Search Results

Search found 7801 results on 313 pages for 'lazy loading'.

Page 46/313 | < Previous Page | 42 43 44 45 46 47 48 49 50 51 52 53  | Next Page >

  • loading mp3 from file using random access to flash.media.Sound

    - by Irfan Mulic
    We are migrating application from Delphi to Flex (Air) that plays mp3 files from random access big file. it has positions and sizes to extract mp3 data to FileStream-MemoryStream and then we use bass.dll to play it from memory stream. Now I have to play those same mp3's in flex but I am not sure how... I was reading something similar for reading/writing data using ByteArray from here but how to apply it to flash.media.Sound ? http://livedocs.adobe.com/flex/3/html/help.html?content=ByteArrays_2.html Any help?

    Read the article

  • Iframe vs dynamically loading web user controls

    - by kevin
    I need some advice on techniques to perform page redirect in asp.net. Which one is more recommended to use in asp.net? Dynamically changed the src of the Iframe to difference aspx. Dim frame As HtmlControl = CType(Me.FindControl("frameMain"), HtmlControl) frame.Attributes("src") = "page1.aspx" Dynamically load web user controls to an asp:panel. panelMain.Controls.Clear() panelMain.Controls.Add(LoadControl("WebControl/page1.ascx")) (convert all aspx page to web user controls)

    Read the article

  • SSRS: Report loading external images, image not found, can I hide the image control

    - by Nauman
    My SSRS report loads logo images for each customer from a customer number specific folder on the report server. I write an expression, to form my URL to the image based on th customer number. ..."http://localhost/images/" + iCustomerNumber.ToString() + "/logo.gif" I am able to get this working, but the problem I face is, when a particular customer doesn't has an image, then my report shows a red X mark in place of the logo. In this case, I expect to hide the image control itself. Any thoughts???? The other dirty solution will be to ensure that each customer specific folder has the designated image! even if there is no logo for a customer, I'll place a blank.gif or a spacer.gif of probably a square pixel in dimension!.

    Read the article

  • loading xml into SQL Server 2008 using sqlbulkload component

    - by mohamed
    "Error: Schema: relationship expected on 'headerRecord'." I get the above error while load xml file to SQL Server 2008 using SQLXMLBulkLoad4 Component , the xml file contains Call Detail records, I have generated schema file from xml file using both , Dataset and XSD.exe tool, but the error remains same., if there is another way to imports xml file with multiple tables that have relationship in each file into SQL Server 2008? . Here the xml file: <CallEventDataFile> <headerRecord> <productionDateTime>0912021247482B0300</productionDateTime> <recordingEntity>00</recordingEntity> <extensions/> </headerRecord> <callEventRecords> <mtSMSRecord> <recordType>7</recordType> <serviceCentre>91521230</serviceCentre> <servedIMSI>36570000031728F2</servedIMSI> <servedIMEI>53886000707896F0</servedIMEI> <servedMSISDN>915212454503F2</servedMSISDN> <msClassmark>3319A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C6E</cellIdentifier> </location> <deliveryTime>0912021535412B0300</deliveryTime> <systemType> <gERAN/> </systemType> <basicService> <teleservice>21</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <calledParty/> </chargedParty> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C6E</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <origination>8191F2</origination> <callReference>1605EB2FE1</callReference> </mtSMSRecord> <moSMSRecord> <recordType>6</recordType> <servedIMSI>36570000238707F9</servedIMSI> <servedIMEI>53928320195925F0</servedIMEI> <servedMSISDN>915212159430F2</servedMSISDN> <msClassmark>3319A2</msClassmark> <serviceCentre>91521230</serviceCentre> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>001B</locationAreaCode> <cellIdentifier>6983</cellIdentifier> </location> <messageReference>01</messageReference> <originationTime>0912021535412B0300</originationTime> <destinationNumber>8111F1</destinationNumber> <systemType> <gERAN/> </systemType> <basicService> <teleservice>22</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <chargedParty> <callingParty/> </chargedParty> <orgRNCorBSCId>8F1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705001B6983</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <smsUserDataType>FF</smsUserDataType> <callReference>1701BED4FF</callReference> </moSMSRecord> <ssActionRecord> <recordType>10</recordType> <servedIMSI>36570000636448F8</servedIMSI> <servedIMEI>53246030714961F0</servedIMEI> <servedMSISDN>915212056928F8</servedMSISDN> <msClassmark>3018A1</msClassmark> <recordingEntity>915212110100</recordingEntity> <location> <locationAreaCode>000C</locationAreaCode> <cellIdentifier>05A5</cellIdentifier> </location> <supplService>FF</supplService> <ssAction> <ussdInvocation/> </ssAction> <ssActionTime>0912021535412B0300</ssActionTime> <ssParameters> <unstructuredData>AA5C2E3702</unstructuredData> </ssParameters> <callReference>1701BED500</callReference> <systemType> <gERAN/> </systemType> <ussdCodingScheme>0F</ussdCodingScheme> <ussdString> <UssdString>AA5C2E3702</UssdString> </ussdString> <ussdRequestCounter>1</ussdRequestCounter> <additionalChgInfo> <chargeIndicator>1</chargeIndicator> </additionalChgInfo> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F705000C05A5</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> </ssActionRecord> <moCallRecord> <recordType>0</recordType> <servedIMSI>36570000807501F5</servedIMSI> <servedIMEI>53246030713955F0</servedIMEI> <servedMSISDN>915212157901F0</servedMSISDN> <callingNumber>A151911700</callingNumber> <calledNumber>8151677589</calledNumber> <roamingNumber>A111113850</roamingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2F</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <msClassmark>3319A1</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED501</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <gsm-SCFAddress>915212110130</gsm-SCFAddress> <serviceKey>1</serviceKey> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <numberOfDPEncountered>3</numberOfDPEncountered> <levelOfCAMELService>01</levelOfCAMELService> <freeFormatData>800130</freeFormatData> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <callingParty/> </chargedParty> <mscOutgoingCircuit>1051</mscOutgoingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <calledIMSI>36570000635618F8</calledIMSI> <globalAreaID>36F70500060C2F</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </moCallRecord> <mtCallRecord> <recordType>1</recordType> <servedIMSI>36570000635618F8</servedIMSI> <servedIMEI>53464010474309F0</servedIMEI> <servedMSISDN>915212755697F8</servedMSISDN> <callingNumber>A151911700</callingNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>HWBSC2</rOUTEName> </mscOutgoingROUTE> <location> <locationAreaCode>0006</locationAreaCode> <cellIdentifier>0C2D</cellIdentifier> </location> <basicService> <teleservice>11</teleservice> </basicService> <supplServicesUsed> <SuppServiceUsedid> <ssCode>11</ssCode> <ssTime>0912021535382B0300</ssTime> </SuppServiceUsedid> </supplServicesUsed> <msClassmark>331981</msClassmark> <answerTime>0912021535382B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>4</callDuration> <radioChanRequested> <dualFullRatePreferred/> </radioChanRequested> <radioChanUsed> <halfRate/> </radioChanUsed> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>1701BED502</callReference> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <networkCallReference>171D555132</networkCallReference> <mSCAddress>915212110100</mSCAddress> <speechVersionSupported>25</speechVersionSupported> <speechVersionUsed>21</speechVersionUsed> <systemType> <gERAN/> </systemType> <classmark3>C000</classmark3> <chargedParty> <calledParty/> </chargedParty> <roamingNumber>A111113850</roamingNumber> <mscIncomingCircuit>9119</mscIncomingCircuit> <orgRNCorBSCId>8E1A</orgRNCorBSCId> <orgMSCId>921A</orgMSCId> <globalAreaID>36F70500060C2D</globalAreaID> <subscriberCategory>0A</subscriberCategory> <firstmccmnc>36F705</firstmccmnc> <lastmccmnc>36F705</lastmccmnc> </mtCallRecord> <incGatewayRecord> <recordType>3</recordType> <callingNumber>A17005991565</callingNumber> <calledNumber>A1853643F7</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZTEBSC3</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535302B0300</answerTime> <releaseTime>0912021535422B0300</releaseTime> <callDuration>12</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2203AFBF84</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <roamingNumber>A111111980</roamingNumber> <mscIncomingCircuit>934</mscIncomingCircuit> <orgMSCId>921A</orgMSCId> <mscIncomingRouteAttribute> <isup/> </mscIncomingRouteAttribute> <networkCallReference>22432B5132</networkCallReference> </incGatewayRecord> <outGatewayRecord> <recordType>4</recordType> <callingNumber>A151012431</callingNumber> <calledNumber>817026936873</calledNumber> <recordingEntity>915212110100</recordingEntity> <mscIncomingROUTE> <rOUTEName>HWBSC</rOUTEName> </mscIncomingROUTE> <mscOutgoingROUTE> <rOUTEName>ZPSTN</rOUTEName> </mscOutgoingROUTE> <answerTime>0912021535192B0300</answerTime> <releaseTime>0912021535432B0300</releaseTime> <callDuration>24</callDuration> <causeForTerm>0</causeForTerm> <diagnostics> <gsm0408Cause>144</gsm0408Cause> </diagnostics> <callReference>2303B19880</callReference> <basicService> <teleservice>11</teleservice> </basicService> <additionalChgInfo> <chargeIndicator>2</chargeIndicator> </additionalChgInfo> <mscOutgoingCircuit>398</mscOutgoingCircuit> <orgMSCId>921A</orgMSCId> <mscOutgoingRouteAttribute> <isup/> </mscOutgoingRouteAttribute> <networkCallReference>238BE55132</networkCallReference> </outGatewayRecord> </callEventRecords> <trailerRecord> <productionDateTime>0912021247512B0300</productionDateTime> <recordingEntity>00</recordingEntity> <firstCallDateTime>000000000000000000</firstCallDateTime> <lastCallDateTime>000000000000000000</lastCallDateTime> <noOfRecords>521</noOfRecords> <extensions/> </trailerRecord> <extensions/> </CallEventDataFile> Schema File generated by Dataset: <?xml version="1.0" standalone="yes"?> <xs:schema id="NewDataSet" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="location"> <xs:complexType> <xs:sequence> <xs:element name="locationAreaCode" type="xs:string" minOccurs="0" /> <xs:element name="cellIdentifier" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="systemType"> <xs:complexType> <xs:sequence> <xs:element name="gERAN" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="basicService"> <xs:complexType> <xs:sequence> <xs:element name="teleservice" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="additionalChgInfo"> <xs:complexType> <xs:sequence> <xs:element name="chargeIndicator" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="chargedParty"> <xs:complexType> <xs:sequence> <xs:element name="calledParty" type="xs:string" minOccurs="0" /> <xs:element name="callingParty" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscIncomingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mscOutgoingROUTE"> <xs:complexType> <xs:sequence> <xs:element name="rOUTEName" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanRequested"> <xs:complexType> <xs:sequence> <xs:element name="dualFullRatePreferred" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="radioChanUsed"> <xs:complexType> <xs:sequence> <xs:element name="halfRate" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="diagnostics"> <xs:complexType> <xs:sequence> <xs:element name="gsm0408Cause" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="CallEventDataFile"> <xs:complexType> <xs:sequence> <xs:element name="extensions" type="xs:string" minOccurs="0" /> <xs:element name="headerRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="productionDateTime" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="extensions" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="callEventRecords" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="mtSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="deliveryTime" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="origination" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moSMSRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="serviceCentre" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="messageReference" type="xs:string" minOccurs="0" /> <xs:element name="originationTime" type="xs:string" minOccurs="0" /> <xs:element name="destinationNumber" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="smsUserDataType" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssActionRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="supplService" type="xs:string" minOccurs="0" /> <xs:element name="ssActionTime" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="ussdCodingScheme" type="xs:string" minOccurs="0" /> <xs:element name="ussdRequestCounter" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ssAction" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ussdInvocation" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="ssParameters" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="unstructuredData" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="ussdString" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="UssdString" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="moCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="calledNumber" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="gsm-SCFAddress" type="xs:string" minOccurs="0" /> <xs:element name="serviceKey" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="numberOfDPEncountered" type="xs:string" minOccurs="0" /> <xs:element name="levelOfCAMELService" type="xs:string" minOccurs="0" /> <xs:element name="freeFormatData" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="mscOutgoingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="calledIMSI" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanRequested" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="radioChanUsed" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="diagnostics" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="additionalChgInfo" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="systemType" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="chargedParty" minOccurs="0" maxOccurs="unbounded" /> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="mtCallRecord" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="recordType" type="xs:string" minOccurs="0" /> <xs:element name="servedIMSI" type="xs:string" minOccurs="0" /> <xs:element name="servedIMEI" type="xs:string" minOccurs="0" /> <xs:element name="servedMSISDN" type="xs:string" minOccurs="0" /> <xs:element name="callingNumber" type="xs:string" minOccurs="0" /> <xs:element name="recordingEntity" type="xs:string" minOccurs="0" /> <xs:element name="msClassmark" type="xs:string" minOccurs="0" /> <xs:element name="answerTime" type="xs:string" minOccurs="0" /> <xs:element name="releaseTime" type="xs:string" minOccurs="0" /> <xs:element name="callDuration" type="xs:string" minOccurs="0" /> <xs:element name="causeForTerm" type="xs:string" minOccurs="0" /> <xs:element name="callReference" type="xs:string" minOccurs="0" /> <xs:element name="networkCallReference" type="xs:string" minOccurs="0" /> <xs:element name="mSCAddress" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionSupported" type="xs:string" minOccurs="0" /> <xs:element name="speechVersionUsed" type="xs:string" minOccurs="0" /> <xs:element name="classmark3" type="xs:string" minOccurs="0" /> <xs:element name="roamingNumber" type="xs:string" minOccurs="0" /> <xs:element name="mscIncomingCircuit" type="xs:string" minOccurs="0" /> <xs:element name="orgRNCorBSCId" type="xs:string" minOccurs="0" /> <xs:element name="orgMSCId" type="xs:string" minOccurs="0" /> <xs:element name="globalAreaID" type="xs:string" minOccurs="0" /> <xs:element name="subscriberCategory" type="xs:string" minOccurs="0" /> <xs:element name="firstmccmnc" type="xs:string" minOccurs="0" /> <xs:element name="lastmccmnc" type="xs:string" minOccurs="0" /> <xs:element ref="mscIncomingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="mscOutgoingROUTE" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="location" minOccurs="0" maxOccurs="unbounded" /> <xs:element ref="basicService" minOccurs="0" maxOccurs="unbounded" /> <xs:element name="supplServicesUsed" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="SuppServiceUsedid" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="ssCode" type="xs:string" minOccurs="0" /> <xs:element name="ssTime" type="xs:string" minOccurs="0" /> </xs:sequence>

    Read the article

  • Loading machinecode from file into memory and executing in C -- mprotect failing

    - by chartreusekitsune
    Hi I'm trying to load raw machine code into memory and run it from within a C program, right now when the program executes it breaks when trying to run mprotect on the memory to make it executable. I'm also not entirely sure that if the memory does get set right it will execute. What I currently have is the following: #include <memory.h> #include <sys/mman.h> #include <stdio.h> int main ( int argc, char **argv ) { FILE *fp; int sz = 0; char *membuf; int output = 0; fp = fopen(argv[1],"rb"); if(fp == NULL) { printf("Failed to open file, aborting!\n"); exit(1); } fseek(fp, 0L, SEEK_END); sz = ftell(fp); fseek(fp, 0L, SEEK_SET); membuf = (char *)malloc(sz*sizeof(char)); if(membuf == NULL) { printf("Failed to allocate memory, aborting!\n"); exit(1); } memset(membuf, 0x90, sz*sizeof(char)); if( mprotect(membuf, sz*sizeof(char), PROT_EXEC | PROT_READ | PROT_WRITE) == -1) { printf("mprotect failed!!! aborting!\n"); exit(1); } if((sz*sizeof(char)) != fread(membuf, sz*sizeof(char), 1, fp)) { printf("Read failed, aborting!\n"); exit(1); } __asm__ ( "call %%eax;" : "=a" (output) : "a" (membuf) ); printf("Output = %x\n", output); return 0; }

    Read the article

  • loading data from file into 2d array

    - by Chris
    I am just starting with perl and would like some help with arrays please. I am reading lines from a data file and splitting the line into fields: open (INFILE, $infile); do { my $linedata = <INFILE>; my @data= split ',',$linedata; .... } until eof; I then want to store the individual field values (in @data) in and array so that the array looks like the input data file ie, the first "row" of the array contains the first line of data from INFILE etc. Each line of data from the infile contains 4 values, x,y,z and w and once the data are all in the array, I have to pass the array into another program which reads the x,y,z,w and displays the w value on a screen at the point determined by the x,y,z value. I can not pas the data to the other program on a row-by-row basis as the program expects the data to in a 2d matrtix format. Any help greatly appreciated. Chris

    Read the article

  • loading child swf as3

    - by RichW
    Hi, I've been given an fla to make some changes too. Basically its a fairly long timeline animation with sound. So far I've successfully added a few button functions for sound etc.. but one has got me stumped. One of the buttons needs to load a child swf. I'm using the code below but I'm recieving an error - 'Error #1009: Cannot access a property or method of a null object reference'. I believe this may be refferring to an object that isn't set yet but I have no idea which one it is: Code: var mcExt:MovieClip = new MovieClip(); var ldr:Loader = new Loader(); ldr.contentLoaderInfo.addEventListener(Event.COMPLETE, swfLoaded); ldr.load(new URLRequest("Downloads.swf")); function swfLoaded(e:Event):void { mcExt = MovieClip(ldr.contentLoaderInfo.content); ldr.contentLoaderInfo.removeEventListener(Event.COMPLETE, swfLoaded); mcExt.x = 50; mcExt.y = 50; addChild(mcExt); } Any help on what is going wrong would be greatly appreciated! Thanks

    Read the article

  • Java WebApp: Loading resource from .jar located in WEB-INF

    - by shaman.sir
    There are a lot of similar questions, but, probably, mine is a little bit different: What is the right way to load resource from inside of .jar file located in WEB-INF/lib folder (if I know the jar file name and the name of the class it resource belongs to), while Web Application is running? Should I use getServletContext().getResourceAsStream(?) for this purpose or the <name-of-known-class>.getResourseAsStream(?), and what path do I need to specify there? So, the structure is: /WEB-INF /classes /some/package/name ?.class #some Java code or Servlet that tries to read 'required-file.xml' /lib /<jar-with-known-name>.jar /another/package/with/known/name SomeKnownClass.class required-file.xml

    Read the article

  • Error loading my managedObjectModel

    - by niklassaers
    Hi guys, When I call [myAppDelegate managedObjectModel], in the retain line below, my application will crash (iPhone SDK v3.1.3): - (NSManagedObjectModel *)managedObjectModel { if (managedObjectModel != nil) { return managedObjectModel; } managedObjectModel = [[NSManagedObjectModel mergedModelFromBundles:nil] retain]; return managedObjectModel; } Here is my crash trace #0 0x905c44e6 in objc_exception_throw #1 0x01e78c3b in +[NSException raise:format:arguments:] #2 0x01e78b9a in +[NSException raise:format:] #3 0x000af99b in _NSArrayRaiseInsertNilException #4 0x0001c360 in -[NSCFArray insertObject:atIndex:] #5 0x0001c274 in -[NSCFArray addObject:] #6 0x01c16a7e in +[NSManagedObjectModel mergedModelFromBundles:] #7 0x00002432 in -[myAppDelegate managedObjectModel] at myAppDelegate.m:102 What is going on here? This is template code that I haven't seen fail before. Cheers Nik

    Read the article

  • Loading a Reusable UITableViewCell from a Nib

    - by Greg Martin
    I am able to design custom UITableViewCells and load them just fine using the technique described in the thread found at http://forums.macrumors.com/showthread.php?t=545061. However, using that method no longer allows you to init the cell with a reuseIdentifier which means you have to create whole new instances of each cell at every call. Has anyone figured out a good way to still cache particular cell types for reuses, but still be able to design them in Interface Builder?

    Read the article

  • Ajax Content Loading(Processing) image or indicator

    - by Arny
    Hi there, in part of my web page, I have couple of asp:image Thumbnails, onclick I use ajax modal popup extender to show the imgae in full size which are working fine, what I need to add is to have a processing image or indicator both in thumbnail and modal popup extender, I also have ajax autocomplete that is working fine, I need to add some indicator or processing image to it as soon as user start typing a word. any idea? Thanks in advance

    Read the article

  • Menu item for each module, with module content loading dynamically with Prism or MEF

    - by user573145
    I am developing an application currently using Prism and MEF. I would ideally like to generate a toolbar or menu with an item for each module, and when an item is clicked, only the views declared within that module load into a tab control. For example: Menu Region: ModuleA(Selected) | ModuleB Tab Region: ModuleAViewA | ModuleAViewB | ModuleAViewC Changes to Menu Region: Employees | Inventory(selected) Tab Region: Items | In Fi

    Read the article

  • Loading Accessory callout view for mkannotationview

    - by Zap
    I have a map annotation view that contains a rightcallout button which loads an accessory view which is a UIViewController class. I am using resuable annotations, but am wondering how I can pass updated information to my UIViewController class. Let's say I have 2 string values which map to 2 UILabels on my view. How can I update those values after the initial accessory view has already been loaded into memory as a resusable view? Any help would be appreciated.

    Read the article

  • Apache not loading Xdebug, but does when started from the Command Line

    - by JamesD
    I know that this sounds odd, but believe me, it's what is happening. Here are my system settings: Windows7 Apache 2.2 PHP 5.2.12 Xdebug 2.0.5 I have XDebug configured in my PHP.ini file. When I run php -m, I do in fact see that Xdebug is loaded. Now, if I start Apache AS A SERVICE (or by the Apache Monitor), and run phpinfo(), it is NOT showing Xdebug as being loaded. However, (now here's the crazy part), if I go to my Apache bin directory, and simply run httpd.exe, and then go and look at phpinfo(), Xdebug now shows as being loaded! Also, comparing some phpinfo() when started via service or by command line, it looks like the php.ini file is the same for either case. Everything looks the same except for the Xdebug being loaded part. Please, if you have any ideas it would be greatly appreciated.

    Read the article

  • Django template not loading properly

    - by fmsf
    Hey, When this one runs everything goes fine: (r"^newobject$", "views.myobjects.newobject"), All the CSS + JS files are properly fetched from: static/css/... static/js/... When this one runs: (r"^mybjects/(([a-z]|[A-Z]|[0-9])+)$","views.myobjects.loadobject"), All the css and JS files that are being fetched, are run trough the urlpatterns and are returning my defailt page: (r"", 'views.main.index'), This makes all my CSS and JS code to actualy be HTML. My guess is that i'm giving some noob mistake. Is there any common reason why this should happen? And how to fix it?

    Read the article

  • jQuery - Loading content into div, styles not applied?

    - by Kenny Bones
    Hi! I'm trying to get this content loader to work and I've managed to get it to get new content, once the content is loaded it isn't styled correctly. Also the character "é" becomes a questionmark. Doctype problem? As well as the h2 tag normally having Cufon applied to it is not triggering. So basically, this content loader require me to have a bunch of pages being essentially the same, except for the content I want to retreice. This way, users can use the actual URL as you'd normally exect. Only when a link is clicked on an already loaded page, it's only the content from the #content div that's realle being replaced. I can post code here, but I think it's better to just watch it happen on the testpage. It's very low on graphics btw ;) http://www.matkalenderen.no Just click the blue text link and you'll see it. Also, the red button on the second loaded content is supposed to revert the content back to previous. But it's not being triggered or something. What's happening?

    Read the article

  • Stop an anchor from loading on javascript confirm

    - by Joseph Carrington
    I was under the impression that this was formed correctly, but here it is forwarding to the anchor href (clicking through? what should I call this?) whether or not the user selects cancel or okay. <script type="text/javascript"> function myconfirm(my_string) { var agree = confirm('Are you sure you want to remove ' + my_string + '?'); if(agree) { return true; } else { return false; } } </script> and the anchor <a href="example.com/?remove=yes" onclick="myconfirm('my_string')">My String</a>

    Read the article

  • Trouble with loading jquery onload.

    - by Darcy
    Hi guys, I'm trying to build some jquery tabs based on the request (which is stored in a table). I have two pages sharing one .js file. One page is for the user to create the request, and the other is for the administrator to approve/deny the request. On the admin page, here is my javascript code: $(function() { GetRequest(); }); Which is just calling a function I have inside my .js file. All the code in the .js file is also wrapped in a '$(function(){ //...code here })'. The problem is the function isn't built yet when calling it from the page. Is there a way I can tell the page to wait until the script is complete?

    Read the article

  • How to send web browser a loading page, then some time later a results page

    - by Kurt W. Leucht
    I've wasted at least a half day of my company's time searching the Internet for an answer and I'm getting wrapped around the axle here. I can't figure out the difference between all the different technology choices (long polling, ajax streaming, comet, XMPP, etc.) and I can't get a simple hello world example working on my PC. I am running Apache 2.2 and ActivePerl 5.10.0. JavaScript is completely acceptable for this solution. All I want to do is write a simple Perl CGI script that when accessed, it immediately returns some HTML that tells the user to wait or maybe sends an animated GIF. Then without any user intervention (no mouse clicks or anything) I want the CGI script to at some time later replace the wait message or the animated GIF with the actual results from their query. I know this is simple stuff and websites do it all the time using JavaScript, but I can't find a single working example that I can cut and paste onto my machine that will work in Perl. Here is my simple Hello World example that I've compiled from various Internet sources, but it doesn't seem to work. When I refresh this Perl CGI script in my web browser it prints nothing for 5 seconds, then it prints the PLEASE BE PATIENT web page, but not the results web page. So the Ajax XMLHttpRequest stuff obviously isn't working right. What am I doing wrong? #!C:\Perl\bin\perl.exe use CGI; use CGI::Carp qw/fatalsToBrowser warningsToBrowser/; sub Create_HTML { my $html = <<EOHTML; <html> <head> <meta http-equiv="pragma" content="no-cache" /> <meta http-equiv="expires" content="-1" /> <script type="text/javascript" > var xmlhttp=false; /*@cc_on @*/ /*@if (@_jscript_version >= 5) // JScript gives us Conditional compilation, we can cope with old IE versions. // and security blocked creation of the objects. try { xmlhttp = new ActiveXObject("Msxml2.XMLHTTP"); } catch (e) { try { xmlhttp = new ActiveXObject("Microsoft.XMLHTTP"); } catch (E) { xmlhttp = false; } } @end @*/ if (!xmlhttp && typeof XMLHttpRequest!='undefined') { try { xmlhttp = new XMLHttpRequest(); } catch (e) { xmlhttp=false; } } if (!xmlhttp && window.createRequest) { try { xmlhttp = window.createRequest(); } catch (e) { xmlhttp=false; } } </script> <title>Ajax Streaming Connection Demo</title> </head> <body> Some header text. <p> <div id="response">PLEASE BE PATIENT</div> <p> Some footer text. </body> </html> EOHTML return $html; } my $cgi = new CGI; print $cgi->header; print Create_HTML(); sleep(5); print "<script type=\"text/javascript\">\n"; print "\$('response').innerHTML = 'Here are your results!';\n"; print "</script>\n";

    Read the article

  • Problem while loading the application on iPAD?

    - by chaitanya
    Hi, I developed a simple application for iPAD. I want to test the app how it works on the device. I have paid developer licence, and i have added the device id and created the app id and i have downloaded the provisioning profile using both. The same way how we will build the app for iphone i have done for ipad. i have sent the provisioning profile and .ipa file to my friend to load on to the ipad device(same device which i have added in the developer.apple.com). when he tried to drag n drop the provisioning file on to the device from iTunes it is giving below error. "abc.mobileprovision" was not copied on to the iPAD, because it cannot be palyed on this iPAD I am not able to understand what the exact error is. Can anyone please let me know how to dump the applicatio on to the ipad device?

    Read the article

  • htaccess rewrite rule not loading site content

    - by peter
    I am struggling with .htaccess rewrite rules. Let's say I have this URL. localhost/site/index.php and I want to rewrite it as this URL localhost/site/tutorial I would use this RewriteRule Options +FollowSymLinks RewriteEngine on RewriteRule ^tutorial/(.*)$ /up/index.php The page works, but the CSS files don't load. Also, if I have a URL like this: index.php?page=home Then I would have to parse through that URL to get 'home' not using $_GET anymore correct??

    Read the article

  • loading multiple line query in one row

    - by bharath
    Hi, How to load a multiple line query in one row using mysql.The data is stored in a text file. For example: "GGAGTTGTGGGAGTGGAGGAGGAAGAGGCGGTGGGGAGTACGGGGGCTGGTCCCAGAAGATGGCGGAGGC GGGGGATTTCTGGTAGGTCCTACTTTAGGACAAGATGTGGTGGTACTGTTGAAGCGTCAGTCTTTGATTC" Thanks in advance.

    Read the article

  • Dynamic adding of usercontrols not showing control on page

    - by Phil
    I am trying to insert a user control dynamically into my default.aspx page via the following method in the page_init: Dim control As UserControl = LoadControl("~\Modules\Content.ascx") Controls.Add(control) When I run the page there is no sign of the usercontrol. Am I using the correct code to insert the usercontrol? Is there an alternative method of insertion available? Does the fact that the usercontrol has a page_load make a difference? Do I need to register the control in my aspx page at design time? Thanks in advance for any assistance you can offer.

    Read the article

< Previous Page | 42 43 44 45 46 47 48 49 50 51 52 53  | Next Page >