheck :: String -> String -> Bool endTaskCheck str1 str2 = str1 /= str2 endTask :: [String] -> [String] endTask inFileArray = do putStr "Enter the task you would like to end: " task <- getLine return filter (endTaskCheck task) inFileArray viewTasks :: [String] -> IO() viewTasks inFileArray = case inFileArray of [] -> do putStrLn "\nEnd of tasks." _ -> do putStrLn (head inFileArray) viewTasks (tail inFileArray) schedulerSimpleMain :: [String] -> IO() schedulerSimpleMain inFileArray = do putStr "SchedulerSimple> " input <- getLine case input of "help" -> displayHelp "quit" -> quit "new-task" -> schedulerSimpleMain (createTask inFileArray) "get-task" -> do (getTask inFileArray); schedulerSimpleMain "end-task" -> schedulerSimpleMain (endTask inFileArray) "view-tasks" -> do (viewTasks inFileArray); schedulerSimpleMain _ -> do putStrLn "Invalid input."; schedulerSimpleMain main :: IO() main = do putStr "What is the name of the schedule? " sName <- getLine schedulerSimpleMain (initializeFile sName) Thanks, and apologies if this isn't the correct place to be asking such a question.

  Read the article

• Passing Values from a View to itself with parameters getting null values ?

  - by vsj

  Hi all, I am trying to get values from a view which i have the code below and I am taking the start date value from the view input text box and posting it back but I am still getting null except for the apikey and userkey.Here are the two views.. public ActionResult View1(string apiKey, string userId) { StartGoalViewModel vm = new StartGoalViewModel(); vm.ApiKey = apiKey; vm.UserId = userId; vm.GoalTypeId =1; vm.StartDate = null; return View(vm); } VIEW1.ASPX <% Html.BeginForm(); %> <%= Html.TextBox("name", Model.StartDate) %> <input type="submit" value="Start" /> <% Html.EndForm(); %> [HttpPost] public ActionResult VIEW1 (StartGoalViewModel fm) { // I get StartDate null... }

  Read the article

• Why is Drupal writing to root and not sites/default/files?

  - by Candland

  I'm using Drupal 6.14 on Win7. Everything seems to work except files that should be written to sites/default/files are trying to be written to /. The site was moved from a linux installation, which is writing the files correctly. I have setup a web.config w/ the rewrite rules for drupal. Not sure what or where else I should check. Thanks for any help. <rule name="Drupal Clean URLs" stopProcessing="true"> <match url="^(.*)$" /> <conditions> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Rewrite" url="index.php?q={R:1}" appendQueryString="true" /> </rule>

  Read the article

• javascript ul button dropdown crashes after if doing more than 1 button

  - by Apprentice Programmer

  So i have a button drop down list that i want users to select a choice, and basically the button will return the users selection.Pretty straight forward, tested on jsFiddle and works great. Using ruby on rails btw, so i'm not sure if it might conflicting the way rails handle javascript actions. Heres the code: <%= form_for(@user, :html => {:class => 'form-horizontal'}) do |f| %> <fieldset> <p>Do you have experience in Business? If yes, select one of the following: <div class="input-group"> <div class="input-group-btn btn-group"> <button type="button" class="btn btn-default dropdown-toggle" data-toggle="dropdown">Select one <span class="caret"></span></button> <ul class="dropdown-menu"> <li ><a href="#">Entrepreneurship</a></li> <li ><a href="#">Investments</a></li> <li ><a href="#">Management</a></li> <li class="divider"></li> <li ><a href="#">All of the Above</a></li> </ul> </div><!-- /btn-group --> <%= f.text_field :years_business , :class => "form-control", :placeholder => "Years of experience" %> </div> Now there are 2 more of these, and basically what happens is that if I select an item for the first time from the dropdown list, everything works great. But the moment I select the same button/or new button, the page immediately kind of refreshes, they selected value will not show up after the list drops down and user selects a value. I viewed the page source and added additional javascript src and types, but still doesnt work. the jquery code: jQuery(function ($) { $('.input-group-btn .dropdown-menu > li:not(.divider)').click(function(){ $(this).closest('ul').prev().text($(this).text()) }) }); Any suggestions what is causing the problem?? The jsfiddle link is here: http://jsfiddle.net/w4s8u/7/

  Read the article

• Using php to create a password system with chinese characters

  - by WillDonohoe

  Hi guys, I'm having an issue with validating chinese characters against other chinese characters, for example I'm creating a simple password script which gets data from a database, and gets the user input through get. The issue I'm having is for some reason, even though the characters look exactly the same when you echo them out, my if statement still thinks they are different. I have tried using the htmlentities() function to encode the characters, the password from the database encodes nicely, giving me a working '& #35441;' (I've put a space in it to stop it from converting to a chinese character!). The other user input value gives me a load of funny characters. The only thing which I believe must be breaking it, is it encodes in a different way and therefore the php thinks it's 2 completely different strings. Does anybody have any ideas? Thanks in advance, Will

  Read the article

• IIS7 URL Redirect with Regex

  - by andyjv

  I'm preparing for a major overhaul of our shopping cart, which is going to completely change how the urls are structured. For what its worth, this is for Magento 1.7. An example URL would be: {domain}/item/sub-domain/sub-sub-domain-5-16-7-16-/8083770?plpver=98&categid=1027&prodid=8090&origin=keyword and redirect it to {domain}/catalogsearch/result/?q=8083710 My web.config is: <?xml version="1.0" encoding="UTF-8"?> <configuration> <system.webServer> <rewrite> <rules> <rule name="Magento Required" stopProcessing="false"> <match url=".*" ignoreCase="false" /> <conditions> <add input="{URL}" pattern="^/(media|skin|js)/" ignoreCase="false" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Rewrite" url="index.php" /> </rule> <rule name="Item Redirect" stopProcessing="true"> <match url="^item/([_\-a-zA-Z0-9]+)/([_\-a-zA-Z0-9]+)/([_\-a-zA-Z0-9]+)(\?.*)" /> <action type="Redirect" url="catalogsearch/result/?q={R:3}" appendQueryString="true" redirectType="Permanent" /> <conditions trackAllCaptures="true"> </conditions> </rule> </rules> </rewrite> <httpProtocol allowKeepAlive="false" /> <caching enabled="false" /> <urlCompression doDynamicCompression="true" /> </system.webServer> </configuration> Right now it seems the redirect is completely ignored, even though in the IIS GUI the sample url passes the regex test. Is there a better way to redirect or is there something wrong with my web.config?

  Read the article

• preg_replace replacing with array

  - by Scott

  What I want to do is replace the "[replace]" in input string with the corresponding vaule in the replace array. The total number of values will change but there will always be the same number in the replace array as in input string. I have tried doing this with preg_replace and preg_replace_callback but I can't get the pattern right for [replace], I also tried using vsprintf but the % in <table width="100%"> was messing it up. All help is greatly appreciated! Replace Array: $array = array('value 1','value 2','value 3'); Input String $string = ' <table width="100%"> <tr> <td>Name:</td> <td>[replace]</td> </tr> <tr> <td>Date:</td> <td>[replace]</td> </tr> <tr> <td>Info:</td> <td>[replace]</td> </tr> </table> '; Desired Result <table width="100%"> <tr> <td>Name:</td> <td>value 1</td> </tr> <tr> <td>Date:</td> <td>value 2</td> </tr> <tr> <td>Info:</td> <td>value 3</td> </tr> </table>

  Read the article

• how to use OR in jquery

  - by user1493339

  1st i would like to thanks all who view this and special thanks for those who answer this. today, i tested this out but it not working, so just want to know how should this code. multiple "OR" in one line $("input[name='ABC']or[name='DEF']or[name='GHI']or[name='JKL']").click(function (){ //do something }); or even put else for it like... $("input[name='ABC'][name='DEF'][name='GHI'][name='JKL']").click(function (){ //do something }else{ //do something else }); i know both code is invalid, so is that possible to code in that way? so far i code it all one by one, so my coding is very long.

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• move text from one div to another with javascript or mootools

  - by Ke

  Hi, I have two divs. I would like to move/populate the text from div id one to div id two using an onclick event. I am wondering how to do this? and also whether mootools can be used to accomplish the task or whether simple javascript is only necessary? <div id='one'> <ul> <input type="checkbox" onclick = "my_function()"/> <li>some text 1</li> <input type="checkbox" onclick = "my_function()"/> <li>some text 2</li> </ul> <div> <div id='two'> <div> Cheers in advance for any helps. Bangin my head against a brick wall here, because my javascript skillz are limited! Ke

  Read the article

• Failed to sum splited text

  - by user1784753

  I have a problem when summing all of bx3.text to t2.text. first I split bx3.text with space private void total() { string[] ps = bx3.Text.Split(new string[] {" "}, StringSplitOptions.None ); t2.Text = ps.Select(x => Convert.ToInt32(x)).Sum().ToString(); } I did try with t2.text = ps[1] and the number showed was correct. but when i try to sum it all, I got error "Input string was not in a correct format" on (x = Convert.ToInt32(x)) bx3.text is full of user-input number separated by single space " "

  Read the article

• "Remember" last three MySql queries; Cookie, passed variable or other method?

  - by Camran

  I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

  Read the article

• Javascript Function wont submit form..

  - by Josh K

  Here is my function: function processCheck() { var numberClicked = 0; var frm = document.getElementById('form'); for (var i=0; i<form.elements.length; i++) { if (frm.elements[i].checked) numberClicked++; } if(numberClicked != 8) alert('Must choose 8 Teams'); else frm.submit(); } My forms name is 'form', here is my input: echo "<input type='button' name='submit' value='Update' onclick='processCheck()' />"; When i click the button and there is anything but 8 boxes selected it displays the alert, if there is 8 boxes it does nothing (<-- The problem). I have the form action set to another page.

  Read the article

• Confused on the basics of AJAX

  - by Doug

  So right now, I'm just using a basic form to check a password. I want it to check the password and basically remain on page.html so I can use JavaScript to alert incorrect password or something. I'm not really sure how to do that. It seems it would bring me to check.php. I'm not too sure on the whole process, any help appreciated! Thanks! Page.html <form action="check.php" method="post"> <input type="password" name="password" /> <input type="submit" value="Submit" /> </form> check.php <?php $password = $_POST['password']; if ( $password != "testing" ) { die(); } ?>

  Read the article

• Shell Sort problem

  - by user191603

  Show the result of running Shell Sort on the input 9,8,7,6,5,4,3,2,1 using increments { 1,3,7 }. I have done this part. the result is: 9 8 7 6 5 4 3 2 1 (original) 2 1 7 6 5 4 3 9 8 ( 7-sort ) 2 1 4 3 5 7 6 9 8 ( 3-sort ) 1 2 3 4 5 6 7 8 9 ( 1-sort ) Then the question requires me to determine the running time of Shell Sort using Shell's increments of N/2, N/4, ..., 1 for sorted input. I am not quite sure how to answer the second question as I don't understand the requirement of this question. So, would anyone give some hints to let me finish this question? Thank you for your help first!

  Read the article

• What is the differance between those two Strings in Java

  - by user1816808

  why when we declare string in java we can't use == to compare this string and always will turn to false while if we initialize the string from the beginning it will be true . for example : import java.util.Scanner; public class MyString { /** * @param args */ public static void main(String[] args) { // TODO Auto-generated method stub Scanner input = new Scanner(System.in); String s = input.nextLine(); if(s=="Hello") system.out.println("Hello"); String d = "Hello"; if(d=="Hello") system.out.println("Hello"); } } I need an explanation please ??

  Read the article

• Form validation in JAvascript with Regexp

  - by Nikita Barsukov

  I have a webpage with an input field where only digits are allowed. The input field has an onkeyup event that starts this validating function: function validate() { var uah_amount = document.getElementById("UAH").value; var allowed = /^\d+$/; document.getElementById("error").innerHTML = document.getElementById("UAH").value; if (!allowed.test(uah_amount)) { document.getElementById("error").style.backgroundColor = "red"; } } Everything works as I expect until I hit Backspace button to remove some characters. In this case function always behaves as if I entered letters. How to correct this?

  Read the article

• Buttons created through jquery don't respond to clicks

  - by Atrus

  As I've come to understand using $('.whatever').click() only works for items created initially. Additional items won't respond in the correct fashion. I was then directed to using something like $('.whatever).on('click', myFunction()). However, I'm not detecting any difference, as newly created items are not called. Here is a JSFiddle demonstration my example code: http://jsfiddle.net/atrus6/zaKZN/ My initial input plus 'Kill' will work in the correct fashion, however any additional 'input + kill's will not not do anything. Am I incorrectly using .on() or is it something else?

  Read the article

• JavaScript not working with Chrome & Xampp!

  - by Anonymous

  Hi, I've been trying for a couple hours now to figure out why JavaScript wouldn't work. The code works, but here it is anyway. <script type="text/javascript"> function change(text) { document.f1.ta.value="Hi!"; } </script> <form name="f1"> <input type="textarea" id="ta"/> <input type="button" action='change("Hi!")'/> </form> When I click the button, it does nothing. When I write "document.f1.ta.value="Hi!";" in the Chrome's inspector console, it works. I am using XAMPP (for Windows) 1.7.3 Windows 7 Ultimate.

  Read the article

• Database that accesses a website.?

  - by Alec

  Hi Guys What application should I use that is able to automatically access a website to gather information? Basically I have a database that completes calculations for me; however I have to manually gather the parameters from a website and input these into my database. What I would like is have an application that will take my input say the name of a product, access the website, add this name into a search box on a website, complete the search and then extract the desired information from the web page returning the results to my application to complete the calculation thus presenting me with the result. This is a little out of my depth but I’m willing to learn no matter how complicated the software. Cheers for your help.

  Read the article

• Change Modul popup every 30 sec Javascript

  - by SoftwareDeveloper

  I have a div id called modalpage and have css. I need a javascript function which can dynamically shows popup for 20 mins and change in every 30 secs right now i have the following javascript function. Can anybody help me please <script language="javascript" type="text/javascript"> function revealModal(divID) { window.onscroll = function () { document.getElementById(divID).style.top = document.body.scrollTop; }; document.getElementById(divID).style.display = "block"; document.getElementById(divID).style.top = document.body.scrollTop; } which is called by a input id button. <input id="Button1" type="button" value="Click here" onclick="revealModal('modalPage')" /> Thanks

  Read the article

• Is it possible to block a certain character or group of characters from entering into text box or an

  - by Param-Ganak

  Hello friends! I have a text input field like text box or text area. I want to prevent the user from entering certain character or a group of characters. That is for example if I dont want # * @ and numbers from 0-9 these characters. So Whenever user press any of the above character key then that character should not appear in to an input field. It means directly blocking that character. Is this possible in Jquery? Please give me some guidelines to achive it. Thank You

  Read the article

• PHP setcookie warning

  - by Ranking

  Hello guys, I have a problem with 'setcookie' in PHP and I can't solve it. so I receive this error "Warning: Cannot modify header information - headers already sent by (output started at C:\Program Files\VertrigoServ\www\vote.php:14) in C:\Program Files\VertrigoServ\www\vote.php on line 86" and here is the file.. line 86 is setcookie ($cookie_name, 1, time()+86400, '/', '', 0); is there any other way to do this ?? <html> <head> <title>Ranking</title> <link href="style.css" rel="stylesheet" type="text/css"> </head> <body bgcolor="#EEF0FF"> <div align="center"> <br/> <div align="center"><div id="header"></div></div> <br/> <table width="800" border="0" align="center" cellpadding="5" cellspacing="0" class="mid-table"> <tr><td height="5"> <center> <table border="0" cellpadding="0" cellspacing="0" align="center" style="padding-top:5px;"> <tr> <td align="center" valign="top"><img src="images/ads/top_banner.png"></td> </tr> </table> </center> </td></tr> <tr><td height="5"></td></tr> </table> <br/> <?php include "conf.php"; $id = $_GET['id']; if (!isset($_POST['submitted'])) { if (isset($_GET['id']) && is_numeric($_GET['id'])) { $id = mysql_real_escape_string($_GET['id']); $query = mysql_query("SELECT SQL_CACHE id, name FROM s_servers WHERE id = $id"); $row = mysql_fetch_assoc($query); ?> <form action="" method="POST"> <table width="800" height="106" border="0" align="center" cellpadding="3" cellspacing="0" class="mid-table"> <tr><td><div align="center"> <p>Code: <input type="text" name="kod" class="port" /><img src="img.php" id="captcha2" alt="" /><a href="javascript:void(0);" onclick="document.getElementById('captcha2').src = document.getElementById('captcha2').src + '?' + (new Date()).getMilliseconds()">Refresh</a></p><br /> <p><input type="submit" class="vote-button" name="vote" value="Vote for <?php echo $row['name']; ?>" /></p> <input type="hidden" name="submitted" value="TRUE" /> <input type="hidden" name="id" value="<?php echo $row['id']; ?>" /> </div></td></tr> <tr><td align="center" valign="top"><img src="images/ads/top_banner.png"></td></tr> </table> </form> <?php } else { echo '<font color="red">You must select a valid server to vote for it!</font>'; } } else { $kod=$_POST['kod']; if($kod!=$_COOKIE[imgcodepage]) { echo "The code does not match"; } else { $id = mysql_real_escape_string($_POST['id']); $query = "SELECT SQL_CACHE id, votes FROM s_servers WHERE id = $id"; $result = mysql_query($query) OR die(mysql_error()); $row = mysql_fetch_array($result, MYSQL_ASSOC); $votes = $row['votes']; $id = $row['id']; $cookie_name = 'vote_'.$id; $ip = $_SERVER['REMOTE_ADDR']; $ltime = mysql_fetch_assoc(mysql_query("SELECT SQL_CACHE `time` FROM `s_votes` WHERE `sid`='$id' AND `ip`='$ip'")); $ltime = $ltime['time'] + 86400; $time = time(); if (isset($_COOKIE['vote_'.$id]) OR $ltime > $time) { echo 'You have already voted in last 24 hours! Your vote is not recorded.'; } else { $votes++; $query = "UPDATE s_servers SET votes = $votes WHERE id = $id"; $time = time(); $query2 = mysql_query("INSERT INTO `s_votes` (`ip`, `time`, `sid`) VALUES ('$ip', '$time', '$id')"); $result = mysql_query($query) OR die(mysql_error()); setcookie ($cookie_name, 1, time()+86400, '/', '', 0); } } } ?> <p><a href="index.php">[Click here if you don't want to vote]</a></p><br/> <p><a href="index.php">Ranking.net</a> &copy; 2010-2011<br> </p> </div> </body> </html> Thanks a lot!

  Read the article

• Color getAlpha() not working as intended

  - by Arvy

  I was making a program where I load an image and after that I do something with opaque pixels. Transparent pixels showed up as black pixels, but after some time I found the cause: Color c = new Color (input.getRGB(x, y)); Works-> if ((input.getRGB(x, y) & 0xFF000000) != 0x00000000) { do_smth();} Returns true at all times-> if (c.getAlpha() != 0) { do_smth(); } So why it does not work?

  Read the article

< Previous Page | 442 443 444 445 446 447 448 449 450 451 452 453  | Next Page >