Search Results

Search found 12376 results on 496 pages for 'side effects'.

Page 466/496 | < Previous Page | 462 463 464 465 466 467 468 469 470 471 472 473  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • css coding on Myspace - Problem

    - by Frederik Wessberg
    Hey Folks. I've read what I could, and I'm certainly no master, but I'm fixing up a colleagues profile on myspace.com, and im working with 2 divs in each side of the screen, and I want them to align so that they are next to each other. I've tried float: left; and float: right;, and I've tried margin: right; on div 1 and such. Could you help? Here's the site: http://www.myspace.com/jonasjohansen This is info for div1: <div class="textBox" align="left" style="width: 290px; word-wrap:break-word"> <span class="orangetext15"> BANDS </span> <b>MOVE</b><br /> Fredrik ....balbalbalbla </div> <style> .textBox { position: relative; left:-320px; top:0px; width: 290px; height: 350px; overflow-y: visible; overflow-x: visible; top: YYYpx; z-index: 3; background-color: transparent; border:none; } </style> This is info for div2: <style>.i {display:none;}{!-eliminate bio header!-}table table td.text table td.text {display:none;}{!-recover in shows and friends-!}table table td.text div table td.text,table table td.text table.friendSpace td.text {display:inline;}{! move up our custom section. You may change px value !}div.myDivR {position:relative; top:0px; margin-bottom:-300px; }{! you can apply style to the custom div !}div.myDivR {background-color:white; border:2px solid; border-color:darkgreen; float: right;}</style></td></tr></table></td></tr></table><span class="off">Re-Open Bio Table give it our own Class </span><table class="myBio" style="width:435px;"><tr><i class="i"></i><td class="myBioHead" valign="center" align="left" width="auto" bgcolor="ffcc99" height="17"> &nbsp;&nbsp;<span class="orangetext15"> ABOUT JONAS JOHANSEN</span> </td></tr><tr><td><table class="myBioI"><tr><td><span class="off"></span> blalbalbalbalbla <span class="off">END Bio Content </span>

    Read the article

  • How to implement a caching model without violating MVC pattern?

    - by RPM1984
    Hi Guys, I have an ASP.NET MVC 3 (Razor) Web Application, with a particular page which is highly database intensive, and user experience is of the upmost priority. Thus, i am introducing caching on this particular page. I'm trying to figure out a way to implement this caching pattern whilst keeping my controller thin, like it currently is without caching: public PartialViewResult GetLocationStuff(SearchPreferences searchPreferences) { var results = _locationService.FindStuffByCriteria(searchPreferences); return PartialView("SearchResults", results); } As you can see, the controller is very thin, as it should be. It doesn't care about how/where it is getting it's info from - that is the job of the service. A couple of notes on the flow of control: Controllers get DI'ed a particular Service, depending on it's area. In this example, this controller get's a LocationService Services call through to an IQueryable<T> Repository and materialize results into T or ICollection<T>. How i want to implement caching: I can't use Output Caching - for a few reasons. First of all, this action method is invoked from the client-side (jQuery/AJAX), via [HttpPost], which according to HTTP standards should not be cached as a request. Secondly, i don't want to cache purely based on the HTTP request arguments - the cache logic is a lot more complicated than that - there is actually two-level caching going on. As i hint to above, i need to use regular data-caching, e.g Cache["somekey"] = someObj;. I don't want to implement a generic caching mechanism where all calls via the service go through the cache first - i only want caching on this particular action method. First thought's would tell me to create another service (which inherits LocationService), and provide the caching workflow there (check cache first, if not there call db, add to cache, return result). That has two problems: The services are basic Class Libraries - no references to anything extra. I would need to add a reference to System.Web here. I would have to access the HTTP Context outside of the web application, which is considered bad practice, not only for testability, but in general - right? I also thought about using the Models folder in the Web Application (which i currently use only for ViewModels), but having a cache service in a models folder just doesn't sound right. So - any ideas? Is there a MVC-specific thing (like Action Filter's, for example) i can use here? General advice/tips would be greatly appreciated.

    Read the article

  • compressed archive with quick access to individual file

    - by eric.frederich
    I need to come up with a file format for new application I am writing. This file will need to hold a bunch other text files which are mostly text but can be other formats as well. Naturally, a compressed tar file seems to fit the bill. The problem is that I want to be able to retrieve some data from the file very quickly and getting just a particular file from a tar.gz file seems to take longer than it should. I am assumeing that this is because it has to decompress the entire file even though I just want one. When I have just a regular uncompressed tar file I can get that data real quick. Lets say the file I need quickly is called data.dat For example the command... tar -x data.dat -zf myfile.tar.gz ... is what takes a lot longer than I'd like. MP3 files have id3 data and jpeg files have exif data that can be read in quickly without opening the entire file. I would like my data.dat file to be available in a similar way. I was thinking that I could leave it uncompressed and seperate from the rest of the files in myfile.tar.gz I could then create a tar file of data.dat and myfile.tar.gz and then hopefully that data would be able to be retrieved faster because it is at the head of outer tar file and is uncompressed. Does this sound right?... putting a compressed tar inside of a tar file? Basically, my need is to have an archive type of file with quick access to one particular file. Tar does this just fine, but I'd also like to have that data compressed and as soon as I do that, I no longer have quick access. Are there other archive formats that will give me that quick access I need? As a side note, this application will be written in Python. If the solution calls for a re-invention of the wheel with my own binary format I am familiar with C and would have no problem writing the Python module in C. Idealy I'd just use tar, dd, cat, gzip, etc though. Thanks, ~Eric

    Read the article

  • Template function as a template argument

    - by Kos
    I've just got confused how to implement something in a generic way in C++. It's a bit convoluted, so let me explain step by step. Consider such code: void a(int) { // do something } void b(int) { // something else } void function1() { a(123); a(456); } void function2() { b(123); b(456); } void test() { function1(); function2(); } It's easily noticable that function1 and function2 do the same, with the only different part being the internal function. Therefore, I want to make function generic to avoid code redundancy. I can do it using function pointers or templates. Let me choose the latter for now. My thinking is that it's better since the compiler will surely be able to inline the functions - am I correct? Can compilers still inline the calls if they are made via function pointers? This is a side-question. OK, back to the original point... A solution with templates: void a(int) { // do something } void b(int) { // something else } template<void (*param)(int) > void function() { param(123); param(456); } void test() { function<a>(); function<b>(); } All OK. But I'm running into a problem: Can I still do that if a and b are generics themselves? template<typename T> void a(T t) { // do something } template<typename T> void b(T t) { // something else } template< ...param... > // ??? void function() { param<SomeType>(someobj); param<AnotherType>(someotherobj); } void test() { function<a>(); function<b>(); } I know that a template parameter can be one of: a type, a template type, a value of a type. None of those seems to cover my situation. My main question is hence: How do I solve that, i.e. define function() in the last example? (Yes, function pointers seem to be a workaround in this exact case - provided they can also be inlined - but I'm looking for a general solution for this class of problems).

    Read the article

  • boost.asio error on read from socket.

    - by niXman
    The following code of the client: typedef boost::array<char, 10> header_packet; header_packet header; boost::system::error_code error; ... /** send header */ boost::asio::write( _socket, boost::asio::buffer(header, header.size()), boost::asio::transfer_all(), error ); /** send body */ boost::asio::write( _socket, boost::asio::buffer(buffer, buffer.length()), boost::asio::transfer_all(), error ); of the server: struct header { boost::uint32_t header_length; boost::uint32_t id; boost::uint32_t body_length; }; static header unpack_header(const header_packet& data) { header hdr; sscanf(data.data(), "%02d%04d%04d", &hdr.header_length, &hdr.id, &hdr.body_length); return hdr; } void connection::start() { boost::asio::async_read( _socket, boost::asio::buffer(_header, _header.size()), boost::bind( &connection::read_header_handler, shared_from_this(), boost::asio::placeholders::error ) ); } /***************************************************************************/ void connection::read_header_handler(const boost::system::error_code& e) { if ( !e ) { std::cout << "readed header: " << _header.c_array() << std::endl; std::cout << constants::unpack_header(_header); boost::asio::async_read( _socket, boost::asio::buffer(_body, constants::unpack_header(_header).body_length), boost::bind( &connection::read_body_handler, shared_from_this(), boost::asio::placeholders::error ) ); } else { /** report error */ std::cout << "read header finished with error: " << e.message() << std::endl; } } /***************************************************************************/ void connection::read_body_handler(const boost::system::error_code& e) { if ( !e ) { std::cout << "readed body: " << _body.c_array() << std::endl; start(); } else { /** report error */ std::cout << "read body finished with error: " << e.message() << std::endl; } } On the server side the method read_header_handler() is called, but the method read_body_handler() is never called. Though the client has written down the data in a socket. The header is readed and decoded successfully. What's the error?

    Read the article

  • Getting rid of "static" references in C#

    - by DevEight
    Hello. I've recently begun learning C# but have encountered an annoying problem. Every variable I want available to all functions in my program I have to put a "static" in front of and also every function. What I'd like to know is how to avoid this, if possible? Also, small side question: creating public variables inside functions? This is what my program looks like right now, and I want to basically keep it like that, without having to add "static" everywhere: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Net; using System.Threading; using System.Net.Sockets; namespace NetworkExercise { class Client { public IPAddress addr; public int port; public string name; public Thread thread; public TcpClient tcp; public NetworkStream stream; public Client(IPAddress addr, int port, string name, NetworkStream stream) { } } class Program { //NETWORK TcpListener tcpListener; Thread listenThread; ASCIIEncoding encoder = new ASCIIEncoding(); //DATA byte[] buffer = new byte[4096]; string servIp; int servPort; //CLIENT MANAGEMENT int clientNum; static void Main(string[] args) { beginConnect(); } public void beginConnect() { Console.Write("Server IP (leave blank if you're the host): "); servIp = Console.ReadLine(); Console.Write("Port: "); servPort = Console.Read(); tcpListener = new TcpListener(IPAddress.Any, servPort); listenThread = new Thread(new ThreadStart(listenForClients)); listenThread.Start(); } public void listenForClients() { tcpListener.Start(); Console.WriteLine("Listening for clients..."); while (true) { Client cl = new Client(null, servPort, null, null); cl.tcp = tcpListener.AcceptTcpClient(); ThreadStart pts = delegate { handleClientCom(cl); }; cl.thread = new Thread(pts); cl.thread.Start(); } } public void handleClientCom(Client cl) { cl.stream = cl.tcp.GetStream(); } } }

    Read the article

  • jQuery UI dialog + WebKit + HTML response with script

    - by Anthony Koval'
    Once again I am faced with a great problem! :) So, here is the stuff: on the client side, I have a link. By clicking on it, jQuery makes a request to the server, gets response as HTML content, then popups UI dialog with that content. Here is the code of the request-function: function preview(){ $.ajax({ url: "/api/builder/", type: "post", //dataType: "html", data: {"script_tpl": $("#widget_code").text(), "widgets": $.toJSON(mwidgets), "widx": "0"}, success: function(data){ //console.log(data) $("#previewArea").dialog({ bgiframe: true, autoOpen: false, height: 600, width: 600, modal: true, buttons: { "Cancel": function() { $(this).dialog('destroy'); } } }); //console.log(data.toString()); $('#previewArea').attr("innerHTML", data.toString()); $("#previewArea").dialog("open"); }, error: function(){ console.log("shit happens"); } }) } The response (data) is: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript">var smakly_widget_sid = 0 ,widgets = [{"cols": "2","rows": "2","div_id": "smakly_widget","wid": "0","smakly_style": "small_image",}, ] </script> <script type="text/javascript" src="/media/js/smak/smakme.js"></script> </head> <body> preview <div id="smakly_widget" style="width:560px;height:550px"> </div> </body> </html> As you see, there is a script to load: smakme.js, somehow it doesn't execute in WebKit-based browsers (I tried in Safari and Chrome), but in Firefox, Internet Explorer and Opera it works as expected! Here is that script: String.prototype.format = function(){ var pattern = /\{\d+\}/g; var args = arguments; return this.replace(pattern, function(capture){ return args[capture.match(/\d+/)]; }); } var turl = "/widget" var widgetCtrl = new(function(){ this.render_widget = function (w, content){ $("#" + w.div_id).append(content); } this.build_widgets = function(){ for (var widx in widgets){ var w = widgets[widx], iurl = '{0}?sid={1}&wid={2}&w={3}&h={4}&referer=http://ya.ru&thrash={5}'.format( turl, smakly_widget_sid, w.wid, w.cols, w.rows, Math.floor(Math.random()*1000).toString()), content = $('<iframe src="{0}" width="100%" height="100%"></iframe>'.format(iurl)); this.render_widget(w, content); } } }) $(document).ready(function(){ widgetCtrl.build_widgets(); }) Is that some security issue, or anything else?

    Read the article

  • Strategies for "Always-Connected" Windows Client Data Architecture

    - by magz2010
    Hi. Let me start by saying: this is my 1st post here, this is a bit lenghty, and I havent done Windows Forms development in years....with that in mind please excuse me if this isn't directly a programming question and please bear with me as I really need the help!! I have been asked to develop a Windows Forms app for our company that talks to a central (local area network) Linux Server hosting a PostgreSQL database. The app is to allow users to authenticate themselves into the system and thereafter conduct the usual transactions with the PG database. Ordinarily, I would propose writing a webforms app against Mono, but the clients need to utilise local resources such as USB peripheral devices, so that is out of the question. While it might not seem clear, my questions are italised below: Dilemma #1: The application is meant to be always connected. How should I structure my DAL/BLL - Should this reside on the server or with the client? Dilemma #2: I have been reading up on Client Application Services (CAS), and it seems like a great fit for authentication, as everything is exposed via URIs. I know that a .NET Data Provider exists for PostgreSQL, but not too sure if CAS will all work on a Linux (Debian) server? Believe me, I would get my hands dirty and try myself, but I need to come up with a logical design first before resources are allocated to me for "trial purposes"! Dilemma #3: If the DAL/BLL is to reside on the server, is there any way I can create data services, and expose only these services to authenticated clients. There is a (security) requirement whereby a connection string with username and password to the database cannot be present on any client machines...even if security on the database side is quite rigid. I'm guessing that the only way for this to work would be to create the various CRUD data service methods that are exposed by an ASP.NET app, and have the WindowsForms make a request for data or persist data to the ASP.NET app (thru a URI) and have that return a resultset or value. Would I be correct in assuming this? Should I be looking into WCF Data Services? and will WCF work with a non-SQL Server database? Thank you for taking the time out to read this, but know that I am desperately seeking any advice on this! THANKS A MILLION!!!!

    Read the article

  • Maximum nametable char count exceeded

    - by doc
    I'm having issues with the maximum nametable char count quota, I followed a couple of answers here and it solved the problem for a while, but now I'm having the same issue. My Server side config is as follows: <system.serviceModel> <bindings> <netTcpBinding> <binding name="GenericBinding" maxBufferPoolSize="2147483647" maxBufferSize="2147483647" maxReceivedMessageSize="2147483647"> <readerQuotas maxDepth="2147483647" maxStringContentLength="2147483647" maxArrayLength="2147483647" maxBytesPerRead="2147483647" maxNameTableCharCount="2147483647" /> <security mode="None" /> </binding> </netTcpBinding> </bindings> <behaviors> <serviceBehaviors> <behavior> <serviceMetadata httpGetEnabled="false" /> <serviceDebug includeExceptionDetailInFaults="true" /> <dataContractSerializer maxItemsInObjectGraph="1000000" /> </behavior> </serviceBehaviors> </behaviors> <services> <service name="REMWCF.RemWCFSvc"> <endpoint address="" binding="netTcpBinding" contract="REMWCF.IRemWCFSvc" bindingConfiguration="GenericBinding" /> <endpoint address="mex" binding="mexTcpBinding" contract="IMetadataExchange" /> <host> <baseAddresses> <add baseAddress="net.tcp://localhost:9081/RemWCFSvc" /> </baseAddresses> </host> </service> </services> </system.serviceModel> I also have the same tcp binding on the devenv configuration. Have I reached the limit of contracts supported? Is there a way to turn off that quota? EDIT Error Message: Error: Cannot obtain Metadata from net.tcp://localhost:9081/RemWCFSvc/mex If this is a Windows (R) Communication Foundation service to which you have access, please check that you have enabled metadata publishing at the specified address. For help enabling metadata publishing, please refer to the MSDN documentation at http://go.microsoft.com/fwlink/?LinkId=65455.WS-Metadata Exchange Error URI: net.tcp://localhost:9081/RemWCFSvc/mex Metadata contains a reference that cannot be resolved: 'net.tcp://localhost:9081/RemWCFSvc/mex'. There is an error in the XML document. The maximum nametable character count quota (16384) has been exceeded while reading XML data. The nametable is a data structure used to store strings encountered during XML processing - long XML documents with non-repeating element names, attribute names and attribute values may trigger this quota. This quota may be increased by changing the MaxNameTableCharCount property on the XmlDictionaryReaderQuotas object used when creating the XML reader. I'm getting that error when trying to run the WCF (which is hosted in a windows service app).

    Read the article

  • Define Javascript slider hit/rollover area

    - by Rob
    Hey, Im having an issue defining the hit area for a javascript sliding element. See example: http://www.warface.co.uk/clients/warface.co.uk/ Please slide over the grey box on the right side to reveal the button, although this works I would only like for the slider to only be triggered by rolling over the red block. CSS .slidingtwitter { /* -- This is the hit area -- */ background: #ccc; width:255px; height:55px; overflow: hidden; top:50%; right: 0px; /* -- This is the sliding start point -- */ position: fixed; font-family: Gotham, Sans-Serif; z-index: 50; } .slidingtwitter.right { right:0px; } .slidingtwitter .caption { /* -- This is the sliding area -- */ background: #fff; position: absolute; width:260px; height:55px; right: -205px; /* -- This is the sliding start point -- */ } .slidingtwitter a { color: #484848; font-size: 20px; text-transform: uppercase; } .slidingtwitter a:hover { color: black; } .slidingtwitter .smaller { font-size: 12px; font-family: Gotham Medium; } .twitterblock { background: #f35555 url("styles/images/button_twitter.png") no-repeat 14px 15px ; width:35px; height:35px; padding:10px; float:left; display:block; } .slidingtwitter .followme { background: url("styles/images/button_arrowheadthin.jpg")no-repeat right 0; height:35px; display:block; float:left; line-height:14px; width:140px; margin:10px 0px 0px 14px; padding-top:6px; padding-right: 40px; } JS $('.slidingtwitter').hover(function(){ $(".slide", this).stop().animate({right:'0px'},{queue:false,duration:400}); //Position on rollover },function() { $(".slide", this).stop().animate({right:'-205px'},{queue:false,duration:400}); //Position on rollout }); Any suggestions would be much appreciated.

    Read the article

  • Resize AIR app window while dragging

    - by matt lohkamp
    So I've noticed Windows 7 has a disturbing tendency to prevent you from dragging the title bar of windows off the top of the screen. If you try - in this case, using an air app with a draggable area at the bottom of the window, allowing you to push the top of the window up past the screen - it just kicks the window back down far enough that the title bar is at the top of what it considers the 'visible area.' One solution would be to resize the app window as it moves, so that the title bar is always where windows wants it. How would you resize the window while you're dragging it, though? Would you do it like this? dragHitArea.addEventListener(MouseEvent.MOUSE_DOWN, function(e:MouseEvent):void{ stage.nativeWindow.height += 50; stage.nativeWindow.startMove(); stage.nativeWindow.height -= 50; }); see what's going on there? When I click, I'm doing startMove(), which is hooking into the OS' function for dragging a window around. I'm also increasing and decreasing the height of the window by 50 pixels - which should give me no net increase, right? Wrong - the first '.height +=' gets executed, but the '.height -=' after the .startMove() never runs. Why? update - If you're curious, I'm programming an air widget with fly-out menus which expand rightwards and upwards - and since those element can only be displayed within the boundaries of the application window itself (even though the window is set to be chromeless and transparent) I have to expand the application's borders to include the area that the menu 'pops up' into. In the extreme case, with the widget positioned bottom left, and the menus expanded completely across to the right side and top edge of the screen, the application area could very well cover the entire desktop. The problem is, when it's expanded like this, if the user drags it up and to the right, it causes the 'title bar' area of the application window to move above the top edge of the desktop area, where it would normally be unreachable; and Windows automatically re-positions the window back below that edge once the .startMove() operation is completed. So what I want to do is continually resize the height of the application so that the visual effect will be the same for the user, but for the benefit of the operating system the window's title bar will never be above that top boundary of the desktop area.

    Read the article

  • Abnormally disconnected TCP sockets and write timeout

    - by James
    Hello I will try to explain the problem in shortest possible words. I am using c++ builder 2010. I am using TIdTCPServer and sending voice packets to a list of connected clients. Everything works ok untill any client is disconnected abnormally, For example power failure etc. I can reproduce similar disconnect by cutting the ethernet connection of a connected client. So now we have a disconnected socket but as you know it is not yet detected at server side so server will continue to try to send data to that client too. But when server try to write data to that disconnected client ...... Write() or WriteLn() HANGS there in trying to write, It is like it is wating for somekind of Write timeout. This hangs the hole packet distribution process as a result creating a lag in data transmission to all other clients. After few seconds "Socket Connection Closed" Exception is raised and data flow continues. Here is the code try { EnterCriticalSection(&SlotListenersCriticalSection); for(int i=0;i<SlotListeners->Count;i++) { try { //Here the process will HANG for several seconds on a disconnected socket ((TIdContext*) SlotListeners->Objects[i])->Connection->IOHandler->WriteLn("Some DATA"); }catch(Exception &e) { SlotListeners->Delete(i); } } }__finally { LeaveCriticalSection(&SlotListenersCriticalSection); } Ok i already have a keep alive mechanism which disconnect the socket after n seconds of inactivity. But as you can imagine, still this mechnism cant sync exactly with this braodcasting loop because this braodcasting loop is running almost all the time. So is there any Write timeouts i can specify may be through iohandler or something ? I have seen many many threads about "Detecting disconnected tcp socket" but my problem is little different, i need to avoid that hangup for few seconds during the write attempt. So is there any solution ? Or should i consider using some different mechanism for such data broadcasting for example the broadcasting loop put the data packet in some kind of FIFO buffer and client threads continuously check for available data and pick and deliver it to themselves ? This way if one thread hangs it will not stop/delay the over all distribution thread. Any ideas please ? Thanks for your time and help. Regards Jams

    Read the article

  • Sessions not persisting between requests

    - by klonq
    My session objects are only stored within the request scope on google app engine and I can't figure out how to persist objects between requests. The docs are next to useless on this matter and I can't find anyone who's experienced a similar problem. Please help. When I store session objects in the servlet and forward the request to a JSP using: getServletContext().getRequestDispatcher("/example.jsp").forward(request,response); Everything works like it should. But when I store objects to the session and redirect the request using: response.sendRedirect("/example/url"); The session objects are lost to the ether. In fact when I dump session key/value pairs on new requests there is absolutely nothing, session objects only appear within the request scope of servlets which create session objects. It appears to me that the objects are not being written to Memcache or Datastore. In terms of configuring sessions for my application I have set <sessions-enabled>true</sessions-enabled> In appengine-web.xml. Is there anything else I am missing? The single paragraph of documentation on sessions also notes that only objects which implement Serializable can be stored in the session between requests. I have included an example of the code which is not working below. The obvious solution is to not use redirects, and this might be ok for the example given below but some application data does need to be stored in the session between requests so I need to find a solution to this problem. EXAMPLE: The class FlashMessage gives feedback to the user from server-side operations. if (email.send()) { FlashMessage flash = new FlashMessage(FlashMessage.SUCCESS, "Your message has been sent."); session.setAttribute(FlashMessage.SESSION_KEY, flash); // The flash message will not be available in the session object in the next request response.sendRedirect(URL.HOME); } else { FlashMessage flash = new FlashMessage(FlashMessage.ERROR, FlashMessage.INVALID_FORM_DATA); session.setAttribute(FlashMessage.SESSION_KEY, flash); // The flash message is displayed without problem getServletContext().getRequestDispatcher(Templates.CONTACT_FORM).forward(request,response); } FlashMessage.java import java.io.Serializable; public class FlashMessage implements Serializable { private static final long serialVersionUID = 8109520737272565760L; // I have tried using different, default and no serialVersionUID public static final String SESSION_KEY = "flashMessage"; public static final String ERROR = "error"; public static final String SUCCESS = "success"; public static final String INVALID_FORM_DATA = "Your request failed to validate."; private String message; private String type; public FlashMessage (String type, String message) { this.type = type; this.message = message; } public String display(){ return "<div id='flash' class='" + type + "'>" + message + "</div>"; } }

    Read the article

  • Publishing/subscribing multiple subsets of the same server collection

    - by matb33
    How does one go about publishing different subsets (or "views") of a single collection on the server as multiple collections on the client? Here is some pseudo-code to help illustrate my question: items collection on the server Assume that I have an items collection on the server with millions of records. Let's also assume that: 50 records have the enabled property set to true, and; 100 records have the processed property set to true. All others are set to false. items: { "_id": "uniqueid1", "title": "item #1", "enabled": false, "processed": false }, { "_id": "uniqueid2", "title": "item #2", "enabled": false, "processed": true }, ... { "_id": "uniqueid458734958", "title": "item #458734958", "enabled": true, "processed": true } Server code Let's publish two "views" of the same server collection. One will send down a cursor with 50 records, and the other will send down a cursor with 100 records. There are over 458 million records in this fictitious server-side database, and the client does not need to know about all of those (in fact, sending them all down would probably take several hours in this example): var Items = new Meteor.Collection("items"); Meteor.publish("enabled_items", function () { // Only 50 "Items" have enabled set to true return Items.find({enabled: true}); }); Meteor.publish("processed_items", function () { // Only 100 "Items" have processed set to true return Items.find({processed: true}); }); Client code In order to support the latency compensation technique, we are forced to declare a single collection Items on the client. It should become apparent where the flaw is: how does one differentiate between Items for enabled_items and Items for processed_items? var Items = new Meteor.Collection("items"); Meteor.subscribe("enabled_items", function () { // This will output 50, fine console.log(Items.find().count()); }); Meteor.subscribe("processed_items", function () { // This will also output 50, since we have no choice but to use // the same "Items" collection. console.log(Items.find().count()); }); My current solution involves monkey-patching _publishCursor to allow the subscription name to be used instead of the collection name. But that won't do any latency compensation. Every write has to round-trip to the server: // On the client: var EnabledItems = new Meteor.Collection("enabled_items"); var ProcessedItems = new Meteor.Collection("processed_items"); With the monkey-patch in place, this will work. But go into Offline mode and changes won't appear on the client right away -- we'll need to be connected to the server to see changes. What's the correct approach?

    Read the article

  • C++ DLL creation for C# project - No functions exported

    - by Yeti
    I am working on a project that requires some image processing. The front end of the program is C# (cause the guys thought it is a lot simpler to make the UI in it). However, as the image processing part needs a lot of CPU juice I am making this part in C++. The idea is to link it to the C# project and just call a function from a DLL to make the image processing part and allow to the C# environment to process the data afterwards. Now the only problem is that it seems I am not able to make the DLL. Simply put the compiler refuses to put any function into the DLL that I compile. Because the project requires some development time testing I have created two projects into a C++ solution. One is for the Dll and another console application. The console project holds all the files and I just include the corresponding header into my DLL project file. I thought the compiler should take out the functions that I marked as to be exported and make the DLL from them. Nevertheless this does not happens. Here it is how I defined the function in the header: extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck); extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI, CvScalar &refHSVColorLow, CvScalar &refHSVColorHi ); Followed by the implementation in the cpp file: extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI,&refHSVColorLow, CvScalar &refHSVColorHi ) { \\... return cvPoint((int)( M10/M00) + imgROI.x, (int)( M01/M00 ) + imgROI.y) ;} extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck) { \\ ...}; And my main file for the DLL project looks like: #ifdef _MANAGED #pragma managed(push, off) #endif /// <summary> Include files. </summary> #include "..\ImageProcessingDebug\ImageProcessingTest.h" #include "..\ImageProcessingDebug\ImageProcessing.h" BOOL APIENTRY DllMain( HMODULE hModule, DWORD ul_reason_for_call, LPVOID lpReserved) { return TRUE; } #ifdef _MANAGED #pragma managed(pop) #endif Needless to say it does not work. A quick look with DLL export viewer 1.36 reveals that no function is inside the library. I don't get it. What I am doing wrong ? As side not I am using the C++ objects (and here it is the C++ DLL part) such as the vector. However, only for internal usage. These will not appear in the headers of either function as you can observe from the previous code snippets. Any ideas? Thx, Bernat

    Read the article

  • xmlns='' was not expected when deserializing nested classes

    - by Mavrik
    I have a problem when attempting to serialize class on a server, send it to the client and deserialize is on the destination. On the server I have the following two classes: [XmlRoot("StatusUpdate")] public class GameStatusUpdate { public GameStatusUpdate() {} public GameStatusUpdate(Player[] players, Command command) { this.Players = players; this.Update = command; } [XmlArray("Players")] public Player[] Players { get; set; } [XmlElement("Command")] public Command Update { get; set; } } and [XmlRoot("Player")] public class Player { public Player() {} public Player(PlayerColors color) { Color = color; ... } [XmlAttribute("Color")] public PlayerColors Color { get; set; } [XmlAttribute("X")] public int X { get; set; } [XmlAttribute("Y")] public int Y { get; set; } } (The missing types are all enums). This generates the following XML on serialization: <?xml version="1.0" encoding="utf-16"?> <StatusUpdate> <Players> <Player Color="Cyan" X="67" Y="32" /> </Players> <Command>StartGame</Command> </StatusUpdate> On the client side, I'm attempting to deserialize that into following classes: [XmlRoot("StatusUpdate")] public class StatusUpdate { public StatusUpdate() { } [XmlArray("Players")] [XmlArrayItem("Player")] public PlayerInfo[] Players { get; set; } [XmlElement("Command")] public Command Update { get; set; } } and [XmlRoot("Player")] public class PlayerInfo { public PlayerInfo() { } [XmlAttribute("X")] public int X { get; set; } [XmlAttribute("Y")] public int Y { get; set; } [XmlAttribute("Color")] public PlayerColor Color { get; set; } } However, the deserializer throws an exception: There is an error in XML document (2, 2). <StatusUpdate xmlns=''> was not expected. What am I missing or doing wrong?

    Read the article

  • vc++ - static member is showing error

    - by prabhakaran
    I am using vc++(2010). I am trying to create a class for server side socket. Here is the header file #include<winsock.h> #include<string> #include<iostream> using namespace std; class AcceptSocket { // static SOCKET s; protected: SOCKET acceptSocket; public: AcceptSocket(){}; void setSocket(SOCKET socket); static void EstablishConnection(int portNo,string&); static void closeConnection(); static void StartAccepting(); virtual void threadDeal(); static DWORD WINAPI MyThreadFunction(LPVOID lpParam); }; SOCKET AcceptSocket::s; and the corresponding source file #include<NetWorking.h> #include<string> void AcceptSocket::setSocket(SOCKET s) { acceptSocket=s; } void AcceptSocket::EstablishConnection(int portno,string &failure) { WSAData w; int error = WSAStartup(0x0202,&w); if(error) failure=failure+"\nWSAStartupFailure"; if(w.wVersion != 0x0202) { WSACleanup(); failure=failure+"\nVersion is different"; } SOCKADDR_IN addr; addr.sin_family=AF_INET; addr.sin_port=htons(portno); addr.sin_addr.s_addr=htonl(INADDR_ANY); AcceptSocket::s=socket(AF_INET,SOCK_STREAM,IPPROTO_TCP); if(AcceptSocket::s == INVALID_SOCKET) failure=failure+"\nsocket creating error"; if(bind(AcceptSocket::s,(LPSOCKADDR) &addr,sizeof(addr)) == SOCKET_ERROR) failure=failure+"\nbinding error"; listen(AcceptSocket::s,SOMAXCONN); } void AcceptSocket::closeConnection() { if(AcceptSocket::s) closesocket(AcceptSocket::s); WSACleanup(); } void AcceptSocket::StartAccepting() { sockaddr_in addrNew; int size=sizeof(addrNew); while(1) { SOCKET temp=accept(AcceptSocket::s,(sockaddr *)&addrNew,&size); AcceptSocket * tempAcceptSocket=new AcceptSocket(); tempAcceptSocket->setSocket(temp); DWORD threadId; HANDLE thread=CreateThread(NULL,0,MyThreadFunction,(LPVOID)tempAcceptSocket,0,&threadId); } } DWORD WINAPI AcceptSocket::MyThreadFunction(LPVOID lpParam) { AcceptSocket * acceptsocket=(AcceptSocket *) lpParam; acceptsocket->threadDeal(); return 1; } void AcceptSocket::threadDeal() { "You didn't define threadDeal in the derived class"; } Now the main.cpp is #include<Networking.h> int main() { } When I am compiling The error I got is Error 1 error LNK2005: "private: static unsigned int AcceptSocket::s" (?s@AcceptSocket@@0IA) already defined in NetWorking.obj C:\Documents and Settings\prabhakaran\Desktop\check\check\main.obj check Error 2 error LNK1169: one or more multiply defined symbols found C:\Documents and Settings\prabhakaran\Desktop\check\Debug\check.exe 1 1 check Now anybody please enlighten me about this issue

    Read the article

  • Finding open contiguous blocks of time for every day of a month, fast

    - by Chris
    I am working on a booking availability system for a group of several venues, and am having a hard time generating the availability of time blocks for days in a given month. This is happening server-side in PHP, but the concept itself is language agnostic -- I could be doing this in JS or anything else. Given a venue_id, month, and year (6/2012 for example), I have a list of all events occurring in that range at that venue, represented as unix timestamps start and end. This data comes from the database. I need to establish what, if any, contiguous block of time of a minimum length (different per venue) exist on each day. For example, on 6/1 I have an event between 2:00pm and 7:00pm. The minimum time is 5 hours, so there's a block open there from 9am - 2pm and another between 7pm and 12pm. This would continue for the 2nd, 3rd, etc... every day of June. Some (most) of the days have nothing happening at all, some have 1 - 3 events. The solution I came up with works, but it also takes waaaay too long to generate the data. Basically, I loop every day of the month and create an array of timestamps for each 15 minutes of that day. Then, I loop the time spans of events from that day by 15 minutes, marking any "taken" timeslot as false. Remaining, I have an array that contains timestamp of free time vs. taken time: //one day's array after processing through loops (not real timestamps) array( 12345678=>12345678, // <--- avail 12345878=>12345878, 12346078=>12346078, 12346278=>false, // <--- not avail 12346478=>false, 12346678=>false, 12346878=>false, 12347078=>12347078, // <--- avail 12347278=>12347278 ) Now I would need to loop THIS array to find continuous time blocks, then check to see if they are long enough (each venue has a minimum), and if so then establish the descriptive text for their start and end (i.e. 9am - 2pm). WHEW! By the time all this looping is done, the user has grown bored and wandered off to Youtube to watch videos of puppies; it takes ages to so examine 30 or so days. Is there a faster way to solve this issue? To summarize the problem, given time ranges t1 and t2 on day d, how can I determine the remaining time left in d that is longer than the minimum time block m. This data is assembled on demand via AJAX as the user moves between calendar months. Results are cached per-page-load, so if the user goes to July a second time, the data that was generated the first time would be reused. Any other details that would help, let me know. Edit Per request, the database structure (or the part that is relevant here) *events* id (bigint) title (varchar) *event_times* id (bigint) event_id (bigint) venue_id (bigint) start (bigint) end (bigint) *venues* id (bigint) name (varchar) min_block (int) min_start (varchar) max_start (varchar)

    Read the article

  • Code Golf: Countdown Number Game

    - by Noldorin
    Challenge Here is the task, inspired by the well-known British TV game show Countdown. The challenge should be pretty clear even without any knowledge of the game, but feel free to ask for clarifications. And if you fancy seeing a clip of this game in action, check out this YouTube clip. It features the wonderful late Richard Whitely in 1997. You are given 6 numbers, chosen at random from the set {1, 2, 3, 4, 5, 6, 8, 9, 10, 25, 50, 75, 100}, and a random target number between 100 and 999. The aim is to make use the six given numbers and the four common arithmetic operations (addition, subtraction, multiplication, division; all over the rational numbers) to generate the target - or as close as possible either side. Each number may only be used once at most, while each arithmetic operator may be used any number of times (including zero.) Note that it does not matter how many numbers are used. Write a function that takes the target number and set of 6 numbers (can be represented as list/collection/array/sequence) and returns the solution in any standard numerical notation (e.g. infix, prefix, postfix). The function must always return the closest-possible result to the target, and must run in at most 1 minute on a standard PC. Note that in the case where more than one solution exists, any single solution is sufficient. Examples: {50, 100, 4, 2, 2, 4}, target 203 e.g. 100 * 2 + 2 + (4 / 4) e.g. (100 + 50) * 4 * 2 / (4 + 2) {25, 4, 9, 2, 3, 10}, target 465 e.g. (25 + 10 - 4) * (9 * 2 - 3) {9, 8, 10, 5, 9, 7), target 241 e.g. ((10 + 9) * 9 * 7) + 8) / 5 Rules Other than mentioned in the problem statement, there are no further restrictions. You may write the function in any standard language (standard I/O is not necessary). The aim as always is to solve the task with the smallest number of characters of code. Saying that, I may not simply accept the answer with the shortest code. I'll also be looking at elegance of the code and time complexity of the algorithm! My Solution I'm attempting an F# solution when I find the free time - will post it here when I have something! Format Please post all answers in the following format for the purpose of easy comparison: Language Number of characters: ??? Fully obfuscated function: (code here) Clear (ideally commented) function: (code here) Any notes on the algorithm/clever shortcuts it takes.

    Read the article

  • How do you select form elements in JQuery based upon an html table?

    - by Swoop
    I am working on some ASP.NET web forms which involves some dynamic generation, and I need to add some onClick helpers on the client side. I have a basic outline of something working, except for one huge problem. There are multiple HTML tables, each generated by a different ASP.NET web control. Each table can contain overlapping field names, which is causing a problem with my JQuery click event handlers. The click event handler is linking to unintended form fields in addition to the intended form field. I have provided a simplified sample version of the code below. This code is trying to set the value of textbox box1 when a particular radiobutton is selected in the table with id=thing1. Obviously, the jquery code will be triggered for the form fields in both tables. The tables are dynamically added to the webpage based upon different conditions. It is possible that no tables will be loaded, only 1 table, or both tables might load. In the future, other tables could be added. Each table comes from a different .net web control. Other than renaming the form fields to make sure they are unique across all user controls, is there a way to have JQuery act only on the intended form fields? In other words, could the table ID be incorporated into the JQuery code in a manner that does not become a nightmare to maintain later? <script> $(document).ready(function() { $("[id$=radio1_0]").click(function() { $("[id$=box1]").attr("value", ""); }); $("[id$=radio1_1]").click(function() { $("[id$=box1]").attr("value", "N/A"); }); </script> <table id="thing1"> <tr><td> <radiobuttonlist id="radio1"/> <listitem>yes</listitem> <listitem>no</listitem> </td></tr> <tr><td> <textbox id="box1"/> </td></tr> </table> <table id="thing2"> <tr><td> <radiobuttonlist id="radio1"/> <listitem>yes</listitem> <listitem>no</listitem> </td></tr> <tr><td> <textbox id="box1"/> </tr></td> </table>

    Read the article

  • Why can't I put a jquery-ui progressbar inside a div with fixed position?

    - by Matthew
    I started the source from this progressbar example, and it works fine. My only change was to set the width of the progressbar to "20%". <!DOCTYPE html> <html> <head> <link href="http://ajax.googleapis.com/ajax/libs/jqueryui/1.8/themes/base/jquery-ui.css" rel="stylesheet" type="text/css"/> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.4/jquery.min.js"></script> <script src="http://ajax.googleapis.com/ajax/libs/jqueryui/1.8/jquery-ui.min.js"></script> <script> $(document).ready(function() { $("#progressbar").progressbar({ value: 37 }).css({ width : "20%"}); }); </script> </head> <body style="font-size:62.5%;"> <div id="progressbar"></div> </body> </html> I then put the progressbar inside another div, and used css to fix that div in the upper-right-hand corner. <!DOCTYPE html> <html> <head> <link href="http://ajax.googleapis.com/ajax/libs/jqueryui/1.8/themes/base/jquery-ui.css" rel="stylesheet" type="text/css"/> <style type="text/css"> #testContainer { position : fixed; top : 6; right : 6; } </style> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.4/jquery.min.js"></script> <script src="http://ajax.googleapis.com/ajax/libs/jqueryui/1.8/jquery-ui.min.js"></script> <script> $(document).ready(function() { $("#progressbar").progressbar({ value: 37 }).css({ width : "20%"}); }); </script> </head> <body style="font-size:62.5%;"> <div id="testContainer"> <div id="progressbar"></div> </div> </body> </html> The progressbar becomes a slim vertical line on the left side of the screen. What am I doing wrong? I'm new to web development in general, and jquery in particular, so please forgive me if this is a stupid question.

    Read the article

  • Recommended ASP.NET Shared Hosting

    - by coffeeaddict
    Ok, I have to admit I'm getting fed up with www.discountasp.net's pricing model and this annoyance has built up over the past 8 years or so. I've been with them for years and absolutely love them on the technical side, however it's getting ridiculously expensive for so little that you get. I mean here's my scenario: 1) I am running 2 SQL Server databases which costs me $10/ea per month so that's $20/month for 2 and I only get 500 mb disk space which is horrible 2) I am paying $10/mo just for the hosting itself which I only get 1 gig of disk space! I mean common! 3) I am simply running 2 small apps (Screwturn Wiki & Subtext Blog)...so I don't really care if it's up 99% or not, it's not worth paying a total of $300 just to keep these 2 apps running over discountasp.net Anyone else feel the same? Yes, I know they have great support, probably have great servers running behind this but in the end I really don't care as long as my site is up 95% or better. Yes, the hosting toolset rocks. But you know I bet you I can find a similar set somewhere else. I like how I can totally control IIS 7 at discountasp and I can control my own app pool etc. That's very powerful and essential. But anyone have any good alternatives to discountasp that gives me close to the same at a much more reasonable cost point? I mean http://www.m6.net/prices.aspx gives you 10 SQL Databases for $7 and 200 gigs disk space! I don't know about their tools or support but just looking at those numbers and some other hosts I've seen, I feel that discountasp.net is way out of line. They don't even offer any purchasing discounts such as it would be nice if my 2nd SQL Server is only $5/month not $10...stuff like this, to make it much more realistic and fair. Opinions (people who do have discountasp.net, people who have left them, or people who have another host they like)??? But geez $300 just to host a couple DBs and lightweight open source apps? Not worth the price they are charging. I'm almost at a price point that enables me to get a decent dedicated server! I really don't care about beta support. Not a big deal to me.

    Read the article

  • Issues in Ajax based applications

    - by Sinuhe
    I'm very interested in developing Ajax based applications. This is, loading almost all of the content of the application via XMLHttpRequest, instead of only some combos and widgets. But if I try to do this form scratch, soon I find some problems without an easy solution. I wonder if there is some framework (both client and server side) to deal with this issues. As far as I know, there isn't (but I've searched mainly in Java world). So I am seriously thinking of doing my own framework, at least for my projects. Therefore, in this question I ask for several things. First, the possible problems of an ajax based development. Then, I'm looking for some framework or utility in order to deal with them. Finally, if there is no framework available, what features must it have. Here are the issues I thought: 1 - JavaScript must be enabled. Security paranoia isn't the only problem: a lot of mobile devices couldn't use the application, too. 2 - Sometimes you need to update more than one DIV (e.g. main content, menu and breadcrumbs). 3 - Unknown response type: when you make an Ajax call, you set the callback function too, usually specifying if expected response is a javascript object or in which DIV put the result. But this fails when you get another type of response: for example when the session has expired and the user must log in again. 4 - Browser's refresh, back and forward buttons can be a real pain. User will expect different behaviors depending on the situation. 5 - When search engines indexes a site, only follow links. Thus, content load by Ajax won't "exist" for who doesn't know about it yet. 6 - Users can ask for open a link in a different window/tab. 7 - Address bar doesn't show the "real" page you are in. So, you can't copy the location and send it to a friend or bookmark the page. 8 - If you want to monetize the site, you can put some advertisings. As you don't refresh entire page and you want to change the ad after some time, you have to refresh only the DIV where the ad is. But this can violate the Terms and Conditions of your ad service. In fact, it can go against AdSense TOS. 9 - When you refresh an entire page, all JavaScript gets "cleaned". But in Ajax calls, all JavaScript objects will remain. 10 - You can't easily change your CSS properties.

    Read the article

  • Best way to version control a WCF application with Git?

    - by Sam
    Suppose I have the following projects. The format is [ProjectName] : [ProjectDependency1, ProjectDependency2, etc.] // Service CoolLibrary WcfApp.Core WcfApp.Contracts WcfApp.Services : CoolLibrary, WcfApp.Core, WcfApp.Contracts // Clients CustomerX.App : WcfApp.Contracts CustomerY.App : WcfApp.Contracts CustomerZ.App : WcfApp.Contracts (On a side note, WcfApp.Contracts should not depend on WcfApp.Core, right? Else CustomerX.App would also depend on and thus be exposed to the service domain model?) (CoolLibrary is shared with other applications, so I can't just put it inside of WcfApp.Services.) All of this code is in-house. I was thinking of having 6 repositories for this. The format is [repository folder name] : [Projects included in repository.] 1. CoolLibrary.git : CoolLibrary 2. WcfApp.Contracts.git : WcfApp.Contracts 3. WcfApp.git : WcfApp.Core, WcfApp.Services 4. CustomerX.App.git : CustomerX.App 5. CustomerY.App.git : CustomerY.App 6. CustomerZ.App.git : CustomerZ.App How should I manage my project dependencies? I see three options: I could use binaries which I have to manually copy to each dependent repository. This would be easiest at the start, but my repositories would be a little bloated, and it'd become more tedious as I add more client apps for customers. I could import dependent code as submodules. This is what I will probably end up doing, although I keep reading on the web that submodules are a hassle. I also read that I can use something called the subtree merge strategy, but I am not sure how it is different from just cloning the repo into a subdirectory and adding the subdirectory to .gitignore. Is the difference that the subtree is recorded in the master repository, so (for example) cloning it from a different location will also pull the subtree? I know I asked a lot of questions in this post, but the most important two questions I have are: 1. Am I using the right number and layout of repositories? Should I use less or more? 2. Which of the three dependency management strategies would you recommend? Is there another strategy I haven't considered?

    Read the article

< Previous Page | 462 463 464 465 466 467 468 469 470 471 472 473  | Next Page >