Search Results

Search found 37048 results on 1482 pages for 'whole line'.

Page 455/1482 | < Previous Page | 451 452 453 454 455 456 457 458 459 460 461 462  | Next Page >

• Rails 3 beta 1 - Nested layouts - LocalJumpError

  - by Art Shayderov

  Hi Nested layouts do not work in Rails 3. After I hit this I tried Rails Guides Example on a blank project (both ruby 1.9.1 and 1.8.7). LocalJumpError no block given on line <%= yield :stylesheets %. If you remove this line you will get the same error on the next yield statement. Could someone fix(patch) this? It's probably just a matter of calling block_given? in the right place. That would be great. Thanks Added on 4/3: Rails 3 beta 2 released. Problem fixed.

  Read the article

• How to get LSB bit in MIPS?

  - by israkir

  Is there a short way to check/get for least significant bit in a 32-bit integer, in MIPS? It is obviously set for the odd numbers and an algorithm which checks for the whole number is odd or even can decide for this. But I just wonder is there a better way to do this...

  Read the article

• How do I detect a Word table with (horizontally) merged cells?

  - by Reuben

  When a Word table contains horizontally merged cells, accessing aTable.Columns.First or performing a For Each over aTable.Columns will result in an error. Is there a way to determine if a table contains horizontally merged cells without resulting in an error? I've read Determine if a Word cell is merged, but that is about detecting if a particular Word table cell is merged, rather than does the whole table have any merged cells.

  Read the article

• Safest LAMP encrypt method

  - by Adam Kiss

  Hello, what is PHP's safest encrypt/decrypt method, in use with MySQL - to store let's say passwords? Of course, not for portal purposes. I want to do little password (domain/mysql/ftp...) storage for whole team online, but I don't want really to endanger our clients' bussinesses. Hash can't be used for obvious reasons (Doesn't really make sense to run rainbow tables every time :D). Any idea?

  Read the article

• "_FILE_AND_LINE_ is not defined in this scope" (compiling RakNet NAT examples in OS X)

  - by Michael F

  Hello! I'm working on a RakNet-based project (using 3.8 on OS X 10.6), and I'm trying to work through the various examples that demonstrate the parts of RakNet I want to use. For the "NatCompleteClient" example, I've imported the source into a command-line project in XCode, along with the UPNP dependency. At compile time I've had a few errors in the UPNP section, though, and I can't find any guidance on this. In UPNPPortForwarder.mm, there are 7 lines that use _FILE_AND_LINE_, and the compiler is not happy; for example on line 232: foundInterfaces.Deallocate(r1,_FILE_AND_LINE_); causes: UPNPPortForwarder.mm:232: error: '_FILE_AND_LINE_' was not declared in this scope Can anyone tell me what this is all about? That variable doesn't seem to get talked about very often... or Google doesn't like to find it.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Updating a TextView with a SeekBar's value (ultra-slow)

  - by Peter Bjorn

  Now look at that! I am having trouble with one of the simplest goals: updating a plain TextView with the value of a SeekBar. This is my approach: @Override public void onProgressChanged(SeekBar seekBar, int progress, boolean fromUser) { if (fromUser) { mInfoText.setText(mFunction.getUserFriendlyString(progress)); } } It basically works, but it kind of blocks the whole UI when I'm dragging. (Note: I tried both View.post() and Activity.runOnUiThread()). Am I overlooking something?

  Read the article

• Document.oncontextmenu, component is not available (firefox)

  - by Tom J Nowell

  I have a script for a website, and one of the things ti does right at the end if attempt to disable an anti-right click protection in a website if($("span[class=MembersNameDisplay]").exists()){ var list_row = document.getElementsByTagName('script'); if(list_row != null){ list_row[0].parentNode.removeChild(list_row[0]); } } document.oncontextmenu=new Function("return true"); In google chrome this works, however in firefox with greasemonkey, the last line fails and the protection is not removed. Error: Component is not available Line: 171 How do I fix this, and why does it fail under firefox?

  Read the article

• Eclipse: Double semi-colon on an import

  - by smp7d

  Using Eclipse, if I have an extra semicolon on an import line (not the last import line), I see a syntax error in the IDE. However, this compiles fine outside of the IDE (Maven in this case). Example: import java.util.ArrayList;; //notice extra semicolon import java.util.List; Does anyone else see this behavior? Why is this showing as a syntax error? I am working with someone who keeps pushing these this to source control and it is irritating me (they clearly aren't using Eclipse). Full disclosure... I am using SpringSource Tool Suite 2.8.0.

  Read the article

• Can I use the browser's word-wrapping from JavaScript?

  - by Max

  I have some text in a div. It can be any Unicode text under the sun, including Chinese, Japanese, and Korean. Now, I need to take this text and word-wrap it in JavaScript in some efficient but correct manner. (Because I need to make each line start with "" in a textarea.) Browsers have an implementation of the Unicode Word Wrap algorithm, as is evidenced by word-wrapping Unicode text in a with CSS. (At least, Firefox has such an algorithm, and I suspect other browsers do as well.) What I need is some way for JavaScript to use the same word-wrapping algorithm, so that I can properly wrap and then "quote" Unicode text. Is there any way for JavaScript to use the browser's word-wrapping algorithm, or to know where text has been line-broken in a div or any other element?

  Read the article

• Deploying patches and new versions.

  - by 0plus1

  I'm deveoping a big project, I have the dev folder (connected to a specific subdomain) then the "real" folder, the live one. When I'm ready to push patches or whole new versions I'm currently copying the files individually, is there a program that can help me do this task? Keep in mind that some files (the config one and the htacess) must never change in the live version. Thank you

  Read the article

• Rendering suggested values from an ext Combobox to an element in the DOM

  - by qui

  I have an ext combobox which uses a store to suggest values to a user as they type. An example of which can be found here: combobox example Is there a way of making it so the suggested text list is rendered to an element in the DOM. Please note I do not mean the "applyTo" config option, as this would render the whole control, including the textbox to the DOM element.

  Read the article

• Template class implicit copy constructor issues

  - by Nate

  Stepping through my program in gdb, line 108 returns right back to the calling function, and doesn't call the copy constructor in class A, like (I thought) it should: template <class S> class A{ //etc... A( const A & old ){ //do stuff... } //etc... }; template <class T> class B{ //etc... A<T> ReturnsAnA(){ A<T> result; // do some stuff with result return result; //line 108 } //etc... }; Any hints? I've banged my head against the wall about this for 4 hours now, and can't seem to come up with what's happening here.

  Read the article

• In python writing from XML to CSV, encoding error

  - by user574435

  Hi, I am trying to convert an XML file to CSV, but the encoding of the XML ("ISO-8859-1") apparently contains characters that are not in the ascii codec which Python uses to write rows. I get the error: Traceback (most recent call last): File "convert_folder_to_csv_PLAYER.py", line 139, in <module> xml2csv_PLAYER(filename) File "convert_folder_to_csv_PLAYER.py", line 121, in xml2csv_PLAYER fout.writerow(row) UnicodeEncodeError: 'ascii' codec can't encode character u'\xe1' in position 4: ordinal not in range(128) I have tried opening the file as follows: dom1 = parse(input_filename.encode( "utf-8" ) ) and I have tried replacing the \xe1 character in each row before it is written. Any suggestions?

  Read the article

• my .jar file won't do anything.

  - by David

  I created a program that more or less holds an array of strings as an object and randomly prints one. so basicaly class Happy { string[] namestrings = new string[#] constructor() { fill with some strings} public static void main (String[]arg) { create instance of class do some junk with it method that prints it } method that prints it {} another method } when i compile and run it on the command line it works fine but when on the comand line i type in jar -cf Happy.jar Fun.class i get a .jar file called Happy and when i click on it i get an error message that reads "the java Jar file happy could not be launched read the consol for possible error messages" I have a mac i'm running lepord if that makes a diference. Whats going on?

  Read the article

• What is this for an IP in my google app engine log file?

  - by Christian Harms

  I get many normal log lines in my google app engine application. But today I go these instead the 4-part number: 2a01:e35:2f20:f770:6c54:3ee8:67fb:df8 What is this for an format? ipv6 are 6 numbers, mac address too... Normal logfile line: 187.14.44.208 - - [19/Mar/2010:14:31:35 -0700] "GET /geo_data.js HTTP/1.1" 200 776 "http://www.xxx.com.br/spl19/index.php?refid=gv_av_ri" "Mozilla/5.0 (Windows; U; Windows NT 5.1; pt-BR; rv:1.9.2) Gecko/20100115 Firefox/3.6 (.NET CLR 3.5.30729),gzip(gfe)" This special logfile line: 2a01:e35:2f20:f770:6c54:3ee8:67fb:df8 - - [18/Mar/2010:17:00:37 -0700] "GET /geo_data.js HTTP/1.1" 500 450 "http://www.xxx.com.br/spl19/index.php?refid=cm_av_ri" "Mozilla/5.0 (Windows; U; Windows NT 6.1; pt-PT; rv:1.9.2) Gecko/20100115 Firefox/3.6,gzip(gfe)"

  Read the article

• urllib alternative for iPhone

  - by Pr301

  hi, I am trying to create an iPhone application which in some point connects to the internet, fills an on-line form, fetches the resulting website, parses it and returns a string to the user. I want all this process to happen in the background. I know how to do this kind of things with python and urllib but in objc I can't find an alternative, from on-line search I found either sites that explain how to use webkit to retrieve webpages (I suppose this is for displaying them to the user) or how to parse an existing HTML file or string. Since I want the file to be retrieved from the internet and the whole process should be running in the background, neither of these solutions covers my needs.

  Read the article

• Newline character in stringbuilder - C#

  - by nettguy

  How do you append new line(\n\r) character in StringBuilder?

  Read the article

• jQuery each function, getting the data out of it

  - by Ankur

  I am trying to use the jQuery each function (line 5) to display the results of an AJAX call. when I write resultObj.value on line 6 how come I am not getting any data? Am I making a syntax error (I am pretty sure that I must be)? success : function(resultObj) { count = count+1; $(".objHolder").filter("#"+id).append("<table border='1' cellspacing='4' cellpadding='4' class='preTable' id='"+id+"' level='"+count+"'><tr><td class='preItem' id='"+id+"' level='"+count+"'><img src='images/right.jpg' width='16' height='10' /></td><td class='preList'>&nbsp;</td><td class='preHolder' level='"+count+"'>&nbsp;</td></tr></table>"); isClicked[level]="yes"; $.each(resultObj, function(index, value){ $(".preHolder").filter("#"+id).append(resultObj.value); }); } });

  Read the article

• HASHREF in Perl

  - by Uri

  I'm trying to decrypt a Perl code which I'm not familiar with, somehow related to HashRef. I'm using Amazon::S3, but my question is a general Perl question. See the code below: use Amazon::S3; my $s3 = Amazon::S3-new( ... ); my $response = $s3-buckets; Documentation (here) sais, about s3-buckets: Returns undef on error, else HASHREF of results The following line is working for me, but I don't understand why: for $b in ( @ { $response-{buckets} } ) { print "bucket: " . $b-bucket . "\n"; } I'm buzzled by each operator on the first line. What type exactly are $response, $respone-{bucket}. Looks like the expression within the 'for' is an array, but I don't understand this syntax: @{ ... }?

  Read the article

• Netbeans PHP require_once() problem

  - by mawg

  I'm stumped! In PHP in Netbeans (6.8), a project has two files, file1.php and file2.php file1.php starts require_once('file2.php'); and I get Warning: require_once(query_form.php): failed to open stream: No such file or directory in C:\xampp\htdocs\my_project\file1.php on line 3 Call Stack: 0.0741 322920 1. {main}() C:\xampp\htdocs\my_project\file1.php:0 Fatal error: require_once(): Failed opening required 'file2.php' (include_path='.;\xampp\php\PEAR') in C:\xampp\htdocs\my_project\file1.php on line 3 Call Stack: 0.0741 322920 1. {main}() C:\xampp\htdocs\my_project\file1.php:0 I tried require_once('./file2.php'); and require_once('.\file2.php'); since it is windows. I even added C:\xampp\htdocs\my_project\ to the projects include path and it shows up as such on the prject view and see file1.php and file2.php It doesn't show up on this error report, but possibly because Netbeans (or PHP ]) knows that C:\xampp\htdocs\my_project\ === . Any suggestions? Btw, I am new to Netbeans, so it i sprobably something very obvious.

  Read the article

• Running OpenMPI on Windows XP

  - by iamweird

  Hi there. I'm trying to build a simple cluster based on Windows XP. I compiled OpenMPI-1.4.2 successfully, and tools like mpicc and ompi_info work too, but I can't get my mpirun working properly. The only output I can see is Z:\orterun --hostfile z:\hosts.txt -np 2 hostname [host0:04728] Failed to initialize COM library. Error code = -2147417850 [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\mca\ess\hnp\ess_hnp_module.c at line 218 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_plm_init failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\runtime\orte_init.c at line 132 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_ess_set_name failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\..\..\openmpi -1.4.2\orte\tools\orterun\orterun.c at line 543 Where z:\hosts.txt appears as follows: host0 host1 Z: is a shared network drive available to both host0 and host1. What my problem is and how do I fix it? Upd: Ok, this problem seems to be fixed. It seems to me that WideCap driver and/or software components causes this error to appear. A "clean" machine runs local task successfully. Anyway, I still cannot run a task within at least 2 machines, I'm getting following message: Z:\mpirun --hostfile z:\hosts.txt -np 2 hostname connecting to host1 username:cluster password:******** Save Credential?(Y/N) y [host0:04728] This feature hasn't been implemented yet. [host0:04728] Could not connect to namespace cimv2 on node host1. Error code =-2147024891 -------------------------------------------------------------------------- mpirun was unable to start the specified application as it encountered an error. More information may be available above. -------------------------------------------------------------------------- I googled a little and did all the things as described here: http://www.open-mpi.org/community/lists/users/2010/03/12355.php but I'm still getting the same error. Can anyone help me? Upd2: Error code -2147024891 might be WMI error WBEM_E_INVALID_PARAMETER (0x80041008) which occures when one of the parameters passed to the WMI call is not correct. Does this mean that the problem is in OpenMPI source code itself? Or maybe it's because of wrong/outdated wincred.h and credui.lib I used while building OpenMPI from the source code?

  Read the article

• Why was this T-SQL Syntax never implemented?

  - by ChrisA

  Why did they never let us do this sort of thing: Create Proc RunParameterisedSelect @tableName varchar(100), @columnName varchar(100), @value varchar(100) as select * from @tableName where @columnName = @value You can use @value as a parameter, obviously, and you can achieve the whole thing with dynamic SQL, but creating it is invariably a pain. So why didn't they make it part of the language in some way, rather than forcing you to EXEC(@sql)?

  Read the article

• UIViewController is popped from view stack and NSURLConnection crashes the application

  - by rickharrison

  I am pushing a UIViewController onto a UINavigationController. This view controller immediately starts a download of an xml feed and then parses it. However, if you hit the back button before it is done downloading, and crashes with EXC_BAD_ACCESS. The line that is crashing it is in parserDidEndDocument and is this line: if (self.delegate && [self.delegate conformsToProtocol:@protocol(ModelDelegate)]) [self.delegate modelDidFinishParsing:self]; I assume it is crashing because it is trying to access self.delegate which is not assigned anymore. How do I get around this? Also, I would release the model object in the modelDidFinishParsing method. How would I release this model if it never reaches this method.

  Read the article

• How to read tags out of m4a files in .NET?

  - by dkackman

  I've got some heavily modified code that ultimately came from the Windows Media SDK that works great for reading tags out of MP3 and WMV files. Somewhere along the line, Windows Media Player added support for .m4a files (was it in Windows 7?) but the Windows Media API doesn't seem to reflect that addition (or at least IWMMetadataEditor2::OpenEx pukes on an .m4a file). What would be some good C# code or links on how to dig meta data tags out of m4a files? (Google has come up dry on the C# front.) UPDATE AtomicParsley did indeed end being the best approach. Since that code is a command line tool however I ended up having to create a managed wrapper around some of its functionality in order to use in-process. It is posted on google code if anyone else needs such a thing.

  Read the article

< Previous Page | 451 452 453 454 455 456 457 458 459 460 461 462  | Next Page >