Search Results

Search found 24018 results on 961 pages for 'platform specific'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 458/961 | < Previous Page | 454 455 456 457 458 459 460 461 462 463 464 465  | Next Page >

  • Specifying Language for a grammar

    - by darkie15
    Hi All, Is there any specific methodology followed to specify a language for given grammar ?? i.e. Is it necessary to run all the production rules given in a grammar to determine the language it represents? I don't have an example as such since the one I am working on is a homework question. Regards, darkie15

    Read the article

  • IE6 and IE7 Input padding CSS

    - by Podlsk
    I have input boxes with a height of 25 pixels. In Firefox, Safari and IE8 automatically vertically align the text of it in the middle correctly. However in IE6 and IE7 the text is aligned to the top. How may I resolve this? Adding padding-top increased the total height of the input as I have explicitly declared its height. I don't wish to use browser specific CSS. Thanks.

    Read the article

  • JMS Topic message size

    - by jjoshi
    Our application uses a topic to push message to a small set of subscribers. what sort of things should i look for when modeling a jms message with respect to the size of the actual message to be pushed. Are there any known limits or is application server specific? Any best practices or suggestions on this topic (pun unintended)?

    Read the article

  • Android Screen Density Compatibility on 1.5

    - by fordays
    Hi, I'm getting ready to release my first application the marketplace. It's being written for devices running Android 1.5 and above, however there aren't any specific folders for the three different screen densities (I think those came around in 1.6). Should I make these folders myself? Where should I put image resources for the different densities and what should I put in my Manifest??

    Read the article

  • Running Maven Goals in CLI.

    - by Jeeyoung Kim
    Hello, I have a maven pom.xml file with multiple instances of a same goal defined (inside with different s). I'm wondering how I can run a specific goal via maven command line. I've tried mvn --help, but I couldn't find an entry regarding this.

    Read the article

  • How to programmatically cut/copy/get files to/from Windows clipboard in a systam standard compliand

    - by Ivan
    How to put a cut/copy reference to specific files and/or folders into Windows clipboard so that when I open standard Windows Explorer window, go to somewhere and press Ctrl+V - the files are pasted? If I copy or cut some files/folders in Windows Explorer, how do I get this info (full names and whether they were cut or copied) in my Program? I program in C#4, but other languages ways are also interesting to know.

    Read the article

  • django deployment apache

    - by Uszy Wieloryba
    I would like to create a python script, which will: Create a django project in the current directory. Fix settings.py, urls.py. Do syncdb Install new apache instance listening on specific port (command line argument), with WSGI configured to serve my project. I can't figure out how to do point 3. EDIT: Peter Rowell: I need the solution for both Linux and Windows I have root access This is a dedicated host Apache only

    Read the article

  • adjustment of footer in website

    - by Mayur
    Hi All, I m web designer and getting problem in adjustment of footer. I need footer should be fixed at specific height and it will get down if content incresed otherwise it will be at same position please help me .... Thanks Mayur

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Associate an Activity with an item in XML ListViews in Android

    - by John
    I have a ListView that is populated using an XML file. However, I want each item, when clicked, to start a new Activity related to that item. I understand how to use OnItemClick to start a Toast that shows the selected item's text. However, since the ListView is populated from an XML there is not a specific Id for each item in the list. So, how would I associate an Activity with each item in the ListView when the items do not have Ids?

    Read the article

  • How to process audio in real time?

    - by user1756648
    I am giving some audio input through microphone. I recorded it in Audacity, it looks something like as shown below. I want to process this audio in real time. I mainly want to do this. 1) see real time audio amplitude vs time graph 2) perform some actions based on some thing (like if a specific type of hike is seen in audio, then do something, else do something else) Is there any python module or C library that can allow me to do this ?

    Read the article

  • Can this django query be improved?

    - by Hobhouse
    Given a model structure like this: class Book(models.Model): user = models.ForeignKey(User) class Readingdate(models.Model): book = models.ForeignKey(Book) date = models.DateField() One book may have several readingdates. How do I list books having at least one readingdate within a specific year? I can do this: from_date = datetime.date(2010,1,1) to_date = datetime.date(2010,12,31) book_ids = Readingdate.objects\ .filter(date__range=(from_date,to_date))\ .values_list('book_id', flat=True) books_read_2010 = Book.objects.filter(id__in=book_ids) Is it possible to do this with one queryset, or is this the best way?

    Read the article

  • Deploying patches and new versions.

    - by 0plus1
    I'm deveoping a big project, I have the dev folder (connected to a specific subdomain) then the "real" folder, the live one. When I'm ready to push patches or whole new versions I'm currently copying the files individually, is there a program that can help me do this task? Keep in mind that some files (the config one and the htacess) must never change in the live version. Thank you

    Read the article

  • Colud not open connection to the host error in telnet

    - by hima
    I am using telnet tk2smtp.msn.com 25 command from the command prompt to connect to the specific port on tk2smtp but its showing Could not open connection to the host error in command prompt. I installed Telnet Client in my machine . Let me know if there are any other things to be configured for this

    Read the article

  • Jetspeed 2.2 Nest or render one portlet inside another

    - by David Just
    I have a requirement to build an extensible wizard in a portlet. This wizard will list components that are installed and forward the user to a sub-wizard that is component specific. The requirement is that the components are to be developed by other people and dynamically plugged into this wizard (Jetspeed reboot is okay). I would like to be able to define the components as portlets themselves who's content is rendered into the primary portlet. Has anybody ever done something like this?

    Read the article

  • Formatting numbers with significant figures in C#

    - by Chris Farmer
    I have some decimal data that I am pushing into a SharePoint list where it is to be viewed. I'd like to restrict the number of significant figures displayed in the result data based on my knowledge of the specific calculation. Sometimes it'll be 3, so 12345 will become 12300 and 0.012345 will become 0.0123. Occasionally it will be 4 or 5. Is there any convenient way to handle this?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 454 455 456 457 458 459 460 461 462 463 464 465  | Next Page >