Search Results

Search found 34094 results on 1364 pages for 'open authentication'.

Page 458/1364 | < Previous Page | 454 455 456 457 458 459 460 461 462 463 464 465  | Next Page >

• OpenVPN on ec2 bridged mode connects but no Ping, DNS or forwarding

  - by michael

  I am trying to use OpenVPN to access the internet over a secure connection. I have openVPN configured and running on Amazon EC2 in bridge mode with client certs. I can successfully connect from the client, but I cannot get access to the internet or ping anything from the client I checked the following and everything seems to shows a successful connection between the vpn client/server and UDP traffic on 1194 [server] sudo tcpdump -i eth0 udp port 1194 (shows UDP traffic after establishing connection) [server] sudo iptables -L Chain INPUT (policy ACCEPT) target prot opt source destination ACCEPT all -- anywhere anywhere ACCEPT all -- anywhere anywhere Chain FORWARD (policy ACCEPT) target prot opt source destination ACCEPT all -- anywhere anywhere Chain OUTPUT (policy ACCEPT) target prot opt source destination [server] sudo iptables -L -t nat Chain PREROUTING (policy ACCEPT) target prot opt source destination Chain POSTROUTING (policy ACCEPT) target prot opt source destination MASQUERADE all -- ip-W-X-Y-0.us-west-1.compute.internal/24 anywhere Chain OUTPUT (policy ACCEPT) target prot opt source destination [server] openvpn.log Wed Oct 19 03:11:26 2011 localhost/a.b.c.d:61905 [localhost] Inactivity timeout (--ping-restart), restarting Wed Oct 19 03:11:26 2011 localhost/a.b.c.d:61905 SIGUSR1[soft,ping-restart] received, client-instance restarting Wed Oct 19 03:41:31 2011 MULTI: multi_create_instance called Wed Oct 19 03:41:31 2011 a.b.c.d:57889 Re-using SSL/TLS context Wed Oct 19 03:41:31 2011 a.b.c.d:57889 LZO compression initialized Wed Oct 19 03:41:31 2011 a.b.c.d:57889 Control Channel MTU parms [ L:1574 D:166 EF:66 EB:0 ET:0 EL:0 ] Wed Oct 19 03:41:31 2011 a.b.c.d:57889 Data Channel MTU parms [ L:1574 D:1450 EF:42 EB:135 ET:32 EL:0 AF:3/1 ] Wed Oct 19 03:41:31 2011 a.b.c.d:57889 Local Options hash (VER=V4): '360696c5' Wed Oct 19 03:41:31 2011 a.b.c.d:57889 Expected Remote Options hash (VER=V4): '13a273ba' Wed Oct 19 03:41:31 2011 a.b.c.d:57889 TLS: Initial packet from [AF_INET]a.b.c.d:57889, sid=dd886604 ab6ebb38 Wed Oct 19 03:41:35 2011 a.b.c.d:57889 VERIFY OK: depth=1, /C=US/ST=CA/L=SanFrancisco/O=EXAMPLE/CN=EXAMPLE_CA/[email protected] Wed Oct 19 03:41:35 2011 a.b.c.d:57889 VERIFY OK: depth=0, /C=US/ST=CA/L=SanFrancisco/O=EXAMPLE/CN=localhost/[email protected] Wed Oct 19 03:41:37 2011 a.b.c.d:57889 Data Channel Encrypt: Cipher 'BF-CBC' initialized with 128 bit key Wed Oct 19 03:41:37 2011 a.b.c.d:57889 Data Channel Encrypt: Using 160 bit message hash 'SHA1' for HMAC authentication Wed Oct 19 03:41:37 2011 a.b.c.d:57889 Data Channel Decrypt: Cipher 'BF-CBC' initialized with 128 bit key Wed Oct 19 03:41:37 2011 a.b.c.d:57889 Data Channel Decrypt: Using 160 bit message hash 'SHA1' for HMAC authentication Wed Oct 19 03:41:37 2011 a.b.c.d:57889 Control Channel: TLSv1, cipher TLSv1/SSLv3 DHE-RSA-AES256-SHA, 1024 bit RSA Wed Oct 19 03:41:37 2011 a.b.c.d:57889 [localhost] Peer Connection Initiated with [AF_INET]a.b.c.d:57889 Wed Oct 19 03:41:39 2011 localhost/a.b.c.d:57889 PUSH: Received control message: 'PUSH_REQUEST' Wed Oct 19 03:41:39 2011 localhost/a.b.c.d:57889 SENT CONTROL [localhost]: 'PUSH_REPLY,redirect-gateway def1 bypass-dhcp,route-gateway W.X.Y.Z,ping 10,ping-restart 120,ifconfig W.X.Y.Z 255.255.255.0' (status=1) Wed Oct 19 03:41:40 2011 localhost/a.b.c.d:57889 MULTI: Learn: (IPV6) -> localhost/a.b.c.d:57889 [client] tracert google.com Tracing route to google.com [74.125.71.104] over a maximum of 30 hops: 1 347 ms 349 ms 348 ms PC [w.X.Y.Z] 2 * * * Request timed out. I can also successfully ping the server IP address from the client, and ping google.com from an SSH shell on the server. What am I doing wrong? Here is my config (Note: W.X.Y.Z == amazon EC2 private ipaddress) bridge config on br0 ifconfig eth0 0.0.0.0 promisc up brctl addbr br0 brctl addif br0 eth0 ifconfig br0 W.X.Y.X netmask 255.255.255.0 broadcast W.X.Y.255 up route add default gw W.X.Y.1 br0 /etc/openvpn/server.conf (from https://help.ubuntu.com/10.04/serverguide/C/openvpn.html) local W.X.Y.Z dev tap0 up "/etc/openvpn/up.sh br0" down "/etc/openvpn/down.sh br0" ;server W.X.Y.0 255.255.255.0 server-bridge W.X.Y.Z 255.255.255.0 W.X.Y.105 W.X.Y.200 ;push "route W.X.Y.0 255.255.255.0" push "redirect-gateway def1 bypass-dhcp" push "dhcp-option DNS 208.67.222.222" push "dhcp-option DNS 208.67.220.220" tls-auth ta.key 0 # This file is secret user nobody group nogroup log-append openvpn.log iptables config sudo iptables -A INPUT -i tap0 -j ACCEPT sudo iptables -A INPUT -i br0 -j ACCEPT sudo iptables -A FORWARD -i br0 -j ACCEPT sudo iptables -t nat -A POSTROUTING -s W.X.Y.0/24 -o eth0 -j MASQUERADE echo 1 > /proc/sys/net/ipv4/ip_forward Routing Tables added route -n Kernel IP routing table Destination Gateway Genmask Flags Metric Ref Use Iface W.X.Y.0 0.0.0.0 255.255.255.0 U 0 0 0 br0 0.0.0.0 W.X.Y.1 0.0.0.0 UG 0 0 0 br0 C:>route print =========================================================================== Interface List 32...00 ff ac d6 f7 04 ......TAP-Win32 Adapter V9 15...00 14 d1 e9 57 49 ......Microsoft Virtual WiFi Miniport Adapter #2 14...00 14 d1 e9 57 49 ......Realtek RTL8191SU Wireless LAN 802.11n USB 2.0 Net work Adapter 10...00 1f d0 50 1b ca ......Realtek PCIe GBE Family Controller 1...........................Software Loopback Interface 1 11...00 00 00 00 00 00 00 e0 Teredo Tunneling Pseudo-Interface 16...00 00 00 00 00 00 00 e0 Microsoft ISATAP Adapter 17...00 00 00 00 00 00 00 e0 Microsoft ISATAP Adapter #2 18...00 00 00 00 00 00 00 e0 Microsoft ISATAP Adapter #3 36...00 00 00 00 00 00 00 e0 Microsoft ISATAP Adapter #5 =========================================================================== IPv4 Route Table =========================================================================== Active Routes: Network Destination Netmask Gateway Interface Metric 0.0.0.0 0.0.0.0 10.1.2.1 10.1.2.201 25 10.1.2.0 255.255.255.0 On-link 10.1.2.201 281 10.1.2.201 255.255.255.255 On-link 10.1.2.201 281 10.1.2.255 255.255.255.255 On-link 10.1.2.201 281 127.0.0.0 255.0.0.0 On-link 127.0.0.1 306 127.0.0.1 255.255.255.255 On-link 127.0.0.1 306 127.255.255.255 255.255.255.255 On-link 127.0.0.1 306 224.0.0.0 240.0.0.0 On-link 127.0.0.1 306 224.0.0.0 240.0.0.0 On-link 10.1.2.201 281 255.255.255.255 255.255.255.255 On-link 127.0.0.1 306 255.255.255.255 255.255.255.255 On-link 10.1.2.201 281 =========================================================================== Persistent Routes: Network Address Netmask Gateway Address Metric 0.0.0.0 0.0.0.0 10.1.2.1 Default =========================================================================== C:>tracert google.com Tracing route to google.com [74.125.71.147] over a maximum of 30 hops: 1 344 ms 345 ms 343 ms PC [W.X.Y.221] 2 * * * Request timed out.

  Read the article

• How to configure a session timeout for Grails application?

  - by curd0

  In one of controllers in my Grails application I'm preserving a parameter value in a session variable like this: session.myVariable = params.myValue After that, I can access the saved value from different controllers/GSP-pages as long as I actively use the app. However, if I don't use my app for a while, even though my browser window is still open, the session variable looses it's value. Does this happens because the session expires? I was under impression that a session lives until the browser window is still open, but apparently I was wrong. What should I do to ensure all session variables I define in my Grails app don't expire until the browser is closed? Is there any way to set session timeout manually? Thank you in advance for your answers!

  Read the article

• Bing Maps - how to link to a push pin from a link outside the map

  - by Rajah

  I have a Virtual Earth Maps (Bing Maps??) to which I have added a set of pushpins. Each pushpin is labelled 1 to n. In addition to adding pushpins to the map, I also add text to the web-page that contains the description to each pushpin. I would like to add a link to the text outside the map, that when clicked will open the balloon associated with the corresponding pushpin. How do I open the balloon associated with a pushpin, through a link that exists outside the map? To get a better understanding, look at my map: link. When you click load, PushPins are added to the map. I would like to have a link from the list on the right of the map, that opens the corresponding PushPin. Thanks in advance!

  Read the article

• PAM_LDAP error trying to bind ?

  - by billyduc

  I have this error when I ssh to my LDAP client using the login name on the LDAP server my LDAP client's running Ubuntu 9.10 Karmic my LDAP server is Fedora Core 4 and running Fedora Directory Server ssh [email protected] cat /var/log/auth.log //on the client Dec 18 10:24:17 ubuntu-ltsp sshd[4527]: pam_unix(sshd:auth): authentication failure; logname= uid=0 euid=0 tty=ssh ruser= rhost=billyhost.local user=billyduc Dec 18 10:24:17 ubuntu-ltsp sshd[4527]: pam_ldap: error trying to bind as user "uid=billyduc,dc=mydomain,dc=com" (Invalid credentials) Dec 18 10:24:18 ubuntu-ltsp sshd[4527]: Failed password for billyduc from 192.168.5.121 port 51449 ssh2 Here's my /etc/pam.d/sshd cat /etc/pam.d/sshd auth [success=1 default=ignore] pam_unix.so auth required pam_ldap.so use_first_pass auth required pam_permit.so account sufficient pam_permit.so I also edit my /etc/ssh/sshd_config in both client and Server PasswordAuthentication yes So I think something wrong with the password when the ssh server do checking

  Read the article

• Revocation status of DC can't be verified

  - by DotGeorge

  A Domain Controller within my forest was working fine (as the story usually goes). Then, suddenly, I can't logon with my smart card. Instead, I'm greeted with the following message: The system could not log you on. The revocation status of the domain controller certificate used for smart card authentication could not be determined. I literally have no idea what's happened here. As an attempted quick fix, I removed the root certificate which issued the Smart Card's certificate from the CA of both the client and DC. Then imported a newly exported one from the DC in question. Same issue. I've spotted a number of related articles on Microsoft's forums and a HP support document. Each don't really shed much light as it's a generic error message apparently. Having said all of this, other smart cards (issued from other DCs) work fine. So I have no idea what's up with this one.

  Read the article

• which asp net hosting site allows to listen on differnt port than 80 and uses .net 4?

  - by ijjo

  i'm trying to take advantage of html 5 web sockets in .NET and the easiest way appears to do something like this guy does: http://www.codeproject.com/KB/webservices/c_sharp_web_socket_server.aspx?msg=3485900#xx3485900xx i've already tested this myself and it works great, but there are a few problems if i try to deploy this to my hosting site (discountasp.net). basically i am not allowed to open up a port on 8080 and listen on it. i then tried to figure out a way to listen non port 80 with IIS as well, but using the HTTPListener runs into sercurity issues as well that doesn't seem like will help since i can't mess with this stuff on the hosting site server either: http://stackoverflow.com/questions/169904/can-i-listen-on-a-port-using-httplistener-or-other-net-code-on-vista-without-r so to make my life easier, i think i need to find a hosting site that simply allows me to open up a socket on port 8080 and listen on it. anyone know of one? or anyone know of a workaround (besides sniffing ALL the traffic on port 80)?

  Read the article

• Poor upload/download speed on 2 x ADSL lines into a Cisco 2621XM

  - by 2020mobile

  Hi, Sorry never been on this site before so I apologise if not the right section or even forum. I have users complaining of very slow internetn connectivity on site and have checked with our ISP who have said that the line is testing at 8mb. We have 2 x BT lines that have our ISP broadand on them. Both lines go into a Cisco 2600 series router that then has a PIX firewall off that. Connectivity is successful just gone really slow and unable to download anything. Config is below: version 12.3 no service pad service tcp-keepalives-in service tcp-keepalives-out service timestamps debug datetime msec service timestamps log datetime msec service password-encryption ! hostname ROUTER-ADSL-INTERNET ! logging buffered 16384 informational enable secret xxx enable password xxx ! username xxx username xxx clock summer-time UK recurring last Sun Mar 1:00 last Sun Oct 1:00 aaa new-model ! ! aaa authentication login default local aaa authorization exec default local aaa session-id common ip subnet-zero no ip source-route ! ! ! ip audit notify log ip audit po max-events 100 no ip bootp server ip name-server 213.208.106.212 no mpls ldp logging neighbor-changes no ftp-server write-enable ! ! ! ! ! ! ! ! ! ! no voice hpi capture buffer no voice hpi capture destination ! ! ! ! ! ! ! ! interface ATM0/0 description 01270 111111 no ip address no atm ilmi-keepalive pvc 0/38 encapsulation aal5mux ppp dialer dialer pool-member 1 ! dsl operating-mode auto ! interface FastEthernet0/0 ip address 82.133.32.9 255.255.255.248 shutdown speed 100 full-duplex no cdp enable ! interface ATM0/1 description 01270 222222 no ip address no atm ilmi-keepalive pvc 0/38 encapsulation aal5mux ppp dialer dialer pool-member 1 ! dsl operating-mode auto ! interface FastEthernet0/1 ip address 217.146.115.49 255.255.255.240 duplex auto speed auto no cdp enable ! interface Dialer0 ip address 217.146.115.250 255.255.255.248 encapsulation ppp dialer pool 1 dialer-group 1 ppp authentication chap callin ppp chap hostname [email protected] ppp chap password 7 xxxxx ppp multilink ! ip classless ip route 0.0.0.0 0.0.0.0 Dialer0 ! no ip http server no ip http secure-server ! no logging trap access-list 10 permit 217.146.115.50 access-list 10 permit 82.133.32.10 access-list 10 deny any access-list 22 permit 217.146.115.50 access-list 22 permit 217.206.239.86 access-list 22 permit 82.133.32.10 access-list 22 deny any dialer-list 1 protocol ip permit no cdp run ! ! snmp-server community xxxxxx RO 10 snmp-server enable traps tty radius-server authorization permit missing Service-Type ! ! ! ! ! ! line con 0 exec-timeout 5 0 password 7 xxxxxx line aux 0 no exec line vty 0 4 access-class 22 in exec-timeout 5 0 password 7 xxxxxx transport input telnet ssh transport output none line vty 5 15 password 7 xxxxxx transport input telnet ssh ! ntp clock-period 17180095 ntp server 130.88.200.98 ! ! end Now my knowledge is very limited but ISP have said that while the lines are bonded each needs a seperate login as they've recently changed their L2TP router and that enforces the use of seperate logins - when the lines were configured we were given two logins. So, my question is what changes do I need to make to the config in order to get this working? it was ok before their change and I do have another login :- 01270 111111 - [email protected] 01270 222222 - [email protected] Apologies for the long email and thanks for taking the time to read it. Any more info I can provide please let me know. Thanks,

  Read the article

• .NET version or port of Flying Saucer

  - by Tawani

  Is there any open source .NET project (or port) similar to the Flying Saucer project which renders HTML to PDF using iText?

  Read the article

• flex combobox hide and show down arrow

  - by crazy horse

  I am looking to implement a search text box as follows: When user starts typing in and there are non-zero results, the text box will open up and display the results below it. When the user selects a result, the text box closed, but this time with a down-arrow (like a combobox) so that the user can re-open the list. I suspect what I really need is a combobox with ability to hide/show the down arrow. How do I do this in Flex? Thanks in advance.

  Read the article

• known memory leaks in 3ds max?

  - by Denise

  I've set up a script in 3ds max to render a bunch of animations into frames. To do this, I open up a file with all of the materials, load an animation (as a bip) onto the figure, then render. We were seeing a problem where eventually the script would fail because it was unable to open the next file-- max had consumed all of the system memory. Closing max, of course, freed the memory, and we were able to continue with the script. I checked out the heapfree variable, hoping to see a memory leak within my script, hoping to see a memory leak within my own (maxscript) code-- but the amount of free space was the same after every animation. Then, it must be 3ds max which is consuming all of that memory. Nothing in max need be saved from animation to animation-- is there some way to get max to free that memory? (I've tried resetMaxFile() and manually deleting all of the objects in the scene). Is there any known sets of operations that cause max to grow out of control?

  Read the article

• C# file Decryption - Bad Data

  - by Jon

  Hi all, I am in the process of rewriting an old application. The old app stored data in a scoreboard file that was encrypted with the following code: private const String SSecretKey = @"?B?n?Mj?"; public DataTable GetScoreboardFromFile() { FileInfo f = new FileInfo(scoreBoardLocation); if (!f.Exists) { return setupNewScoreBoard(); } DESCryptoServiceProvider DES = new DESCryptoServiceProvider(); //A 64 bit key and IV is required for this provider. //Set secret key For DES algorithm. DES.Key = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Set initialization vector. DES.IV = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Create a file stream to read the encrypted file back. FileStream fsread = new FileStream(scoreBoardLocation, FileMode.Open, FileAccess.Read); //Create a DES decryptor from the DES instance. ICryptoTransform desdecrypt = DES.CreateDecryptor(); //Create crypto stream set to read and do a //DES decryption transform on incoming bytes. CryptoStream cryptostreamDecr = new CryptoStream(fsread, desdecrypt, CryptoStreamMode.Read); DataTable dTable = new DataTable("scoreboard"); dTable.ReadXml(new StreamReader(cryptostreamDecr)); cryptostreamDecr.Close(); fsread.Close(); return dTable; } This works fine. I have copied the code into my new app so that I can create a legacy loader and convert the data into the new format. The problem is I get a "Bad Data" error: System.Security.Cryptography.CryptographicException was unhandled Message="Bad Data.\r\n" Source="mscorlib" The error fires at this line: dTable.ReadXml(new StreamReader(cryptostreamDecr)); The encrypted file was created today on the same machine with the old code. I guess that maybe the encryption / decryption process uses the application name / file or something and therefore means I can not open it. Does anyone have an idea as to: A) Be able explain why this isn't working? B) Offer a solution that would allow me to be able to open files that were created with the legacy application and be able to convert them please? Thank you

  Read the article

• Serial Mac OS X constantly freezes/locks/dissappears for USB to Arduino

  - by Niraj D

  I have a problem with my C++ code running in Xcode with both the AMSerial library as well as the generic C (ioctl, termios). After a fresh restart, my application works well but after I "kill" the program the Serial (I think) is not released. I have checked my open files under /dev and have killed the connection to serial USB from there, but my C++ still can't open the USB port. I have narrowed this down to being a low level Mac OS X issue, regarding blocking the port indefinitely, regardless of closing it using the aforementioned libraries. Just for context, I'm trying to send numbers through my USB port, serially to an Arduino Duemilanove at 9600 baud. Running Serial Monitor in Arduino is perfectly fine, however, running through a C++ application it freezes up my computer, occasionally, my mouse/keyboard freeze up: requiring a hard reset. How can this problem be fixed? It seems like Mac OS X is not USB friendly!

  Read the article

• MS SQL Server not running on Win7

  - by Anas

  I have installed available all components of "MS_SQL_05" as give named instance on Win-7. I had a default instance running of MSSQL08. While Installing MSSQL05 Instance I choose to use windows authentication. But now I got a problem and my database engine is not running, actually no components are working except I am just able to login to Integration service. I think there is some Username issue, coz It using UsrNm :'Anas-PC\Anas' which seems incorrect. Here below is the detail =================================== Cannot connect to ANAS-PC\MS_SQL_05. =================================== Login failed for user 'Anas-PC\Anas'. (.Net SqlClient Data Provider) Server Name: ANAS-PC\MS_SQL_05 Error Number: 18456 Severity: 14 State: 1 Line Number: 65536

  Read the article

• jquery boxy plugin: prevent multiple instances of the same dialog when clicking the link multiple ti

  - by Lyon

  Hi, I'm using the Boxy jQuery plugin to open dialog windows and populating it through ajax. http://onehackoranother.com/projects/jquery/boxy/ Here's my code so far: $("a.create").click(function (e) { url = $(e.target).attr('href'); Boxy.load(url, {title:'Test'}); }); This opens up a dialog alright. However, if I click the link again, another dialog will open. How can I make it such that the previously opened Boxy dialog will come into focus? I only want one instance of this dialog. I tried assigning a variable to var ele = Boxy.load(); but the variable ele returns undefined... Alas, I can't make out much from the limited Boxy documentation available. Enabling the option modal: true would prevent the user from clicking on the link multiple times, but I don't want the overlay to show. Thanks for any light you can shed on this. -Lyon

  Read the article

• How to enable key forwarding with ssh-agent?

  - by Lamnk

  I've used the ssh-agent from oh-my-zsh to manage my SSH key. So far, so good, i only have to type the passphrase for my private key once when I start my shell and public key authentication works great. The problem is however that key forwarding doesn't work. There are 2 servers A & B which I can use public key to login. When I ssh into A then from there ssh into B, I must provide my password, which should not be the case. A is a CentOS 5.6 box, B is an Ubuntu 11.04 box. I have this on my local .ssh/config: Host * ForwardAgent yes OpenSSH on A is standard openssh 4.3 package provided by CentOS. I also enable ForwardAgent for ssh client on A, but forwarding still doesn't work.

  Read the article

• HAProxy authenticated httpchk (health check)

  - by Markel

  I am using HAProxy on EC2 and using httpchk to manage node availability. I had used a pseudo-unique path as the health check route in an attempt to make sure only my servers responded to the health check. Earlier today I had an EC2 server fall out of existence, and before the haproxy config was auto-regenerated (controller issues), Amazon had reassigned the IP to someone whom 200's every request (honeypot?), my HAProxy host then pulled the server back into rotation and started distributing some of my traffic there until the controller recovered and removed the ip from the list. TLDR; Is there a way to add a server authentication method to HAProxy's httpchk?

  Read the article

• ForwardAgent in Jenkins

  - by r_2

  I'm trying to enable ForwardAgent in the "Publish over SSH" Jenkins Plugin. This would allow jenkins to execute deployments, rsyncs and svn+ssh checkouts on remote servers. But there's no option for this in the GUI. ForwardAgent is set to yes in /etc/ssh/ssh_config and in /var/lib/jenkins/.ssh/config, but when Jenkins jobs login over ssh, the remote session does not have the key loaded in agent. ("Could not open a connection to your authentication agent.") Is there a way to force ForwardAgent, or a better way to do this (via a Jenkins slave)? Thanks for any ideas, much appreciated!

  Read the article

• String search and write into file in jython

  - by kdev

  hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

  Read the article

• Requiring 802.1x login before allowing access to network resources

  - by Calvin Froedge

  I have a ZyXel GS2200-24 managed switch, and a free-radius server running on Ubuntu 11.10. Radius is configured and when I log into the switch the authentication goes through Radius. Now, I'm trying to ensure that access to web resources (as an example, I set up a web server on the ip 192.168.1.2) requires first authenticating with radius, before the switch will allow the connection. Am I correct that this should be handled at the switch level? What are these rules usually called / how are they usually defined?

  Read the article

• Why isn't my assets folder being installed on emulator?

  - by Brad Hein

  Where are my assets being installed to? I utilize an assets folder in my new app. I have two files in the folder. When I install my app on the emulator, I cannot access my assets, and furthermore I cannot see them on the emulator filesystem. Extracted my apk and confirmed the assets folder exists: $ ls -ltr assets/ total 16 -rw-rw-r--. 1 brad brad 1050 2010-05-20 00:33 schema-DashDB.sql -rw-rw-r--. 1 brad brad 9216 2010-05-20 00:33 dash.db On the emulator, no assets folder: # pwd /data/data/com.gtosoft.dash # ls -l drwxr-xr-x system system 2010-05-20 00:46 lib # I just want to package a pre-built database with my app and then open it to obtain data when needed. Just tried it on my Moto Droid, unable to access/open the DB, just like the emulator: DBFile=/data/data/com.gtosoft.dash/assets/dash.db Building the DB on the fly from a schema file is out of the question because its such a slow process (about 5-10 statements per second is all I get for throughput).

  Read the article

• ssh permission denied

  - by Gitmo

  I am trying to ssh into a remote machine and I get the following debug messages: debug1: Reading configuration data /etc/ssh/ssh_config debug1: Applying options for * debug2: ssh_connect: needpriv 0 debug1: Connecting to xxx.xxx.x.xx [xxx.xxx.xx.x] port 22. debug1: Connection established. debug3: Not a RSA1 key file /home/hadoop/.ssh/id_rsa. debug2: key_type_from_name: unknown key type '-----BEGIN' debug3: key_read: missing keytype debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug3: key_read: missing whitespace debug2: key_type_from_name: unknown key type '-----END' debug3: key_read: missing keytype debug1: identity file /home/hadoop/.ssh/id_rsa type 1 debug1: Checking blacklist file /usr/share/ssh/blacklist.RSA-2048 debug1: Checking blacklist file /etc/ssh/blacklist.RSA-2048 debug1: Remote protocol version 2.0, remote software version OpenSSH_5.1p1 Debian-6ubuntu2 debug1: match: OpenSSH_5.1p1 Debian-6ubuntu2 pat OpenSSH* debug1: Enabling compatibility mode for protocol 2.0 debug1: Local version string SSH-2.0-OpenSSH_5.1p1 Debian-6ubuntu2 debug2: fd 3 setting O_NONBLOCK debug1: SSH2_MSG_KEXINIT sent debug1: SSH2_MSG_KEXINIT received debug2: kex_parse_kexinit: diffie-hellman-group-exchange-sha256,diffie-hellman-group-exchange-sha1,diffie-hellman-group14-sha1,diffie-hellman-group1-sha1 debug2: kex_parse_kexinit: ssh-rsa,ssh-dss debug2: kex_parse_kexinit: aes128-cbc,3des-cbc,blowfish-cbc,cast128-cbc,arcfour128,arcfour256,arcfour,aes192-cbc,aes256-cbc,[email protected],aes128-ctr,aes192-ctr,aes256-ctr debug2: kex_parse_kexinit: aes128-cbc,3des-cbc,blowfish-cbc,cast128-cbc,arcfour128,arcfour256,arcfour,aes192-cbc,aes256-cbc,[email protected],aes128-ctr,aes192-ctr,aes256-ctr debug2: kex_parse_kexinit: hmac-md5,hmac-sha1,[email protected],hmac-ripemd160,[email protected],hmac-sha1-96,hmac-md5-96 debug2: kex_parse_kexinit: hmac-md5,hmac-sha1,[email protected],hmac-ripemd160,[email protected],hmac-sha1-96,hmac-md5-96 debug2: kex_parse_kexinit: none,[email protected],zlib debug2: kex_parse_kexinit: none,[email protected],zlib debug2: kex_parse_kexinit: debug2: kex_parse_kexinit: debug2: kex_parse_kexinit: first_kex_follows 0 debug2: kex_parse_kexinit: reserved 0 debug2: kex_parse_kexinit: diffie-hellman-group-exchange-sha256,diffie-hellman-group-exchange-sha1,diffie-hellman-group14-sha1,diffie-hellman-group1-sha1 debug2: kex_parse_kexinit: ssh-rsa,ssh-dss debug2: kex_parse_kexinit: aes128-cbc,3des-cbc,blowfish-cbc,cast128-cbc,arcfour128,arcfour256,arcfour,aes192-cbc,aes256-cbc,[email protected],aes128-ctr,aes192-ctr,aes256-ctr debug2: kex_parse_kexinit: aes128-cbc,3des-cbc,blowfish-cbc,cast128-cbc,arcfour128,arcfour256,arcfour,aes192-cbc,aes256-cbc,[email protected],aes128-ctr,aes192-ctr,aes256-ctr debug2: kex_parse_kexinit: hmac-md5,hmac-sha1,[email protected],hmac-ripemd160,[email protected],hmac-sha1-96,hmac-md5-96 debug2: kex_parse_kexinit: hmac-md5,hmac-sha1,[email protected],hmac-ripemd160,[email protected],hmac-sha1-96,hmac-md5-96 debug2: kex_parse_kexinit: none,[email protected] debug2: kex_parse_kexinit: none,[email protected] debug2: kex_parse_kexinit: debug2: kex_parse_kexinit: debug2: kex_parse_kexinit: first_kex_follows 0 debug2: kex_parse_kexinit: reserved 0 debug2: mac_setup: found hmac-md5 debug1: kex: server->client aes128-cbc hmac-md5 none debug2: mac_setup: found hmac-md5 debug1: kex: client->server aes128-cbc hmac-md5 none debug1: SSH2_MSG_KEX_DH_GEX_REQUEST(1024<1024<8192) sent debug1: expecting SSH2_MSG_KEX_DH_GEX_GROUP debug2: dh_gen_key: priv key bits set: 128/256 debug2: bits set: 511/1024 debug1: SSH2_MSG_KEX_DH_GEX_INIT sent debug1: expecting SSH2_MSG_KEX_DH_GEX_REPLY debug3: check_host_in_hostfile: filename /home/hadoop/.ssh/known_hosts debug3: check_host_in_hostfile: match line 20 debug1: Host '192.168.1.63' is known and matches the RSA host key. debug1: Found key in /home/hadoop/.ssh/known_hosts:20 debug2: bits set: 511/1024 debug1: ssh_rsa_verify: signature correct debug2: kex_derive_keys debug2: set_newkeys: mode 1 debug1: SSH2_MSG_NEWKEYS sent debug1: expecting SSH2_MSG_NEWKEYS debug2: set_newkeys: mode 0 debug1: SSH2_MSG_NEWKEYS received debug1: SSH2_MSG_SERVICE_REQUEST sent debug2: service_accept: ssh-userauth debug1: SSH2_MSG_SERVICE_ACCEPT received debug2: key: /home/hadoop/.ssh/id_rsa (0x241c110) debug1: Authentications that can continue: publickey,password debug3: start over, passed a different list publickey,password debug3: preferred gssapi-keyex,gssapi-with-mic,gssapi,publickey,keyboard-interactive debug3: authmethod_lookup publickey debug3: remaining preferred: keyboard-interactive debug3: authmethod_is_enabled publickey debug1: Next authentication method: publickey debug1: Offering public key: /home/hadoop/.ssh/id_rsa debug3: send_pubkey_test debug2: we sent a publickey packet, wait for reply debug1: Authentications that can continue: publickey,password debug2: we did not send a packet, disable method debug1: No more authentication methods to try. Permission denied (publickey,password). What seems to be the problem?? I have tried everything, this is driving me nuts.

  Read the article

• Python urllib.urlopen IOError

  - by Michael

  So I have the following lines of code in a function sock = urllib.urlopen(url) html = sock.read() sock.close() and they work fine when I call the function by hand. However, when I call the function in a loop (using the same urls as earlier) I get the following error: > Traceback (most recent call last): File "./headlines.py", line 256, in <module> main(argv[1:]) File "./headlines.py", line 37, in main write_articles(headline, output_folder + "articles_" + term +"/") File "./headlines.py", line 232, in write_articles print get_blogs(headline, 5) File "/Users/michaelnussbaum08/Documents/College/Sophmore_Year/Quarter_2/Innovation/Headlines/_code/get_content.py", line 41, in get_blogs sock = urllib.urlopen(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 87, in urlopen return opener.open(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 203, in open return getattr(self, name)(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 314, in open_http if not host: raise IOError, ('http error', 'no host given') IOError: [Errno http error] no host given Any ideas?

  Read the article

• Continuing permissions issues - ASP.net, IIS 7, Server 2008 - 0x80070005 (http 500.19) error

  - by Re-Pieper

  I created an ASP.net MVC developed web application and I am trying to set up IIS. The Error: Http error 500.19, error code 0x80070005, Cannot read configuration file due to insufficient permissions, config file: C:\inetpub\wwwroot\BudgetManagerMain\BudgetManager\web.config If I set the AppPool to use 'administrator' i have no problems and can access the site just fine. If i set to NETWORK SERVICE (or anything else including self-created admin or non-admin user accounts), i get the above error. Things I have tried: identity for Application pool named 'test' is 'NetworkService' Set full access privs for wwwroot and all children files/folders verified effective permissions and NETWORK SERVICE has full access. Authentication on my site is set for anonymous and running under Application Pool Identity I do not have any physical path credentials set on the website confirmed website is set to run under the application pool named 'test' using Process Monitor, here is a summary of what i found on the ACCESS DENIED event EVENT TAB: Class: File System Operation: CreateFile Result: Access Denied Path: ..\web.config Desired Access: Generic Read Disposition: Open Options: Sybnchronous IO Non-Alert, Non-Directory file Attributes: N ShareMode: Read AllocaitonSize: n/a PROCESS TAB ...lots of stuff that seems irrelevant User: NT AUTHORITY\NETWORK SERVICE

  Read the article

• Forcing the from address when postfix relays over smtp

  - by John Whitlock

  I'm trying to get email reports from our AWS EC2 instances. We're using Exchange Online (part of Microsoft Online Services). I've setup a user account specifically for SMTP relaying, and I've setup Postfix to meet all the requirements to relay messages through this server. However, Exchange Online's SMTP server will reject messages unless the From address exactly matches the authentication address (the error message is 550 5.7.1 Client does not have permissions to send as this sender). With careful configuration, I can setup my services to send as this user. But I'm not a huge fan of being careful - I'd rather have postfix force the issue. Is there a way to do this?

  Read the article

• which ASP.NET hosting site allows listening on different ports than 80 and uses .NET 4?

  - by ijjo

  I'm trying to take advantage of HTML 5 web sockets in .NET and the easiest way appears to be something like what this guy does. I've already tested this myself and it works great, but there are a few problems if I try to deploy this to my hosting site (discountasp.net). Basically, I am not allowed to open up a port on 8080 and listen on it. I then tried to figure out a way to listen on port 80 with IIS as well, but using the HTTPListener, I run into sercurity issues as well. This doesn't seem like it will help since I can't mess with this stuff on the hosting site server either. So to make my life easier, I think I need to find a hosting site that simply allows me to open up a socket on port 8080 and listen on it. Anyone know of one? Or does anyone know of a workaround (besides sniffing all the traffic on port 80)?

  Read the article

< Previous Page | 454 455 456 457 458 459 460 461 462 463 464 465  | Next Page >