Search Results

Search found 12701 results on 509 pages for 'fulltext index'.

Page 448/509 | < Previous Page | 444 445 446 447 448 449 450 451 452 453 454 455  | Next Page >

• How to make CSS URL background images show up in localhost?

  - by Joel

  Hi guys, I just installed xampp and I brought one of my live sites into it to be able to start working from localhost. So to view my site, I navigate to localhost/example.com I noticed some issues with images when on my html, I had for example: <img src="/new_pictures/05.jpg" alt="Central Market"/> Image wouldn't show up, but then I removed the / and this works: <img src="new_pictures/05.jpg" alt="Central Market"/> I seem to have a similar problem with the CSS background image, but I can't get it to work-if I remove the / there, the image doesn't show up on the live site. How do I make the background image show up on localhost? Example CSS (works in live site but not localhost): .outeremailcontainer { height:60px; width: 275px; background-image:url(/images/feather_email2.jpg); text-align:center; float:right; position:relative; z-index:1; } Thanks!

  Read the article

• C++, Ifstream opens local file but not file on HTTP Server

  - by fammi

  Hi, I am using ifstream to open a file and then read from it. My program works fine when i give location of the local file on my system. for eg /root/Desktop/abc.xxx works fine But once the location is on the http server the file fails to open. for eg http://192.168.0.10/abc.xxx fails to open. Is there any alternate for ifstream when using a URL address? thanks. part of the code where having problem: bool readTillEof = (endIndex == -1) ? true : false; // Open the file in binary mode and seek to the end to determine file size ifstream file ( fileName.c_str ( ), ios::in|ios::ate|ios::binary ); if ( file.is_open ( ) ) { long size = (long) file.tellg ( ); long numBytesRead; if ( readTillEof ) { numBytesRead = size - startIndex; } else { numBytesRead = endIndex - startIndex + 1; } // Allocate a new buffer ptr to read in the file data BufferSptr buf (new Buffer ( numBytesRead ) ); mpStreamingClientEngine->SetResponseBuffer ( nextRequest, buf ); // Seek to the start index of the byte range // and read the data file.seekg ( startIndex, ios::beg ); file.read ( (char *)buf->GetData(), numBytesRead ); // Pass on the data to the SCE // and signal completion of request mpStreamingClientEngine->HandleDataReceived( nextRequest, numBytesRead); mpStreamingClientEngine->MarkRequestCompleted( nextRequest ); // Close the file file.close ( ); } else { // Report error to the Streaming Client Engine // as unable to open file AHS_ERROR ( ConnectionManager, " Error while opening file \"%s\"\n", fileName.c_str ( ) ); mpStreamingClientEngine->HandleRequestFailed( nextRequest, CONNECTION_FAILED ); } }

  Read the article

• My Rails session is getting reset when I have concurrent requests

  - by alex_c

  I think I might be misunderstanding something about Rails sessions, so please bear with me, I might not be phrasing my question the best way. I'm working on an iPhone app with a Ruby on Rails backend. I have a web view which by default goes to the index action of one controller (and uses sessions), and in the background a bunch of API calls going to a different controller (and which don't need to use sessions). The problem is, the sessions set by my web view seem to be overwitten by the API calls. My staging server is pretty slow, so there's lots of time for the requests to overlap each other - what I see in the logs is basically this: Request A (first controller) starts. Session is empty. Request B (second controller) starts. Session is empty. Request A finishes. Request A has done authentication, and stored the user ID in the session. Session contains user ID. Request B finishes. Session is empty. Request C starts. Session is empty - not what I want. Now, the strange thing is that request B should NOT be writing anything to the session. I do have before and after filters which READ from the session - things like: user = User.find_by_id(session[:id]) or logger.debug session.inspect and if I remove all of those, then everything works as expected - session contents get set by request A, and they're still there when request C starts. So. I think I'm missing something about how sessions work. Why would reading from the session overwrite it? Should I be accessing it some other way? Am I completely on the wrong track and the problem is elsewhere? Thank you for any insights!

  Read the article

• PHP Multiple navigation highlights

  - by Blackbird

  I'm using this piece of code below to highlight the "active" menu item on my global navigation. <?php $path = $_SERVER['PHP_SELF']; $page = basename($path); $page = basename($path, '.php'); ?> <ul id="nav"> <li class="home"><a href="index.php">Home</a></li> <li <?php if ($page == 'search') { ?>class="active"<?php } ?>><a href="#">Search</a></li> <li <?php if ($page == 'help') { ?>class="active"<?php } ?>><a href="help.php">Help</a></li> </ul> All works great but, on a couple of pages, I have a second sub menu (sidebar menu) within a global page. I basically need to add a OR type statement into the php somehow, but I haven't a clue a how. Example of what i mean: <li <?php if ($page == 'help') OR ($page == 'help-overview') OR ($page == 'help-cat-1') { ?>class="active"<?php } ?>><a href="#">Search</a></li> Thanks!

  Read the article

• Creating a floating button

  - by Robert Smith

  Hey all, I'm working on a Firefox extension and am out of ideas on how to implement a floating button. I need a button that is overlayed on my page that I can show/hide and dynamically position just about anywhere on my page. I thought I could do something like a fancy CSS tool-tip except replace it with button functionality, but that idea failed because I couldn't pull my example apart well enough to understand what all I need to include, need to change, etc. I've thought about using jQuery(though wouldn't mind avoiding, unless it makes this painfully easy) but will be looking more into that as a possibility now. If anyone can offer a tutorial link, ideas, sample code, anything to help get me moving in the right direction I will greatly appreciate it! Thanks! Edit: Clarification I'm not entirely sure how to actually create the overlayed button. I tried to create a a floating div with some text in it, and nothing showed up, but I got no errors, which means I'm doing something wrong, but I have no idea what that is. http://www.fijiwebdesign.com/blog/css-tooltips-floating-html-elements.html If you take a look at that webpage you see that there is that floating "feedback" button, I would like to create something similar, only it wouldn't be anchored to the sides, but I could position it over text, etc. #floatingBtn { position: absolute; z-index: 10000; top: 50%; left: 50%; } Thats the CSS I used to try and float my div. I don't know if I'm creating the div in the wrong place or... I thought if I could get a floating div with some text, I could turn that into my button.

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• crash when using stl vector at instead of operator[]

  - by Jamie Cook

  I have a method as follows (from a class than implements TBB task interface - not currently multithreading though) My problem is that two ways of accessing a vector are causing quite different behaviour - one works and the other causes the entire program to bomb out quite spectacularly (this is a plugin and normally a crash will be caught by the host - but this one takes out the host program as well! As I said quite spectacular) void PtBranchAndBoundIterationOriginRunner::runOrigin(int origin, int time) const // NOTE: const method { BOOST_FOREACH(int accessMode, m_props->GetAccessModes()) { // get a const reference to appropriate vector from member variable // map<int, vector<double>> m_rowTotalsByAccessMode; const vector<double>& rowTotalsForAccessMode = m_rowTotalsByAccessMode.find(accessMode)->second; if (origin != 129) continue; // Additional debug constrain: I know that the vector only has one non-zero element at index 129 m_job->Write("size: " + ToString(rowTotalsForAccessMode.size())); try { // check for early return... i.e. nothing to do for this origin if (!rowTotalsForAccessMode[origin]) continue; // <- this works if (!rowTotalsForAccessMode.at(origin)) continue; // <- this crashes } catch (...) { m_job->Write("Caught an exception"); // but its not an exception } // do some other stuff } } I hate not putting in well defined questions but at the moment my best phrasing is : "WTF?" I'm compiling this with Intel C++ 11.0.074 [IA-32] using Microsoft (R) Visual Studio Version 9.0.21022.8 and my implementation of vector has const_reference operator[](size_type _Pos) const { // subscript nonmutable sequence #if _HAS_ITERATOR_DEBUGGING if (size() <= _Pos) { _DEBUG_ERROR("vector subscript out of range"); _SCL_SECURE_OUT_OF_RANGE; } #endif /* _HAS_ITERATOR_DEBUGGING */ _SCL_SECURE_VALIDATE_RANGE(_Pos < size()); return (*(_Myfirst + _Pos)); } (Iterator debugging is off - I'm pretty sure) and const_reference at(size_type _Pos) const { // subscript nonmutable sequence with checking if (size() <= _Pos) _Xran(); return (*(begin() + _Pos)); } So the only difference I can see is that at calls begin instead of simply using _Myfirst - but how could that possibly be causing such a huge difference in behaviour?

  Read the article

• Efficiently select top row for each category in the set

  - by VladV

  I need to select a top row for each category from a known set (somewhat similar to this question). The problem is, how to make this query efficient on the large number of rows. For example, let's create a table that stores temperature recording in several places. CREATE TABLE #t ( placeId int, ts datetime, temp int, PRIMARY KEY (ts, placeId) ) -- insert some sample data SET NOCOUNT ON DECLARE @n int, @ts datetime SELECT @n = 1000, @ts = '2000-01-01' WHILE (@n>0) BEGIN INSERT INTO #t VALUES (@n % 10, @ts, @n % 37) IF (@n % 10 = 0) SET @ts = DATEADD(hour, 1, @ts) SET @n = @n - 1 END Now I need to get the latest recording for each of the places 1, 2, 3. This way is efficient, but doesn't scale well (and looks dirty). SELECT * FROM ( SELECT TOP 1 placeId, temp FROM #t WHERE placeId = 1 ORDER BY ts DESC ) t1 UNION ALL SELECT * FROM ( SELECT TOP 1 placeId, temp FROM #t WHERE placeId = 2 ORDER BY ts DESC ) t2 UNION ALL SELECT * FROM ( SELECT TOP 1 placeId, temp FROM #t WHERE placeId = 3 ORDER BY ts DESC ) t3 The following looks better but works much less efficiently (30% vs 70% according to the optimizer). SELECT placeId, ts, temp FROM ( SELECT placeId, ts, temp, ROW_NUMBER() OVER (PARTITION BY placeId ORDER BY ts DESC) rownum FROM #t WHERE placeId IN (1, 2, 3) ) t WHERE rownum = 1 The problem is, during the latter query execution plan a clustered index scan is performed on #t and 300 rows are retrieved, sorted, numbered, and then filtered, leaving only 3 rows. For the former query three times one row is fetched. Is there a way to perform the query efficiently without lots of unions?

  Read the article

• Reordering fields in Django model

  - by Alex Lebedev

  I want to add few fields to every model in my django application. This time it's created_at, updated_at and notes. Duplicating code for every of 20+ models seems dumb. So, I decided to use abstract base class which would add these fields. The problem is that fields inherited from abstract base class come first in the field list in admin. Declaring field order for every ModelAdmin class is not an option, it's even more duplicate code than with manual field declaration. In my final solution, I modified model constructor to reorder fields in _meta before creating new instance: class MyModel(models.Model): # Service fields notes = my_fields.NotesField() created_at = models.DateTimeField(auto_now_add=True) updated_at = models.DateTimeField(auto_now=True) class Meta: abstract = True last_fields = ("notes", "created_at", "updated_at") def __init__(self, *args, **kwargs): new_order = [f.name for f in self._meta.fields] for field in self.last_fields: new_order.remove(field) new_order.append(field) self._meta._field_name_cache.sort(key=lambda x: new_order.index(x.name)) super(TwangooModel, self).__init__(*args, **kwargs) class ModelA(MyModel): field1 = models.CharField() field2 = models.CharField() #etc ... It works as intended, but I'm wondering, is there a better way to acheive my goal?

  Read the article

• Have something loaded only when JList item is visibile

  - by elvencode

  Hello, i'm implementing a Jlist populated with a lot of elements. Each element corresponds to a image so i'd like to show a resized preview of them inside each row of the list. I've implemented a custom ImageCellRenderer extending the Jlabel and on getListCellRendererComponent i create the thumbnail if there'snt any for that element. Each row corresponds to a Page class where i store the path of the image and the icon applied to the JLabel. Each Page object is put inside a DefaultListModel to populate the JList. The render code is something like this: public Component getListCellRendererComponent( JList list, Object value, int index, boolean isSelected, boolean cellHasFocus) { Page page = (Page) value; if (page.getImgIcon() == null) { System.out.println(String.format("Creating thumbnail of %s", page.getImgFilename())); ImageIcon icon = new ImageIcon(page.getImgFilename()); int thumb_width = icon.getIconWidth() > icon.getIconHeight() ? 128 : ((icon.getIconWidth() * 128) / icon.getIconHeight()); int thumb_height = icon.getIconHeight() > icon.getIconWidth() ? 128 : ((icon.getIconHeight() * 128) / icon.getIconWidth()); icon.setImage(getScaledImage(icon.getImage(), thumb_width, thumb_height)); page.setImgIcon(icon); } setIcon(page.getImgIcon()); } I was thinking that only a certain item is visibile in the List the cell renderer is called but i'm seeing that all the thumnails are created when i add the Page object to the list model. I've tried to load the items and after set the model in the JList or set the model first and after starting appending the items but the results are the same. Is there any way to load the data only when necessary or do i need to create a custom control like a JScrollPanel with stacked items inside where i check myself the visibility of each elements? Thanks

  Read the article

• Paperclip: Stay put on edit

  - by EricR

  When a user edits something in my application, they're forced to re-upload their image via paperclip even if they aren't changing it. Failing to do so will cause an error, since I validate_presence_of :image. This is quite annoying. How can I make it so Paperclip won't update its attributes if a user simply doesn't supply a new image on an edit? The photo controller is fresh out of Rails' scaffold generator. The rest of the source code is provided below. models/accommodation.rb class Accommodation < ActiveRecord::Base attr_accessible :photo validates_presence_of :photo has_one :photo has_many :notifications belongs_to :user accepts_nested_attributes_for :photo, :allow_destroy => true end controllers/accommodation_controller.rb class AccommodationsController < ApplicationController def index @accommodations = Accommodation.all end def show @accommodation = Accommodation.find(params[:id]) rescue ActiveRecord::RecordNotFound flash[:error] = "Accommodation not found." redirect_to :home end def new @accommodation = current_user.accommodations.build @accommodation.build_photo end def create @accommodation = current_user.accommodations.build(params[:accommodation]) if @accommodation.save flash[:notice] = "Successfully created your accommodation." redirect_to @accommodation else @accommodation.build_photo render :new end end def edit @accommodation = Accommodation.find(params[:id]) @accommodation.build_photo rescue ActiveRecord::RecordNotFound flash[:error] = "Accommodation not found." redirect_to :home end def update @accommodation = Accommodation.find(params[:id]) if @accommodation.update_attributes(params[:accommodation]) flash[:notice] = "Successfully updated accommodation." redirect_to @accommodation else @accommodation.build_photo render :edit end end def destroy @accommodation = Accommodation.find(params[:id]) @accommodation.destroy flash[:notice] = "Successfully destroyed accommodation." redirect_to :inkeep end end models/photo.rb class Photo < ActiveRecord::Base attr_accessible :image, :primary belongs_to :accommodation has_attached_file :image, :styles => { :thumb=> "100x100#", :small => "150x150>" } end

  Read the article

• Magento products will not show in category

  - by Aaron

  I've recently been tasked with the build and deployment of a large Ecommerce site. In the past we've had to use the clients legacy X-cart installation for redevelopment (too far integrated with their existing work flow). We'd heard good things about Magento, so I've set up a test install to get to grips with it. After a couple of initial issues, there is a live development site which displays categories on the default theme. The problem we've hit now is that products don't display..! After a lot more in-depth research into this, all I've been able to discover is that quite a number of developers endorse using other solutions entirely, with the other 50% saying after the steep learning curve the platform is as wonderful as we'd initially been led to believe. Now, my test category is showing, so I know this is configured properly. I've set up three test products and associated them with this (all done following the Magento user guide), checked double checked and thrice checked the products are enabled and visible individually, yet still the front end says the category has no products in it. I've cleared the cache repeatedly, reset everything possible many times in index management - no products show up. I have to make a call tomorrow morning on whether we're going ahead with Magento. If I can't even get it to show products I'm going to have to go with something with a more established track record and more community support available. Can anybody advise what could possibly be wrong here?

  Read the article

• Extended slice that goes to beginning of sequence with negative stride

  - by recursive

  Bear with me while I explain my question. Skip down to the bold heading if you already understand extended slice list indexing. In python, you can index lists using slice notation. Here's an example: >>> A = list(range(10)) >>> A[0:5] [0, 1, 2, 3, 4] You can also include a stride, which acts like a "step": >>> A[0:5:2] [0, 2, 4] The stride is also allowed to be negative, meaning the elements are retrieved in reverse order: >>> A[5:0:-1] [5, 4, 3, 2, 1] But wait! I wanted to see [4, 3, 2, 1, 0]. Oh, I see, I need to decrement the start and end indices: >>> A[4:-1:-1] [] What happened? It's interpreting -1 as being at the end of the array, not the beginning. I know you can achieve this as follows: >>> A[4::-1] [4, 3, 2, 1, 0] But you can't use this in all cases. For example, in a method that's been passed indices. My question is: Is there any good pythonic way of using extended slices with negative strides and explicit start and end indices that include the first element of a sequence? This is what I've come up with so far, but it seems unsatisfying. >>> A[0:5][::-1] [4, 3, 2, 1, 0]

  Read the article

• How add logic to Views? Ruby on Rails

  - by Gotjosh

  Right now I'm building a project management app in rails, here is some background info: Right now i have 2 models, one is User and the other one is Client. Clients and Users have a one-to-one relationship (client - has_one and user - belongs_to which means that the foreign key it's in the users table) So what I'm trying to do it's once you add a client you can actually add credentials (add an user) to that client, in order to do so all the clients are being displayed with a link next to that client's name meaning that you can actually create credentials for that client. What i can't figure it out how to do is, that if you actually have credentials in the database (meaning that there's a record in the users table with your client id) then don't display that link. Here's what i thought that would work <% for client in @client%> <h5> <h4><%= client.id %></h4> <a href="/clients/<%= client.id %>"><%= client.name %></a> <% for user in @user %> <% if user.client_id = client.id %> <a href="/clients/<%= client.id %>/user/new">Credentials</a> <%end%> <% end %> </h5> <% end %> And here's the controller: def index @client = Client.find_all_by_admin(0) @user = User.find(:all) end but instead it just puts the link the amount of times per records in the user table. Any help?

  Read the article

• Asynchronous javascript issue

  - by amit

  I am trying to create a function which takes values from various html elements of the page to create a string and pass on to a variable. now this works great for all browsers except IE 8 and 9. IE tends to skip the part of fetching the values and goes straight to the variable and finds nothing.. is there a way to sync it all so that it works in IE? function seturl() { var qstring = returnQString(); $('span.keyword').text($.trim($('#hdnKeyWord').attr('value'))); $('input.search_box').attr('value', $.trim($('#hdnKeyWord').attr('value'))); $('#hdnSearchKeyword').attr('value', $.trim($('#hdnKeyWord').attr('value'))); $(".search_box").val($.trim($("#hdn_span_hdnKeyWord").text())); $(".header_inner input[type='text']").focus(); $(".search_term input[type='text']").focus(); $('#locationurl').attr('value', qstring); } function returnQString(){ var qstring = $.trim($('#locationurl').attr('init')); //initial value of the url qstring += "?type=" + $('#hdnSTSearch').attr('value'); // type of handler hit qstring += "&keyword=" + encodeURIComponent($('#hdnKeyWord').attr('value')); // keyword addition qstring += "&pagestart=" + $('#current_page').attr('value'); // pagestart(current page) addition qstring += "&pagesize=" + $('#show_per_page').attr('value'); // per page size addition qstring += "&facets=" // facetsearch $.each(selectedFilter.items, function (index, value) { qstring += value.filter + ","; }); qstring += "&selectedSection=" + selectedSection // Section Select return qstring; }

  Read the article

• INSERT INTO ...SELECT syntax error in join operator

  - by user1477356

  I'm trying to write a shopping basket into a order + orderline in a sql database from C# asp.net. the orderline will contain a ordernumber, total price, productid, quantity etc. for every item in the basket. The order itself will contain the ordernumber as primary key and will be linked to the different lines through it. Everything worked fine yesterday, but now as i tried to use a SELECT command in the insert into statement to get things more dynamic i'm getting the above described syntax error. Does anybody know what's wrong with this statement: INSERT INTO [order] (klant_id,totaalprijs,btw,subtotaal,verzendkosten) SELECT klant.id , SUM(orderregel.totaalprijs) , SUM(orderregel.btw) , SUM(orderregel.totaalprijs) - SUM(orderregel.btw) , 7.50 FROM orderregel INNER JOIN klant ON [order].klant_id = klant.id WHERE klant.username = 'jerry' GROUP BY id; the ordernumber in the "order" table is on autonumber, in the asp codebehind there is a for each which handles the lines being written for every product, there's an index set on 0 outside of this loop and is heightened with 1 every end of it. The executenonquery of the order is only executed once at the beginning of the first loop and the lines are added after with MAX(ordernumber) as ordernumber. I hope i have provided enough information and somebody is capable of helping me. Thanks in advance!

  Read the article

• php while selecting a node should be highlighted.

  - by shaibi

  I need to highlight the node value when I select it.how can I wrirte code for that in php my code is function generate_menu($parent) { $has_childs = false; global $menu_array; foreach($menu_array as $key = $value) { //print_r($value); if ($value['parentid'] == $parent) { if ($has_childs === false) { $has_childs = true; $menu .= '<ul>'; } $clor = 'black'; if(($_GET['id']>0) &&($key == $_GET['id'])) { $clor = '#990000'; } $chld = generate_menu($key); $cls = ($chld != '')? 'folder' : 'file'; $menu .= '<li><span class="'.$cls.'" color='.$clor.'>&nbsp;' . $value['humanid'].'-'.$value['title'] . ' <a href="index.php?id='.$key.'"><img src="images/edit.png" alt=" Edit" title="Edit"/></a></span>'; $menu .= $chld; $menu .= '</li>'; } } if ($has_childs === true) $menu .= '</ul>'; return $menu ; } ?

  Read the article

• Stopping a MATLAB GUI callback

  - by leonhart88

  Dear All, I have a START and STOP button. When I hit START, i run a bunch of code in my callback. It's basically a sequential "script" that opens valves, dispenses water and then closes the valves...there is no while() loop and it doesn't repeat. I want to be able to stop this process at any time using the STOP button. Most of the related answers I've seen are in the cases where a while() loop is used. Some people have also suggested to periodically check if the STOP button was pressed (using a variable or handle variable). Since I do not have a while loop, I can't solve it that way. Also, I'd like to be able to exit immediately, without having to periodically check (because checking multiple times in my code would be ugly and confusing). Is there a way to terminate the callback which was interrupted by the STOP button? If not, is it possible to have the START button run a .m file and then have the STOP button terminate that .m file? The worst case scenario would be to check a variable periodically. UPDATE: Well, looks like the worst case scenario is what is suggested by MATLAB... http://www.mathworks.com/support/solutions/en/data/1-33IK85/index.html?product=ML&solution=1-33IK85 Thanks.

  Read the article

• Django: Create custom template tag -> ImportError

  - by Alexander Scholz

  I'm sorry to ask this again, but I tried several solutions from stack overflow and some tutorials and I couldn't create a custom template tag yet. All I get is ImportError: No module named test_tag when I try to start the server via python manage.py runserver. I created a very basic template tag (found here: django templatetag?) like so: My folder structure: demo manage.py test __init__.py settings.py urls.py ... templatetags __init__.py test_tag.py test_tag.py: from django import template register = template.Library() @register.simple_tag def test_tag(input): if "foo" == input: return "foo" if "bar" == input: return "bar" if "baz" == input: return "baz" return "" index.html: {% load test_tag %} <html> <head> ... </head> <body> {% cms_toolbar %} {% foobarbaz "bar" %} {% foobarbaz "elephant" %} {% foobarbaz "foo" %} </body> </html> and my settings.py: INSTALLED_APPS = ( ... 'test_tag', ... ) Please let me know if you need further information from my settings.py and what I did wrong so I can't even start my server. (If I delete 'test_tag' from installed apps I can start the server but I get the error that test_tag is not known, of course). Thanks

  Read the article

• [LaTeX] positions of page numbers, position of chapter headings, chapters AND Table of Contents, Ref

  - by kaikanmonaco

  I am writing my PhD thesis (120+ pages) in latex, the deadline is approaching and I am struggling with layout problems. I am using the documentstyle book. I am posting both problems in this one thread because I am not sure if the solution might be related to both problems or not. Problems are: 1.) The page numbers are mostly located on the top-right of each page (this is correct and where I want them to be). However, only on the first page of chapters and on the first page of what I call "special chapters", the page number is located bottom-centered. With "special chapters" I mean: List of Contents, List of Figures, List of Tables, References, Index. My university will not accept the thesis like this. The page number must ALWAYS be top-right one each page, even if the page is the first page of a chapter or the first page of something like the List of Contents. How can I fix this? 2.) On the first page of chapters and "special chapters" (List of Contents...), the chapter title is located far too low on the page. This is the standard layout of LaTeX with documentstyle book I think. However, the chapter title must start at the very top of the page! I.e. the same height as the normal text on the pages that follow. I mean the chapter title, not the header. I.e., if there is a chapter called "Chapter 1 Dynamics of foobar under mechanical stress" then that text has to start from the top the page, but right now it starts several centimeters below the top. How can I fix this? Have tried all kinds of things to no effect, I'd be very thankful for a solution! Thanks.

  Read the article

• Recursive code Sorting in VB

  - by Peter

  Ages old question: You have 2 hypothetical eggs, and a 100 story building to drop them from. The goal is to have the least number of guaranteed drops that will ensure you can find what floor the eggs break from the fall. You can only break 2 eggs. Using a 14 drop minimum method, I need help writing code that will allow me to calculate the following: Start with first drop attempt on 14th floor. If egg breaks then drop floors 1-13 to find the floor that causes break. ElseIf egg does not break then move up 13 floors to floor number 27 and drop again. If egg breaks then drop floors 15-26 starting on 15 working up to find the floor egg breaks on. ElseIf egg does not break then move up 12 floors to floor number 39 and drop again. etc. etc. The way this increases is as follows 14+13+12+11+10+9+8+7+6+5+4+3+2+1 So always adding to the previous value, by one less. I have never written a sorting algorithm before, and was curious how I might go about setting this up in a much more efficient way than a mile long of if then statements. My original idea was to store values for the floors in an array, and pull from that, using the index to move up or down and subtract or add to the variables. The most elegant solution would be a recursive function that handled this for any selected floor, 1-100, and ran the math, with an output that shows how many drops were needed in order to find that floor. Maximum is always 14, but some can be done in less.

  Read the article

• 3 small PHP errors I cannot decipher

  - by Dave

  *Notice: Use of undefined constant _ - assumed '_' in /.../uploader.php on line 45* Line 45 $newname = str_replace(array(' ', '&'), array('_', 'and'), trim( strip_tags( $_POST['name'] ) ) ) . _ . $formKey->generateKey() . '_' . time() . '.jpg'; Notice: Undefined index: approve in /.../uploader.php on line 81 Line 81 - the second last line here $query = sprintf("INSERT INTO `$db_name`.`the_table` (`id` , `name` , `photo` , `email` , `date` , `code` , `subscribe` , `approve` , `created` ) VALUES ( NULL , '%s', '%s', '%s', '%s', '%s', '%s', '1', CURRENT_TIMESTAMP );", mysql_real_escape_string($_POST['name']), mysql_real_escape_string($newname), mysql_real_escape_string($_POST['email']), mysql_real_escape_string($date), mysql_real_escape_string($_POST['code']), mysql_real_escape_string($subscribe), mysql_real_escape_string($_POST['approve']) ); Warning: Cannot modify header information - headers already sent by (output started at /.../uploader.php:45) in/.../uploader.php on line 102 Line 45 $newname = str_replace(array(' ', '&'), array('_', 'and'), trim( strip_tags( $_POST['name'] ) ) ) . _ . $formKey->generateKey() . '_' . time() . '.jpg'; Line 102 - the third line here if ($success == 'Done') { $page = 'uploader'; header('Location: ./thanks.php'); } else { echo "error"; }

  Read the article

• Find Pythagorean triplet for which a + b + c = 1000

  - by Rahul

  A Pythagorean triplet is a set of three natural numbers, a < b < c, for which, a^(2) + b^(2) = c^(2) For example, 3^(2) + 4^(2) = 9 + 16 = 25 = 5^(2). There exists exactly one Pythagorean triplet for which a + b + c = 1000. Find the product abc. Source: http://projecteuler.net/index.php?section=problems&id=9 I tried but didn't know where my code went wrong. Here's my code in C: #include <stdio.h> void main() { int a, b, c; for (a = 0; a<=1000; a++) { for (b = 0; b<=1000; b++) { for (c = 0; c<=1000; c++) { if (((a^(2) + b^(2) == c^(2)) && ((a+b+c) ==1000))) printf("a=%d, b=%d, c=%d",a,b,c); } } } return 0; }

  Read the article

• How to access the element of a list/vector that passed by reference in C++

  - by bsoundra

  Hi all, The problem is passing lists/vectors by reference int main(){ list<int> arr; //Adding few ints here to arr func1(&arr); return 0; } void func1(list<int> * arr){ // How Can I print the values here ? //I tried all the below , but it is erroring out. cout<<arr[0]; // error cout<<*arr[0];// error cout<<(*arr)[0];//error //How do I modify the value at the index 0 ? func2(arr);// Since it is already a pointer, I am passing just the address } void func2(list<int> *arr){ //How do I print and modify the values here ? I believe it should be the same as above but // just in case. } Is the vectors any different from the lists ? Thanks in advance. Any links where these things are explained elaborately will be of great help. Thanks again.

  Read the article

• PHP Dom problem, how to insert html code in a particular div

  - by sala_7

  I am trying to replace the html code inside the div 'resultsContainer' with the html of $response. The result of my unsuccessful code is that the contents of 'resultsContainer' remain and the html of $response shows up on screen as text rather than being parsed as html. Finally, I would like to inject the content of $response inside 'resultContainer' without having to create any new div, I need this: <div id='resultsContainer'>Html inside $response here...</div> and NOT THIS: <div id='resultsContainer'><div>Html inside $response here...</div></div> // Set Config libxml_use_internal_errors(true); $doc = new DomDocument(); $doc->strictErrorChecking = false; $doc->validateOnParse = true; // load the html page $app = file_get_contents('index.php'); $doc->loadHTML($app); // get the dynamic content $response = file_get_contents('search.php'.$query); $response = utf8_decode($response); // add dynamic content to corresponding div $node = $doc->createElement('div', $response); $doc->getElementById('resultsContainer')->appendChild($node); // echo html snapshot echo $doc->saveHTML();

  Read the article

< Previous Page | 444 445 446 447 448 449 450 451 452 453 454 455  | Next Page >