Search Results

Search found 52214 results on 2089 pages for 'partial application'.

Page 45/2089 | < Previous Page | 41 42 43 44 45 46 47 48 49 50 51 52  | Next Page >

  • MVC partial page update

    - by GB
    Hello, I have an MVC project where I have a form with fields a user can enter and save. On that same page I have a table which shows a brief listing of information that the user just saved. The problem I am having is trying to update only the table after a save and not an entire page refresh. Is this possible in jquery or MVC? If so does anyone have an example. Here is what the action in the controller looks like: public ActionResult RefreshList() { string _employeeID = Request.QueryString["empIDSearch"]; this.ViewData["coursehistorylist"] = _service.ListCoursesByEmpID(_employeeID); return View("CourseHistoryList"); } The function in the view: (and this is where I'm confused on how to update only the table) $.ajax({ url: "/Home/RefreshList", type: "POST", success: function(result) { alert("got here"); }, error: function(xhr, ajaxOptions, thrownError) { alert(xhr.status + " " + thrownError + " " + ajaxOptions); } }); Thanks.

    Read the article

  • Full and Partial Matching of Sets

    - by jeffrey
    I have several sets of the same type [Y, M, D] and am trying to write a function to search these sets and return an array of the available sets that fit my parameters. ReturnedSets = return_matches(Y,M,D); I want the three parameters of the function return_matches to be optional. Which means any combination of values can be used to return the sets. For example, one could write - return_matches(13,null,2); - and the function would look for all sets that contain [13, anyValue, 2]; I'm writing this in PHP, to allow users to manage dated files on my website, but I'd like to be able to use this function again for other uses. Thanks! edit: (This, or variations of this, is all I can come up with so far... There is something extra that I don't understand, because this function ends up / would not work to return sets that contain y and d, but leaving m arbitrary. if(y == s[0]){ if(m == s[1]){ if(d == s[2]){ print "day match"; } } else {print "month match";} } else {print "year match";} } else {print "no match";}

    Read the article

  • How to avoid "incomplete implementation" warning in partial base class

    - by garph0
    I have created a protocol that my classes need to implement, and then factored out some common functionality into a base class, so I did this: @protocol MyProtocol - (void) foo; - (void) bar; @end @interface Base <MyProtocol> @end @interface Derived_1 : Base @end @interface Derived_2 : Base @end @implementation Base - (void) foo{ //something foo } @end @implementation Derived_1 - (void) bar{ //something bar 1 } @end @implementation Derived_2 - (void) bar{ //something bar 2 } @end In this way in my code I use a generic id<MyProtocol>. The code works (as long as Base is not used directly) but the compiler chokes at the end of the implementation of Base with a warning: Incomplete implementation of class Base Is there a way to avoid this warning or, even better, a more proper way to obtain this partially implemented abstract base class behavior in Objc?

    Read the article

  • Ajax: Partial refresh of a parent page (update a div) from "lightbox" window

    - by superUntitled
    Is there a way to update information in a div of a parent page from a pop-up/"lightbox" window. I would like to create a pop up window that contains a form that updates a database (currently i am using php/mysql with prototype). In other words... I would like a user to be able to use a form in a popup window to update the database, and the changes that are made to be shown on the parent page without that parent page being refreshed. Thanks.

    Read the article

  • C++ typedef for partial templates

    - by Gokul
    Hi, i need to do a typedef like this. template< class A, class B, class C > class X { }; template< class B, class C > typedef X< std::vector<B>, B, C > Y; I just found that it is not supported in C++. Can someone advise me on how to achieve the same through alternative means? Thanks, Gokul.

    Read the article

  • can't create partial objects with accepts_nested_attributes_for

    - by Isaac Cambron
    I'm trying to build a form that allows users to update some records. They can't update every field, though, so I'm going to do some explicit processing (in the controller for now) to update the model vis-a-vis the form. Here's how I'm trying to do it: Family model: class Family < ActiveRecord::Base has_many :people, dependent: :destroy accepts_nested_attributes_for :people, allow_destroy: true, reject_if: ->(p){p[:name].blank?} end In the controller def check edited_family = Family.new(params[:family]) #compare to the one we have in the db #update each person as needed/allowed #save it end Form: = form_for current_family, url: check_rsvp_path, method: :post do |f| = f.fields_for :people do |person_fields| - if person_fields.object.user_editable = person_fields.text_field :name, class: "person-label" - else %p.person-label= person_fields.object.name The problem is, I guess, that Family.new(params[:family]) tries to pull the people out of the database, and I get this: ActiveRecord::RecordNotFound in RsvpsController#check Couldn't find Person with ID=7 for Family with ID= That's, I guess, because I'm not adding a field for family id to the nested form, which I suppose I could do, but I don't actually need it to load anything from the database for this anyway, so I'd rather not. I could also hack around this by just digging through the params hash myself for the data I need, but that doesn't feel a slick. It seems nicest to just create an object out of the params hash and then work with it. Is there a better way? How can I just create the nested object?

    Read the article

  • mvc partial views loses track of the images folder when using jquery

    - by jvelez
    This is what I have and it works: $(function(){ $('.slide-out-div').tabSlideOut({ tabHandle: '.handle', //class of the element that will become your tab pathToTabImage: 'http://mhmiisdev2/images/contact_tab.gif', //path to the image for the tab //Optionally can be set using css imageHeight: '122px', //height of tab image //Optionally can be set using css imageWidth: '40px', //width of tab image //Optionally can be set using css tabLocation: 'right', //side of screen where tab lives, top, right, bottom, or left speed: 300, //speed of animation action: 'click', //options: 'click' or 'hover', action to trigger animation topPos: '200px', //position from the top/ use if tabLocation is left or right leftPos: '20px', //position from left/ use if tabLocation is bottom or top fixedPosition: true //options: true makes it stick(fixed position) on scroll }); }); This is what I want and it doesnt work when I change from one controller to another controller. NOTICE THE IMAGE PATH IS NOT ABSOLUTE $(function(){ $('.slide-out-div').tabSlideOut({ tabHandle: '.handle', //class of the element that will become your tab pathToTabImage: '/images/contact_tab.gif', //path to the image for the tab //Optionally can be set using css imageHeight: '122px', //height of tab image //Optionally can be set using css imageWidth: '40px', //width of tab image //Optionally can be set using css tabLocation: 'right', //side of screen where tab lives, top, right, bottom, or left speed: 300, //speed of animation action: 'click', //options: 'click' or 'hover', action to trigger animation topPos: '200px', //position from the top/ use if tabLocation is left or right leftPos: '20px', //position from left/ use if tabLocation is bottom or top fixedPosition: true //options: true makes it stick(fixed position) on scroll }); }); the html for completeness.... <div class="slide-out-div"> <a class="handle" href="http://link-for-non-js-users.html">Content</a> <h3>Medical Variance Reports</h3> <div> <ul> <li><a href="http://mhmssrs2/Reports/Pages/Report.aspx?" target="_blank">Individual Medicines</a></li> </ul> </div> </div> I suspect somehow pathToTabImage: /images/contact_tab.gif' loses its context when browsing throught controllers. Help me understand...

    Read the article

  • git partial pull

    - by KennyTM
    I am maintaining a repository A. Another contributor has cloned A to another repository B. Later, the other contributor added files F, which is irrelevant to me, into B. Now I want to merge changes in B back to A, but without committing F. How to do so?

    Read the article

  • Upadate panel's child controls are not causing partial postback, the whole page gets reloaded with a

    - by Akshay
    I have put several buttons and panels in my update panel. I also have a script manager on that page. now when I click on any of the buttons then the functionality is working fine but problem is that the complete page gets reloaded witha a flick, instead of updating the update panel only. I have set the "children as trigger" property of update panel "true". please help.

    Read the article

  • NHibernate Partial Update

    - by bleevo
    Is there a way in NHibernate to start with an unproxied model var m = new Model() { ID = 1 }; m.Name = "test"; //Model also has .LastName and .Age Now save this model only updating Name without first selecting the model from the session?

    Read the article

  • Passing partial arguments in tcshell

    - by R S
    Hey, I'm writing a shell script (tcsh) that is supposed to received 3 parameters or more. The first 3 are to be passed to a program, and the rest are supposed to be passed to another program. All in all the script should look something like: ./first_program $1 $2 $3 ./second program [fourth or more] The problem is that I don't know how to do the latter - pass all parameters that are after the third.

    Read the article

  • mysql like issue on partial match

    - by ubercooluk
    Im having a mysql query like this SELECT group_name FROM t_groups WHERE group_name LIKE '%PCB%'; The results are group_name ------------ PCB Full size PCB Another query, SELECT group_name FROM t_groups WHERE group_name LIKE '%PCB-123%'; group_name ----------- PCB-123 How can i use a query that will show all the three results ?,I mean i need to get all the results that starts or contains PCB

    Read the article

  • Application using JOGL stays in Limbo when closing

    - by Roy T.
    I'm writing a game using Java and OpenGL using the JOGL bindings. I noticed that my game doesn't terminate properly when closing the window even though I've set the closing operation of the JFrame to EXIT_ON_CLOSE. I couldn't track down where the problem was so I've made a small reproduction case. Note that on some computers the program terminates normally when closing the window but on other computers (notably my own) something in the JVM keeps lingering, this causes the JFrame to never be disposed and the application to never exit. I haven't found something in common between the computers that had difficulty terminating. All computers had Windows 7, Java 7 and the same version of JOGL and some terminated normally while others had this problem. The test case is as follows: public class App extends JFrame implements GLEventListener { private GLCanvas canvas; @Override public void display(GLAutoDrawable drawable) { GL3 gl = drawable.getGL().getGL3(); gl.glClearColor(0.0f, 0.0f, 0.0f, 0.0f); gl.glClear(GL3.GL_COLOR_BUFFER_BIT); gl.glFlush(); } // The overrides for dispose (the OpenGL one), init and reshape are empty public App(String title, boolean full_screen, int width, int height) { //snipped setting the width and height of the JFRAME GLProfile profile = GLProfile.get(GLProfile.GL3); GLCapabilities capabilities = new GLCapabilities(profile); canvas = new GLCanvas(capabilities); canvas.addGLEventListener(this); canvas.setSize(getWidth(), getHeight()); add(canvas); setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); //!!! setVisible(true); } @Override public void dispose() { System.out.println("HELP"); // } public static void main( String[] args ) { new App("gltut 01", false, 1280, 720); } } As you can see this doesn't do much more than adding a GLCanvas to the frame and registering the main class as the GLEventListener. So what keeps lingering? I'm not sure. I've made some screenshots. The application running normally. The application after the JFrame is closed, note that the JVM still hasn't exited or printed a return code. The application after it was force closed. Note the return code -1, so it wasnt just the JVM standing by or something the application really hadn't exited yet. So what is keeping the application in Limbo? Might it be the circular reference between the GLCanvas and the JFrame? I thought the GC could figure that out. If so how should I deal with that when I want to exit? Is there any other clean-up required when using JOGL? I've tried searching but it doesn't seem to be necessary. Edit, to clarify: there are 2 dispose functions dispose(GLAutoDrawable arg) which is a member of GLEventListener and dispose() which is a member of JFrame. The first one is called correctly (but I wouldn't know what to there, destroying the GLAutoDrawable or the GLCanvas gives an infinite exception loop) the second one is never called.

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • When programatically creating a new IIS web site, how can I add it to an existing application pool?

    - by Ian Robinson
    I have successfully automated the process of creating a new IIS website, however the code I've written doesn't care about application pools, it just gets added to DefaultAppPool. However I'd like to add this newly created site to an existing application pool. Here is the code I'm using to create the new website. var w3Svc = new DirectoryEntry(string.Format("IIS://{0}/w3svc", webserver)); var newsite = new object[] { serverComment, new object[] { serverBindings }, homeDirectory }; var websiteId = w3Svc.Invoke("CreateNewSite", newsite); site.Invoke("Start", null); site.CommitChanges(); <update Although this is not directly related to the question, here are some sample values being used above. This might help someone understand exactly what the code above is doing more easily. webServer: "localhost" serverComment: "testing.dev" serverBindings: ":80:testing.dev" homeDirectory: "c:\inetpub\wwwroot\testing\" </update If I know the name of the application pool that I'd like this web site to be in, how can I find it and add this site to it? <update 2 I've added the following based on Mark's answer below. var appPool = new DirectoryEntry(string.Format("IIS://{0}/w3svc/AppPools/{1}", webServer, appPoolName)); site.Properties["AppPoolId"].Value = appPool; I seem to have moved passed the "RPC" error message I was initially receiving. Now this is the error message I'm receiving: Error: System.Runtime.InteropServices.COMException (0x8000500C): Exception from HRESULT: 0x8000500C at System.DirectoryServices.Interop.UnsafeNativeMethods.IAds.PutEx(Int32 lnControlCode, String bstrName, Object vProp) at System.DirectoryServices.PropertyValueCollection.set_Value(Object value) at ProvisionIISWebsite.Query.CreateWebsite(String webServer, String serverComment, String serverBindings, String homeDirectory, String appPoolName) in C:\Users\irobinson\My Projects\ProvisionIISWebsite\Query.cs:line 104 at ProvisionIISWebsite.Query.Handle_GetData(EngineBase& caller, Boolean isSubQuery, String query, String filterField, String filterText, Debugger& debugWriter, Boolean isRendered, Int32 timeout, String customConnection) in C:\Users\irobinson\My Projects\ProvisionIISWebsite\Query.cs:line 36 </update 2

    Read the article

  • Oracle Utilities Application Framework V4.2.0.0.0 Released

    - by ACShorten
    The Oracle Utilities Application Framework V4.2.0.0.0 has been released with Oracle Utilities Customer Care And Billing V2.4. This release includes new functionality and updates to existing functionality and will be progressively released across the Oracle Utilities applications. The release is quite substantial with lots of new and exciting changes. The release notes shipped with the product includes a summary of the changes implemented in V4.2.0.0.0. They include the following: Configuration Migration Assistant (CMA) - A new data management capability to allow you to export and import Configuration Data from one environment to another with support for Approval/Rejection of individual changes. Database Connection Tagging - Additional tags have been added to the database connection to allow database administrators, Oracle Enterprise Manager and other Oracle technology the ability to monitor and use individual database connection information. Native Support for Oracle WebLogic - In the past the Oracle Utilities Application Framework used Oracle WebLogic in embedded mode, and now, to support advanced configuration and the ExaLogic platform, we are adding Native Support for Oracle WebLogic as configuration option. Native Web Services Support - In the past the Oracle Utilities Application Framework supplied a servlet to handle Web Services calls and now we offer an alternative to use the native Web Services capability of Oracle WebLogic. This allows for enhanced clustering, a greater level of Web Service standards support, enchanced security options and the ability to use the Web Services management capabilities in Oracle WebLogic to implement higher levels of management including defining additional security rules to control access to individual Web Services. XML Data Type Support - Oracle Utilities Application Framework now allows implementors to define XML Data types used in Oracle in the definition of custom objects to take advantage of XQuery and other XML features. Fuzzy Operator Support - Oracle Utilities Application Framework supports the use of the fuzzy operator in conjunction with Oracle Text to take advantage of the fuzzy searching capabilities within the database. Global Batch View - A new JMX based API has been implemented to allow JSR120 compliant consoles the ability to view batch execution across all threadpools in the Coherence based Named Cache Cluster. Portal Personalization - It is now possible to store the runtime customizations of query zones such as preferred sorting, field order and filters to reuse as personal preferences each time that zone is used. These are just the major changes and there are quite a few more that have been delivered (and more to come in the service packs!!). Over the next few weeks we will be publishing new whitepapers and new entries in this blog outlining new facilities that you want to take advantage of.

    Read the article

  • Using the jQuery UI Library in a MVC 3 Application to Build a Dialog Form

    - by ChrisD
    Using a simulated dialog window is a nice way to handle inline data editing. The jQuery UI has a UI widget for a dialog window that makes it easy to get up and running with it in your application. With the release of ASP.NET MVC 3, Microsoft included the jQuery UI scripts and files in the MVC 3 project templates for Visual Studio. With the release of the MVC 3 Tools Update, Microsoft implemented the inclusion of those with NuGet as packages. That means we can get up and running using the latest version of the jQuery UI with minimal effort. To the code! Another that might interested you about JQuery Mobile and ASP.NET MVC 3 with C#. If you are starting with a new MVC 3 application and have the Tools Update then you are a NuGet update and a <link> and <script> tag away from adding the jQuery UI to your project. If you are using an existing MVC project you can still get the jQuery UI library added to your project via NuGet and then add the link and script tags. Assuming that you have pulled down the latest version (at the time of this publish it was 1.8.13) you can add the following link and script tags to your <head> tag: < link href = "@Url.Content(" ~ / Content / themes / base / jquery . ui . all . css ")" rel = "Stylesheet" type = "text/css" /> < script src = "@Url.Content(" ~ / Scripts / jquery-ui-1 . 8 . 13 . min . js ")" type = "text/javascript" ></ script > The jQuery UI library relies upon the CSS scripts and some image files to handle rendering of its widgets (you can choose a different theme or role your own if you like). Adding these to the stock _Layout.cshtml file results in the following markup: <!DOCTYPE html> < html > < head >     < meta charset = "utf-8" />     < title > @ViewBag.Title </ title >     < link href = "@Url.Content(" ~ / Content / Site . css ")" rel = "stylesheet" type = "text/css" />     <link href="@Url.Content("~/Content/themes/base/jquery.ui.all.css")" rel="Stylesheet" type="text/css" />     <script src="@Url.Content("~/Scripts/jquery-1.5.1.min.js")" type="text/javascript"></script>     <script src="@Url.Content("~/Scripts/modernizr-1.7.min . js ")" type = "text/javascript" ></ script >     < script src = "@Url.Content(" ~ / Scripts / jquery-ui-1 . 8 . 13 . min . js ")" type = "text/javascript" ></ script > </ head > < body >     @RenderBody() </ body > </ html > Our example will involve building a list of notes with an id, title and description. Each note can be edited and new notes can be added. The user will never have to leave the single page of notes to manage the note data. The add and edit forms will be delivered in a jQuery UI dialog widget and the note list content will get reloaded via an AJAX call after each change to the list. To begin, we need to craft a model and a data management class. We will do this so we can simulate data storage and get a feel for the workflow of the user experience. The first class named Note will have properties to represent our data model. namespace Website . Models {     public class Note     {         public int Id { get ; set ; }         public string Title { get ; set ; }         public string Body { get ; set ; }     } } The second class named NoteManager will be used to set up our simulated data storage and provide methods for querying and updating the data. We will take a look at the class content as a whole and then walk through each method after. using System . Collections . ObjectModel ; using System . Linq ; using System . Web ; namespace Website . Models {     public class NoteManager     {         public Collection < Note > Notes         {             get             {                 if ( HttpRuntime . Cache [ "Notes" ] == null )                     this . loadInitialData ();                 return ( Collection < Note >) HttpRuntime . Cache [ "Notes" ];             }         }         private void loadInitialData ()         {             var notes = new Collection < Note >();             notes . Add ( new Note                           {                               Id = 1 ,                               Title = "Set DVR for Sunday" ,                               Body = "Don't forget to record Game of Thrones!"                           });             notes . Add ( new Note                           {                               Id = 2 ,                               Title = "Read MVC article" ,                               Body = "Check out the new iwantmymvc.com post"                           });             notes . Add ( new Note                           {                               Id = 3 ,                               Title = "Pick up kid" ,                               Body = "Daughter out of school at 1:30pm on Thursday. Don't forget!"                           });             notes . Add ( new Note                           {                               Id = 4 ,                               Title = "Paint" ,                               Body = "Finish the 2nd coat in the bathroom"                           });             HttpRuntime . Cache [ "Notes" ] = notes ;         }         public Collection < Note > GetAll ()         {             return Notes ;         }         public Note GetById ( int id )         {             return Notes . Where ( i => i . Id == id ). FirstOrDefault ();         }         public int Save ( Note item )         {             if ( item . Id <= 0 )                 return saveAsNew ( item );             var existingNote = Notes . Where ( i => i . Id == item . Id ). FirstOrDefault ();             existingNote . Title = item . Title ;             existingNote . Body = item . Body ;             return existingNote . Id ;         }         private int saveAsNew ( Note item )         {             item . Id = Notes . Count + 1 ;             Notes . Add ( item );             return item . Id ;         }     } } The class has a property named Notes that is read only and handles instantiating a collection of Note objects in the runtime cache if it doesn't exist, and then returns the collection from the cache. This property is there to give us a simulated storage so that we didn't have to add a full blown database (beyond the scope of this post). The private method loadInitialData handles pre-filling the collection of Note objects with some initial data and stuffs them into the cache. Both of these chunks of code would be refactored out with a move to a real means of data storage. The GetAll and GetById methods access our simulated data storage to return all of our notes or a specific note by id. The Save method takes in a Note object, checks to see if it has an Id less than or equal to zero (we assume that an Id that is not greater than zero represents a note that is new) and if so, calls the private method saveAsNew . If the Note item sent in has an Id , the code finds that Note in the simulated storage, updates the Title and Description , and returns the Id value. The saveAsNew method sets the Id , adds it to the simulated storage, and returns the Id value. The increment of the Id is simulated here by getting the current count of the note collection and adding 1 to it. The setting of the Id is the only other chunk of code that would be refactored out when moving to a different data storage approach. With our model and data manager code in place we can turn our attention to the controller and views. We can do all of our work in a single controller. If we use a HomeController , we can add an action method named Index that will return our main view. An action method named List will get all of our Note objects from our manager and return a partial view. We will use some jQuery to make an AJAX call to that action method and update our main view with the partial view content returned. Since the jQuery AJAX call will cache the call to the content in Internet Explorer by default (a setting in jQuery), we will decorate the List, Create and Edit action methods with the OutputCache attribute and a duration of 0. This will send the no-cache flag back in the header of the content to the browser and jQuery will pick that up and not cache the AJAX call. The Create action method instantiates a new Note model object and returns a partial view, specifying the NoteForm.cshtml view file and passing in the model. The NoteForm view is used for the add and edit functionality. The Edit action method takes in the Id of the note to be edited, loads the Note model object based on that Id , and does the same return of the partial view as the Create method. The Save method takes in the posted Note object and sends it to the manager to save. It is decorated with the HttpPost attribute to ensure that it will only be available via a POST. It returns a Json object with a property named Success that can be used by the UX to verify everything went well (we won't use that in our example). Both the add and edit actions in the UX will post to the Save action method, allowing us to reduce the amount of unique jQuery we need to write in our view. The contents of the HomeController.cs file: using System . Web . Mvc ; using Website . Models ; namespace Website . Controllers {     public class HomeController : Controller     {         public ActionResult Index ()         {             return View ();         }         [ OutputCache ( Duration = 0 )]         public ActionResult List ()         {             var manager = new NoteManager ();             var model = manager . GetAll ();             return PartialView ( model );         }         [ OutputCache ( Duration = 0 )]         public ActionResult Create ()         {             var model = new Note ();             return PartialView ( "NoteForm" , model );         }         [ OutputCache ( Duration = 0 )]         public ActionResult Edit ( int id )         {             var manager = new NoteManager ();             var model = manager . GetById ( id );             return PartialView ( "NoteForm" , model );         }         [ HttpPost ]         public JsonResult Save ( Note note )         {             var manager = new NoteManager ();             var noteId = manager . Save ( note );             return Json ( new { Success = noteId > 0 });         }     } } The view for the note form, NoteForm.cshtml , looks like so: @model Website . Models . Note @using ( Html . BeginForm ( "Save" , "Home" , FormMethod . Post , new { id = "NoteForm" })) { @Html . Hidden ( "Id" ) < label class = "Title" >     < span > Title < /span><br / >     @Html . TextBox ( "Title" ) < /label> <label class="Body">     <span>Body</ span >< br />     @Html . TextArea ( "Body" ) < /label> } It is a strongly typed view for our Note model class. We give the <form> element an id attribute so that we can reference it via jQuery. The <label> and <span> tags give our UX some structure that we can style with some CSS. The List.cshtml view is used to render out a <ul> element with all of our notes. @model IEnumerable < Website . Models . Note > < ul class = "NotesList" >     @foreach ( var note in Model )     {     < li >         @note . Title < br />         @note . Body < br />         < span class = "EditLink ButtonLink" noteid = "@note.Id" > Edit < /span>     </ li >     } < /ul> This view is strongly typed as well. It includes a <span> tag that we will use as an edit button. We add a custom attribute named noteid to the <span> tag that we can use in our jQuery to identify the Id of the note object we want to edit. The view, Index.cshtml , contains a bit of html block structure and all of our jQuery logic code. @ {     ViewBag . Title = "Index" ; } < h2 > Notes < /h2> <div id="NoteListBlock"></ div > < span class = "AddLink ButtonLink" > Add New Note < /span> <div id="NoteDialog" title="" class="Hidden"></ div > < script type = "text/javascript" >     $ ( function () {         $ ( "#NoteDialog" ). dialog ({             autoOpen : false , width : 400 , height : 330 , modal : true ,             buttons : {                 "Save" : function () {                     $ . post ( "/Home/Save" ,                         $ ( "#NoteForm" ). serialize (),                         function () {                             $ ( "#NoteDialog" ). dialog ( "close" );                             LoadList ();                         });                 },                 Cancel : function () { $ ( this ). dialog ( "close" ); }             }         });         $ ( ".EditLink" ). live ( "click" , function () {             var id = $ ( this ). attr ( "noteid" );             $ ( "#NoteDialog" ). html ( "" )                 . dialog ( "option" , "title" , "Edit Note" )                 . load ( "/Home/Edit/" + id , function () { $ ( "#NoteDialog" ). dialog ( "open" ); });         });         $ ( ".AddLink" ). click ( function () {             $ ( "#NoteDialog" ). html ( "" )                 . dialog ( "option" , "title" , "Add Note" )                 . load ( "/Home/Create" , function () { $ ( "#NoteDialog" ). dialog ( "open" ); });         });         LoadList ();     });     function LoadList () {         $ ( "#NoteListBlock" ). load ( "/Home/List" );     } < /script> The <div> tag with the id attribute of "NoteListBlock" is used as a container target for the load of the partial view content of our List action method. It starts out empty and will get loaded with content via jQuery once the DOM is loaded. The <div> tag with the id attribute of "NoteDialog" is the element for our dialog widget. The jQuery UI library will use the title attribute for the text in the dialog widget top header bar. We start out with it empty here and will dynamically change the text via jQuery based on the request to either add or edit a note. This <div> tag is given a CSS class named "Hidden" that will set the display:none style on the element. Since our call to the jQuery UI method to make the element a dialog widget will occur in the jQuery document ready code block, the end user will see the <div> element rendered in their browser as the page renders and then it will hide after that jQuery call. Adding the display:hidden to the <div> element via CSS will ensure that it is never rendered until the user triggers the request to open the dialog. The jQuery document load block contains the setup for the dialog node, click event bindings for the edit and add links, and a call to a JavaScript function called LoadList that handles the AJAX call to the List action method. The .dialog() method is called on the "NoteDialog" <div> element and the options are set for the dialog widget. The buttons option defines 2 buttons and their click actions. The first is the "Save" button (the text in quotations is used as the text for the button) that will do an AJAX post to our Save action method and send the serialized form data from the note form (targeted with the id attribute "NoteForm"). Upon completion it will close the dialog widget and call the LoadList to update the UX without a redirect. The "Cancel" button simply closes the dialog widget. The .live() method handles binding a function to the "click" event on all elements with the CSS class named EditLink . We use the .live() method because it will catch and bind our function to elements even as the DOM changes. Since we will be constantly changing the note list as we add and edit we want to ensure that the edit links get wired up with click events. The function for the click event on the edit links gets the noteid attribute and stores it in a local variable. Then it clears out the HTML in the dialog element (to ensure a fresh start), calls the .dialog() method and sets the "title" option (this sets the title attribute value), and then calls the .load() AJAX method to hit our Edit action method and inject the returned content into the "NoteDialog" <div> element. Once the .load() method is complete it opens the dialog widget. The click event binding for the add link is similar to the edit, only we don't need to get the id value and we load the Create action method. This binding is done via the .click() method because it will only be bound on the initial load of the page. The add button will always exist. Finally, we toss in some CSS in the Content/Site.css file to style our form and the add/edit links. . ButtonLink { color : Blue ; cursor : pointer ; } . ButtonLink : hover { text - decoration : underline ; } . Hidden { display : none ; } #NoteForm label { display:block; margin-bottom:6px; } #NoteForm label > span { font-weight:bold; } #NoteForm input[type=text] { width:350px; } #NoteForm textarea { width:350px; height:80px; } With all of our code in place we can do an F5 and see our list of notes: If we click on an edit link we will get the dialog widget with the correct note data loaded: And if we click on the add new note link we will get the dialog widget with the empty form: The end result of our solution tree for our sample:

    Read the article

  • Connect from java mobile application to webservice to read messages.

    - by Alexandru Trandafir Catalin
    Hello, I have a website where users can send personal messages between them, now I want them to recieve the messages also on their mobile phone but without having to send them a SMS. I am thinking about providing them with a mobile phone with internet access over GPRS or 3G, then develop a Java application that will connect to the website and retrieve the messages. On the website I am thinking to make a webservice where the phone will login, get new messages, and also be able to answer back to messages. Does anyone know any mobile application tutorial that will do that? Or do you recommend me where to start? I never done a java mobile application before, I only work with websites and PHP. I also tried to use ICQ, the client is already done for java and for iphone, and I've also found a script that will send ICQ messages from PHP, but ICQ server bans you for 20 minutes when you do many reconnections, so I have to develop some kind of ICQ bot always online that will check for new messages to send from the mySQL database and then send them, one per 2-3 seconds, so the server won't ban me for flooding. Well any advice or recommendation is welcome about how to have users connected to the website messaging system from their phones. Thank you!

    Read the article

  • How to Create the Upload File for Application Loader?

    - by Ohad Regev
    When I use Application Loader, I get to the point where it asks me to "Choose..." the file to be uploaded. If I understand correctly, it supposes to be the appName.app file I see under "Products" on my app bundle (I right click it and select "Show in Finder" to get to the specific file in library; then I'm supposed to ZIP it and the ZIP file is what I will choose in Application Loader). First, am I correct with this assumption? if yes... What should I define different in XCode than the way I used to build the application for testing (on simulator and on my personal iPhone)? Should I change the Info---Command-line build use from Debug to Release? How should I define the Build Settings---Code Signing section (in which field should I select the "iPhone Developer" option and in which should it be "iPhone Distribution")? Are there any other important Info/Build Settings/p.list/etc... fields I should relate to? any help will be appreciated...

    Read the article

  • Enterprise Manager will not start on WebLogic after ADF install

    - by retrodev
    I just built a WebLogic 10.3.6 cluster with EM and JRF checked in the domain extensions. Next I installed ADR 11.1.1.7 by first installing ADR 11.1.1.6, then patching the environment and running upgradeADF in wlst. All seems well except I cannot start EM. The application transitions to STATE_ADMIN, but then fails with the exception below. Any advice would be appreciated. <[ACTIVE] ExecuteThread: '6' for queue: 'weblogic.kernel.Default (self-tuning)' < < <1372081430346 java.lang.RuntimeException: com.sun.faces.config.ConfigurationException: CONFIGURATION FAILED! null at com.sun.faces.config.ConfigureListener.contextInitialized(ConfigureListener.java:293) at weblogic.servlet.internal.EventsManager$FireContextListenerAction.run(EventsManager.java:481) at weblogic.security.acl.internal.AuthenticatedSubject.doAs(AuthenticatedSubject.java:321) at weblogic.security.service.SecurityManager.runAs(SecurityManager.java:120) at weblogic.servlet.internal.EventsManager.notifyContextCreatedEvent(EventsManager.java:181) at weblogic.servlet.internal.WebAppServletContext.preloadResources(WebAppServletContext.java:1870) at weblogic.servlet.internal.WebAppServletContext.start(WebAppServletContext.java:3155) at weblogic.servlet.internal.WebAppModule.startContexts(WebAppModule.java:1518) at weblogic.servlet.internal.WebAppModule.start(WebAppModule.java:487) at weblogic.application.internal.flow.ModuleStateDriver$3.next(ModuleStateDriver.java:427) at weblogic.application.utils.StateMachineDriver.nextState(StateMachineDriver.java:52) at weblogic.application.internal.flow.ModuleStateDriver.start(ModuleStateDriver.java:119) at weblogic.application.internal.flow.ScopedModuleDriver.start(ScopedModuleDriver.java:201) at weblogic.application.internal.flow.ModuleListenerInvoker.start(ModuleListenerInvoker.java:249) at weblogic.application.internal.flow.ModuleStateDriver$3.next(ModuleStateDriver.java:427) at weblogic.application.utils.StateMachineDriver.nextState(StateMachineDriver.java:52) at weblogic.application.internal.flow.ModuleStateDriver.start(ModuleStateDriver.java:119) at weblogic.application.internal.flow.StartModulesFlow.activate(StartModulesFlow.java:28) at weblogic.application.internal.BaseDeployment$2.next(BaseDeployment.java:672) at weblogic.application.utils.StateMachineDriver.nextState(StateMachineDriver.java:52) at weblogic.application.internal.BaseDeployment.activate(BaseDeployment.java:212) at weblogic.application.internal.EarDeployment.activate(EarDeployment.java:59) at weblogic.application.internal.DeploymentStateChecker.activate(DeploymentStateChecker.java:161) at weblogic.deploy.internal.targetserver.AppContainerInvoker.activate(AppContainerInvoker.java:79) at weblogic.deploy.internal.targetserver.operations.AbstractOperation.activate(AbstractOperation.java:569) at weblogic.deploy.internal.targetserver.operations.ActivateOperation.activateDeployment(ActivateOperation.java:150) at weblogic.deploy.internal.targetserver.operations.ActivateOperation.doCommit(ActivateOperation.java:116) at weblogic.deploy.internal.targetserver.operations.StartOperation.doCommit(StartOperation.java:149) at weblogic.deploy.internal.targetserver.operations.AbstractOperation.commit(AbstractOperation.java:323) at weblogic.deploy.internal.targetserver.DeploymentManager.handleDeploymentCommit(DeploymentManager.java:844) at weblogic.deploy.internal.targetserver.DeploymentManager.activateDeploymentList(DeploymentManager.java:1249) at weblogic.deploy.internal.targetserver.DeploymentManager.handleCommit(DeploymentManager.java:440) at weblogic.deploy.internal.targetserver.DeploymentServiceDispatcher.commit(DeploymentServiceDispatcher.java:164) at weblogic.deploy.service.internal.targetserver.DeploymentReceiverCallbackDeliverer.doCommitCallback(DeploymentReceiverCallbackDeliverer.java:195) at weblogic.deploy.service.internal.targetserver.DeploymentReceiverCallbackDeliverer.access$100(DeploymentReceiverCallbackDeliverer.java:13) at weblogic.deploy.service.internal.targetserver.DeploymentReceiverCallbackDeliverer$2.run(DeploymentReceiverCallbackDeliverer.java:69) at weblogic.work.SelfTuningWorkManagerImpl$WorkAdapterImpl.run(SelfTuningWorkManagerImpl.java:545) at weblogic.work.ExecuteThread.execute(ExecuteThread.java:256) at weblogic.work.ExecuteThread.run(ExecuteThread.java:221) Caused By: com.sun.faces.config.ConfigurationException: CONFIGURATION FAILED! null at com.sun.faces.config.ConfigManager.initialize(ConfigManager.java:357) at com.sun.faces.config.ConfigureListener.contextInitialized(ConfigureListener.java:227) at weblogic.servlet.internal.EventsManager$FireContextListenerAction.run(EventsManager.java:481) at weblogic.security.acl.internal.AuthenticatedSubject.doAs(AuthenticatedSubject.java:321) at weblogic.security.service.SecurityManager.runAs(SecurityManager.java:120) at weblogic.servlet.internal.EventsManager.notifyContextCreatedEvent(EventsManager.java:181) at weblogic.servlet.internal.WebAppServletContext.preloadResources(WebAppServletContext.java:1870) at weblogic.servlet.internal.WebAppServletContext.start(WebAppServletContext.java:3155) at weblogic.servlet.internal.WebAppModule.startContexts(WebAppModule.java:1518) at weblogic.servlet.internal.WebAppModule.start(WebAppModule.java:487) at weblogic.application.internal.flow.ModuleStateDriver$3.next(ModuleStateDriver.java:427) at weblogic.application.utils.StateMachineDriver.nextState(StateMachineDriver.java:52) at weblogic.application.internal.flow.ModuleStateDriver.start(ModuleStateDriver.java:119) at weblogic.application.internal.flow.ScopedModuleDriver.start(ScopedModuleDriver.java:201) at weblogic.application.internal.flow.ModuleListenerInvoker.start(ModuleListenerInvoker.java:249) at weblogic.application.internal.flow.ModuleStateDriver$3.next(ModuleStateDriver.java:427) at weblogic.application.utils.StateMachineDriver.nextState(StateMachineDriver.java:52) at weblogic.application.internal.flow.ModuleStateDriver.start(ModuleStateDriver.java:119) at weblogic.application.internal.flow.StartModulesFlow.activate(StartModulesFlow.java:28) at weblogic.application.internal.BaseDeployment$2.next(BaseDeployment.java:672) at weblogic.application.utils.StateMachineDriver.nextState(StateMachineDriver.java:52) at weblogic.application.internal.BaseDeployment.activate(BaseDeployment.java:212) at weblogic.application.internal.EarDeployment.activate(EarDeployment.java:59) at weblogic.application.internal.DeploymentStateChecker.activate(DeploymentStateChecker.java:161) at weblogic.deploy.internal.targetserver.AppContainerInvoker.activate(AppContainerInvoker.java:79) at weblogic.deploy.internal.targetserver.operations.AbstractOperation.activate(AbstractOperation.java:569) at weblogic.deploy.internal.targetserver.operations.ActivateOperation.activateDeployment(ActivateOperation.java:150) at weblogic.deploy.internal.targetserver.operations.ActivateOperation.doCommit(ActivateOperation.java:116) at weblogic.deploy.internal.targetserver.operations.StartOperation.doCommit(StartOperation.java:149) at weblogic.deploy.internal.targetserver.operations.AbstractOperation.commit(AbstractOperation.java:323) at weblogic.deploy.internal.targetserver.DeploymentManager.handleDeploymentCommit(DeploymentManager.java:844) at weblogic.deploy.internal.targetserver.DeploymentManager.activateDeploymentList(DeploymentManager.java:1249) at weblogic.deploy.internal.targetserver.DeploymentManager.handleCommit(DeploymentManager.java:440) at weblogic.deploy.internal.targetserver.DeploymentServiceDispatcher.commit(DeploymentServiceDispatcher.java:164) at weblogic.deploy.service.internal.targetserver.DeploymentReceiverCallbackDeliverer.doCommitCallback(DeploymentReceiverCallbackDeliverer.java:195) at weblogic.deploy.service.internal.targetserver.DeploymentReceiverCallbackDeliverer.access$100(DeploymentReceiverCallbackDeliverer.java:13) at weblogic.deploy.service.internal.targetserver.DeploymentReceiverCallbackDeliverer$2.run(DeploymentReceiverCallbackDeliverer.java:69) at weblogic.work.SelfTuningWorkManagerImpl$WorkAdapterImpl.run(SelfTuningWorkManagerImpl.java:545) at weblogic.work.ExecuteThread.execute(ExecuteThread.java:256) at weblogic.work.ExecuteThread.run(ExecuteThread.java:221) Caused By: java.lang.NullPointerException at oracle.adfinternal.view.faces.unified.renderkit.UnifiedRenderKit.(UnifiedRenderKit.java:129) at oracle.adfinternal.view.faces.unified.renderkit.UnifiedRenderKit.createRenderKit(UnifiedRenderKit.java:111) at oracle.adfinternal.view.faces.unified.renderkit.UnifiedRenderKitFactory.getRenderKit(UnifiedRenderKitFactory.java:59) at org.apache.myfaces.trinidadinternal.renderkit.CoreRenderKitFactory.getRenderKit(CoreRenderKitFactory.java:55) at com.sun.faces.config.processor.RenderKitConfigProcessor.addRenderKits(RenderKitConfigProcessor.java:240) at com.sun.faces.config.processor.RenderKitConfigProcessor.process(RenderKitConfigProcessor.java:159) at com.sun.faces.config.processor.AbstractConfigProcessor.invokeNext(AbstractConfigProcessor.java:114) at com.sun.faces.config.processor.ManagedBeanConfigProcessor.process(ManagedBeanConfigProcessor.java:270) at com.sun.faces.config.processor.AbstractConfigProcessor.invokeNext(AbstractConfigProcessor.java:114) at com.sun.faces.config.processor.ValidatorConfigProcessor.process(ValidatorConfigProcessor.java:120) at com.sun.faces.config.processor.AbstractConfigProcessor.invokeNext(AbstractConfigProcessor.java:114) at com.sun.faces.config.processor.ConverterConfigProcessor.process(ConverterConfigProcessor.java:126) at com.sun.faces.config.processor.AbstractConfigProcessor.invokeNext(AbstractConfigProcessor.java:114) at com.sun.faces.config.processor.ComponentConfigProcessor.process(ComponentConfigProcessor.java:117) at com.sun.faces.config.processor.AbstractConfigProcessor.invokeNext(AbstractConfigProcessor.java:114) at com.sun.faces.config.processor.ApplicationConfigProcessor.process(ApplicationConfigProcessor.java:341) at com.sun.faces.config.processor.AbstractConfigProcessor.invokeNext(AbstractConfigProcessor.java:114) at com.sun.faces.config.processor.LifecycleConfigProcessor.process(LifecycleConfigProcessor.java:116) at com.sun.faces.config.processor.AbstractConfigProcessor.invokeNext(AbstractConfigProcessor.java:114) at com.sun.faces.config.processor.FactoryConfigProcessor.process(FactoryConfigProcessor.java:216) at com.sun.faces.config.ConfigManager.initialize(ConfigManager.java:338) at com.sun.faces.config.ConfigureListener.contextInitialized(ConfigureListener.java:227) at weblogic.servlet.internal.EventsManager$FireContextListenerAction.run(EventsManager.java:481) at weblogic.security.acl.internal.AuthenticatedSubject.doAs(AuthenticatedSubject.java:321) at weblogic.security.service.SecurityManager.runAs(SecurityManager.java:120) at weblogic.servlet.internal.EventsManager.notifyContextCreatedEvent(EventsManager.java:181) at weblogic.servlet.internal.WebAppServletContext.preloadResources(WebAppServletContext.java:1870) at weblogic.servlet.internal.WebAppServletContext.start(WebAppServletContext.java:3155) at weblogic.servlet.internal.WebAppModule.startContexts(WebAppModule.java:1518) at weblogic.servlet.internal.WebAppModule.start(WebAppModule.java:487) at weblogic.application.internal.flow.ModuleStateDriver$3.next(ModuleStateDriver.java:427) at weblogic.application.utils.StateMachineDriver.nextState(StateMachineDriver.java:52) at weblogic.application.internal.flow.ModuleStateDriver.start(ModuleStateDriver.java:119) at weblogic.application.internal.flow.ScopedModuleDriver.start(ScopedModuleDriver.java:201) at weblogic.application.internal.flow.ModuleListenerInvoker.start(ModuleListenerInvoker.java:249) at weblogic.application.internal.flow.ModuleStateDriver$3.next(ModuleStateDriver.java:427) at weblogic.application.utils.StateMachineDriver.nextState(StateMachineDriver.java:52) at weblogic.application.internal.flow.ModuleStateDriver.start(ModuleStateDriver.java:119) at weblogic.application.internal.flow.StartModulesFlow.activate(StartModulesFlow.java:28) at weblogic.application.internal.BaseDeployment$2.next(BaseDeployment.java:672) at weblogic.application.utils.StateMachineDriver.nextState(StateMachineDriver.java:52) at weblogic.application.internal.BaseDeployment.activate(BaseDeployment.java:212) at weblogic.application.internal.EarDeployment.activate(EarDeployment.java:59) at weblogic.application.internal.DeploymentStateChecker.activate(DeploymentStateChecker.java:161) at weblogic.deploy.internal.targetserver.AppContainerInvoker.activate(AppContainerInvoker.java:79) at weblogic.deploy.internal.targetserver.operations.AbstractOperation.activate(AbstractOperation.java:569) at weblogic.deploy.internal.targetserver.operations.ActivateOperation.activateDeployment(ActivateOperation.java:150) at weblogic.deploy.internal.targetserver.operations.ActivateOperation.doCommit(ActivateOperation.java:116) at weblogic.deploy.internal.targetserver.operations.StartOperation.doCommit(StartOperation.java:149) at weblogic.deploy.internal.targetserver.operations.AbstractOperation.commit(AbstractOperation.java:323) at weblogic.deploy.internal.targetserver.DeploymentManager.handleDeploymentCommit(DeploymentManager.java:844) at weblogic.deploy.internal.targetserver.DeploymentManager.activateDeploymentList(DeploymentManager.java:1249) at weblogic.deploy.internal.targetserver.DeploymentManager.handleCommit(DeploymentManager.java:440) at weblogic.deploy.internal.targetserver.DeploymentServiceDispatcher.commit(DeploymentServiceDispatcher.java:164) at weblogic.deploy.service.internal.targetserver.DeploymentReceiverCallbackDeliverer.doCommitCallback(DeploymentReceiverCallbackDeliverer.java:195) at weblogic.deploy.service.internal.targetserver.DeploymentReceiverCallbackDeliverer.access$100(DeploymentReceiverCallbackDeliverer.java:13) at weblogic.deploy.service.internal.targetserver.DeploymentReceiverCallbackDeliverer$2.run(DeploymentReceiverCallbackDeliverer.java:69) at weblogic.work.SelfTuningWorkManagerImpl$WorkAdapterImpl.run(SelfTuningWorkManagerImpl.java:545) at weblogic.work.ExecuteThread.execute(ExecuteThread.java:256) at weblogic.work.ExecuteThread.run(ExecuteThread.java:221)

    Read the article

  • Do parent website application pools serve child application pools as well?

    - by Mike G
    I am running a .NET web application in its own application pool on IIS7. The parent website is set to run in its own application pool. Today we noticed a huge number of connections going to IIS. I tried to browse a plain ol' .html page in the directory of the web application and it hangs. I then try to browse another plain .html file in the root of the parent website, and it too hangs. In performance monitor, i see there are some 8k connections to the default website and climbing. I cant seem to understand if my application was the problem, or IIS itself. If it was my application, wouldnt the html page in the root of the parent website still be able to be served? edit: Also, if i shut down the app pool to my application, the html page on the root of the parent website is still not able to be displayed.

    Read the article

  • EBS 12.1.1 Test Starter Kit now Available for Oracle Application Testing Suite

    - by Steven Chan
    We've discussed automated testing tools for the E-Business Suite several times on this blog, since testing is such a key part of everyone's implementation lifecycle.  An important part of our testing arsenal in E-Business Suite Development is the Oracle Application Testing Suite.  The Oracle Automated Testing Suite (OATS) is built on the foundation of the e-TEST suite of products acquired from Empirix  in 2008.  The testing suite is comprised of:   1. Oracle Load Testing for scalability, performance, and load testing   2. Oracle Functional Testing for automated functional and regression testing   3. Oracle Test Manager for test process management, test execution, and defect trackingOracle Application Testing Suite 9.0 has been supported for use with the E-Business Suite since 2009.  I'm very pleased to let you know that our E-Business Suite Release 12.1.1 Test Starter Kit is now available for Oracle Application Testing Suite 9.1.  You can download it here:Oracle Application Testing Suite Downloads

    Read the article

  • Web application development over C++ development..

    - by learnerforever
    Hi, I am CS undergrad and CS grad. In college I used to program in C/C++/java and have pretty much stuck to the same skill set in industry with 3 years experience. I like thinking,reading,applying logic etc, designing data structures, but I have little patience with debugging large C++ code. And having to deal with low level stuff like memory fault,memory corruption,compilation/linking issues. My confidence in programming is getting down due to this, but I like being in technical field. Does web application development like LAMP suit (Linux,apache,mysql,php),CSS,scripting (AMONG OTHER WEB DEVELOPMENT RELATED SKILLS) etc need lesser patience with debugging,and understanding of low level stuff, but your analysis/logical skills also get used? Also opportunities in web application development look more. Things like scalability, most of the stuff that Google does fascinates me, but for patience needed for dealing with C++ debugging. I make blunders while coding. How does the field look like outside C++? I am beginning to wonder if as a female, by moving to web application development, I can better manage work life balance. I have seen relatively lesser females in C++ than in Java/.net. Not very sure about web related stuff though. Also, what are the other hot technologies being used in web application development? lamp,css is something I know vaguely. Not in touch with keywords going on in this area. Please help!!.

    Read the article

  • Cash Application Work Queue in Oracle Receivables Release 12.1.1

    - by Robert Story
    Upcoming WebcastTitle: Cash Application Work Queue in Oracle Receivables Release 12.1.1Date: March 24, 2010Time: 10:00 am EDT, 7:00 am PDT, 14:00 GMT Product Family: E-Business Suite Receivables 12.1.1 Receipts Summary Understand the setups and processes for the Cash Application Work Queue in Release 12.1.1 and learn how to diagnose basic functional issues. This one-hour session is recommended for technical and functional users. We will be covering topics related to processing receipts efficiently, managing the work load of cash application owners and diagnosing issues. Topics will include: Description of Cash Application Work Queue Setup and Work Queue Process Dependencies and Interactions Basic Troubleshooting Steps A short, live demonstration (only if applicable) and question and answer period will be included. Click here to register for this session....... ....... ....... ....... ....... ....... .......The above webcast is a service of the E-Business Suite Communities in My Oracle Support.For more information on other webcasts, please reference the Oracle Advisor Webcast Schedule.Click here to visit the E-Business Communities in My Oracle Support Note that all links require access to My Oracle Support.

    Read the article

< Previous Page | 41 42 43 44 45 46 47 48 49 50 51 52  | Next Page >