Search Results

Search found 12588 results on 504 pages for 'memory allocation'.

Page 478/504 | < Previous Page | 474 475 476 477 478 479 480 481 482 483 484 485  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • BufferedReader no longer buffering after a while?

    - by BobTurbo
    Sorry I can't post code but I have a bufferedreader with 50000000 bytes set as the buffer size. It works as you would expect for half an hour, the HDD light flashing every two minutes or so, reading in the big chunk of data, and then going quiet again as the CPU processes it. But after about half an hour (this is a very big file), the HDD starts thrashing as if it is reading one byte at a time. It is still in the same loop and I think I checked free ram to rule out swapping (heap size is default). Probably won't get any helpful answers, but worth a try. OK I have changed heap size to 768mb and still nothing. There is plenty of free memory and java.exe is only using about 300mb. Now I have profiled it and heap stays at about 200MB, well below what is available. CPU stays at 50%. Yet the HDD starts thrashing like crazy. I have.. no idea. I am going to rewrite the whole thing in c#, that is my solution. Here is the code (it is just a throw-away script, not pretty): BufferedReader s = null; HashMap<String, Integer> allWords = new HashMap<String, Integer>(); HashSet<String> pageWords = new HashSet<String>(); long[] pageCount = new long[78592]; long pages = 0; Scanner wordFile = new Scanner(new BufferedReader(new FileReader("allWords.txt"))); while (wordFile.hasNext()) { allWords.put(wordFile.next(), Integer.parseInt(wordFile.next())); } s = new BufferedReader(new FileReader("wikipedia/enwiki-latest-pages-articles.xml"), 50000000); StringBuilder words = new StringBuilder(); String nextLine = null; while ((nextLine = s.readLine()) != null) { if (a.matcher(nextLine).matches()) { continue; } else if (b.matcher(nextLine).matches()) { continue; } else if (c.matcher(nextLine).matches()) { continue; } else if (d.matcher(nextLine).matches()) { nextLine = s.readLine(); if (e.matcher(nextLine).matches()) { if (f.matcher(s.readLine()).matches()) { pageWords.addAll(Arrays.asList(words.toString().toLowerCase().split("[^a-zA-Z]"))); words.setLength(0); pages++; for (String word : pageWords) { if (allWords.containsKey(word)) { pageCount[allWords.get(word)]++; } else if (!word.isEmpty() && allWords.containsKey(word.substring(0, word.length() - 1))) { pageCount[allWords.get(word.substring(0, word.length() - 1))]++; } } pageWords.clear(); } } } else if (g.matcher(nextLine).matches()) { continue; } words.append(nextLine); words.append(" "); }

    Read the article

  • Multi-tier applications using L2S, WCF and Base Class

    - by Gena Verdel
    Hi all. One day I decided to build this nice multi-tier application using L2S and WCF. The simplified model is : DataBase-L2S-Wrapper(DTO)-Client Application. The communication between Client and Database is achieved by using Data Transfer Objects which contain entity objects as their properties. abstract public class BaseObject { public virtual IccSystem.iccObjectTypes ObjectICC_Type { get { return IccSystem.iccObjectTypes.unknownType; } } [global::System.Data.Linq.Mapping.ColumnAttribute(Storage = "_ID", AutoSync = AutoSync.OnInsert, DbType = "BigInt NOT NULL IDENTITY", IsPrimaryKey = true, IsDbGenerated = true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order = 1)] public virtual long ID { //get; //set; get { return _ID; } set { _ID = value; } } } [DataContract] public class BaseObjectWrapper<T> where T : BaseObject { #region Fields private T _DBObject; #endregion #region Properties [DataMember] public T Entity { get { return _DBObject; } set { _DBObject = value; } } #endregion } Pretty simple, isn't it?. Here's the catch. Each one of the mapped classes contains ID property itself so I decided to override it like this [global::System.Data.Linq.Mapping.TableAttribute(Name="dbo.Divisions")] [global::System.Runtime.Serialization.DataContractAttribute()] public partial class Division : INotifyPropertyChanging, INotifyPropertyChanged { [global::System.Data.Linq.Mapping.ColumnAttribute(Storage="_ID", AutoSync=AutoSync.OnInsert, DbType="BigInt NOT NULL IDENTITY", IsPrimaryKey=true, IsDbGenerated=true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order=1)] public override long ID { get { return this._ID; } set { if ((this._ID != value)) { this.OnIDChanging(value); this.SendPropertyChanging(); this._ID = value; this.SendPropertyChanged("ID"); this.OnIDChanged(); } } } } Wrapper for division is pretty straightforward as well: public class DivisionWrapper : BaseObjectWrapper<Division> { } It worked pretty well as long as I kept ID values at mapped class and its BaseObject class the same(that's not very good approach, I know, but still) but then this happened: private CentralDC _dc; public bool UpdateDivision(ref DivisionWrapper division) { DivisionWrapper tempWrapper = division; if (division.Entity == null) { return false; } try { Table<Division> table = _dc.Divisions; var q = table.Where(o => o.ID == tempWrapper.Entity.ID); if (q.Count() == 0) { division.Entity._errorMessage = "Unable to locate entity with id " + division.Entity.ID.ToString(); return false; } var realEntity = q.First(); realEntity = division.Entity; _dc.SubmitChanges(); return true; } catch (Exception ex) { division.Entity._errorMessage = ex.Message; return false; } } When trying to enumerate over the in-memory query the following exception occurred: Class member BaseObject.ID is unmapped. Although I'm stating the type and overriding the ID property L2S fails to work. Any suggestions?

    Read the article

  • Getting instance crashes on IntelliJ IDEA with scala plugin.

    - by egervari
    I am building a scala web project using scala test, lift, jpa, hibernate, mercurial plugin, etc. I am getting instant crashes, where the ide just bombs, the window shuts down, and it gives no error messages whatsoever when I am doing any amount of copy/pasting of code. This started happening once my project got to about 100 unit tests. This problem is incredibly annoying, because when the crash happens, 30-60 seconds of activity is not saved. Even IDEA will forget which files were last opened and will forget where the cursor was, which makes it really hard to continue where you left off after the crash. A lot can happen in 60 seconds! Now, I've given up, because it seems like all sorts of things cause the IntelliJ IDEA to crash over and over. For example, if I were to copy and paste this code, to write a similar test for another collection type, it would crash shortly after: it should "cascade save and delete status messages" in { val statusMessage = new StatusMessage("message") var user = userDao.find(1).get user.addToStatusMessages(statusMessage) userDao.save(user) statusMessage.isPersistent should be (true) userDao.delete(user) statusMessageDao.find(statusMessage.id) should equal (None) } There is nothing special about this piece of code. It's code that is working just fine. However, IDEA bombs shortly after I paste something like this. For example, I might change StatusMessage to the new class I want to test cascading on... and then have to import that class into the test... and BOOM... it crashed. On windows 7, the IDEA window literally just minimizes and crashes with no warning. The next time I startup IDEA, it has no memory of what happened. Now, I've had this problem before. I posted it way back on IDEA's YouTrack. I was told to invalidate my caches. That never fixed it then, and it's not fixing it now. Please help. This error is fairly random, but it's happening constantly now. I could program for hours and not see it before... and the fact that my work just gets destroyed and I can't remember what I did during the last minute causes me to swear at my monitor at a db level higher than my stereo can go.

    Read the article

  • .NET Windows Service with timer stops responding

    - by Biri
    I have a windows service written in c#. It has a timer inside, which fires some functions on a regular basis. So the skeleton of my service: public partial class ArchiveService : ServiceBase { Timer tickTack; int interval = 10; ... protected override void OnStart(string[] args) { tickTack = new Timer(1000 * interval); tickTack.Elapsed += new ElapsedEventHandler(tickTack_Elapsed); tickTack.Start(); } protected override void OnStop() { tickTack.Stop(); } private void tickTack_Elapsed(object sender, ElapsedEventArgs e) { ... } } It works for some time (like 10-15 days) then it stops. I mean the service shows as running, but it does not do anything. I make some logging and the problem can be the timer, because after the interval it does not call the tickTack_Elapsed function. I was thinking about rewrite it without a timer, using an endless loop, which stops the processing for the amount of time I set up. This is also not an elegant solution and I think it can have some side effects regarding memory. The Timer is used from the System.Timers namespace, the environment is Windows 2003. I used this approach in two different services on different servers, but both is producing this behavior (this is why I thought that it is somehow connected to my code or the framework itself). Does somebody experienced this behavior? What can be wrong? Edit: I edited both services. One got a nice try-catch everywhere and more logging. The second got a timer-recreation on a regular basis. None of them stopped since them, so if this situation remains for another week, I will close this question. Thank you for everyone so far. Edit: I close this question because nothing happened. I mean I made some changes, but those changes are not really relevant in this matter and both services are running without any problem since then. Please mark it as "Closed for not relevant anymore".

    Read the article

  • writing XML with Xerces 3.0.1 and C++ on windows

    - by Jon
    Hi, i have the following function i wrote to create an XML file using Xerces 3.0.1, if i call this function with a filePath of "foo.xml" or "../foo.xml" it works great, but if i pass in "c:/foo.xml" then i get an exception on this line XMLFormatTarget *formatTarget = new LocalFileFormatTarget(targetPath); can someone explain why my code works for relative paths, but not absolute paths please? many thanks. const int ABSOLUTE_PATH_FILENAME_PREFIX_SIZE = 9; void OutputXML(xercesc::DOMDocument* pmyDOMDocument, std::string filePath) { //Return the first registered implementation that has the desired features. In this case, we are after a DOM implementation that has the LS feature... or Load/Save. DOMImplementation *implementation = DOMImplementationRegistry::getDOMImplementation(L"LS"); // Create a DOMLSSerializer which is used to serialize a DOM tree into an XML document. DOMLSSerializer *serializer = ((DOMImplementationLS*)implementation)->createLSSerializer(); // Make the output more human readable by inserting line feeds. if (serializer->getDomConfig()->canSetParameter(XMLUni::fgDOMWRTFormatPrettyPrint, true)) serializer->getDomConfig()->setParameter(XMLUni::fgDOMWRTFormatPrettyPrint, true); // The end-of-line sequence of characters to be used in the XML being written out. serializer->setNewLine(XMLString::transcode("\r\n")); // Convert the path into Xerces compatible XMLCh*. XMLCh *tempFilePath = XMLString::transcode(filePath.c_str()); // Calculate the length of the string. const int pathLen = XMLString::stringLen(tempFilePath); // Allocate memory for a Xerces string sufficent to hold the path. XMLCh *targetPath = (XMLCh*)XMLPlatformUtils::fgMemoryManager->allocate((pathLen + ABSOLUTE_PATH_FILENAME_PREFIX_SIZE) * sizeof(XMLCh)); // Fixes a platform dependent absolute path filename to standard URI form. XMLString::fixURI(tempFilePath, targetPath); // Specify the target for the XML output. XMLFormatTarget *formatTarget = new LocalFileFormatTarget(targetPath); //XMLFormatTarget *myFormTarget = new StdOutFormatTarget(); // Create a new empty output destination object. DOMLSOutput *output = ((DOMImplementationLS*)implementation)->createLSOutput(); // Set the stream to our target. output->setByteStream(formatTarget); // Write the serialized output to the destination. serializer->write(pmyDOMDocument, output); // Cleanup. serializer->release(); XMLString::release(&tempFilePath); delete formatTarget; output->release(); }

    Read the article

  • How do I create a thread-safe write-once read-many value in Java?

    - by Software Monkey
    This is a problem I encounter frequently in working with more complex systems and which I have never figured out a good way to solve. It usually involves variations on the theme of a shared object whose construction and initialization are necessarily two distinct steps. This is generally because of architectural requirements, similar to applets, so answers that suggest I consolidate construction and initialization are not useful. By way of example, let's say I have a class that is structured to fit into an application framework like so: public class MyClass { private /*ideally-final*/ SomeObject someObject; MyClass() { someObject=null; } public void startup() { someObject=new SomeObject(...arguments from environment which are not available until startup is called...); } public void shutdown() { someObject=null; // this is not necessary, I am just expressing the intended scope of someObject explicitly } } I can't make someObject final since it can't be set until startup() is invoked. But I would really like it to reflect it's write-once semantics and be able to directly access it from multiple threads, preferably avoiding synchronization. The idea being to express and enforce a degree of finalness, I conjecture that I could create a generic container, like so: public class WoRmObject<T> { private T object; WoRmObject() { object=null; } public WoRmObject set(T val) { object=val; return this; } public T get() { return object; } } and then in MyClass, above, do: private final WoRmObject<SomeObject> someObject; MyClass() { someObject=new WoRmObject<SomeObject>(); } public void startup() { someObject.set(SomeObject(...arguments from environment which are not available until startup is called...)); } Which raises some questions for me: Is there a better way, or existing Java object (would have to be available in Java 4)? Is this thread-safe provided that no other thread accesses someObject.get() until after it's set() has been called. The other threads will only invoke methods on MyClass between startup() and shutdown() - the framework guarantees this. Given the completely unsynchronized WoRmObject container, it is ever possible under either JMM to see a value of object which is neither null nor a reference to a SomeObject? In other words, does has the JMM always guaranteed that no thread can observe the memory of an object to be whatever values happened to be on the heap when the object was allocated.

    Read the article

  • WinForm-style Invoke() in unmanaged C++

    - by Matt Green
    I've been playing with a DataBus-type design for a hobby project, and I ran into an issue. Back-end components need to notify the UI that something has happened. My implementation of the bus delivers the messages synchronously with respect to the sender. In other words, when you call Send(), the method blocks until all the handlers have called. (This allows callers to use stack memory management for event objects.) However, consider the case where an event handler updates the GUI in response to an event. If the handler is called, and the message sender lives on another thread, then the handler cannot update the GUI due to Win32's GUI elements having thread affinity. More dynamic platforms such as .NET allow you to handle this by calling a special Invoke() method to move the method call (and the arguments) to the UI thread. I'm guessing they use the .NET parking window or the like for these sorts of things. A morbid curiosity was born: can we do this in C++, even if we limit the scope of the problem? Can we make it nicer than existing solutions? I know Qt does something similar with the moveToThread() function. By nicer, I'll mention that I'm specifically trying to avoid code of the following form: if(! this->IsUIThread()) { Invoke(MainWindowPresenter::OnTracksAdded, e); return; } being at the top of every UI method. This dance was common in WinForms when dealing with this issue. I think this sort of concern should be isolated from the domain-specific code and a wrapper object made to deal with it. My implementation consists of: DeferredFunction - functor that stores the target method in a FastDelegate, and deep copies the single event argument. This is the object that is sent across thread boundaries. UIEventHandler - responsible for dispatching a single event from the bus. When the Execute() method is called, it checks the thread ID. If it does not match the UI thread ID (set at construction time), a DeferredFunction is allocated on the heap with the instance, method, and event argument. A pointer to it is sent to the UI thread via PostThreadMessage(). Finally, a hook function for the thread's message pump is used to call the DeferredFunction and de-allocate it. Alternatively, I can use a message loop filter, since my UI framework (WTL) supports them. Ultimately, is this a good idea? The whole message hooking thing makes me leery. The intent is certainly noble, but are there are any pitfalls I should know about? Or is there an easier way to do this?

    Read the article

  • ANSI C as core of a C# project? Is this possible?

    - by Nektarios
    I'm writing a NON-GUI app which I want to be cross platform between OS X and Windows. I'm looking at the following architecture, but I don't know if it will work on the windows side: (Platform specific entry point) - ANSI C main loop = ANSI C model code doing data processing / logic = (Platform specific helpers) So the core stuff I'm planning to write in regular ANSI C, because A) it should be platform independent, B) I'm extremely comfortable with C, C) It can do the job and do it well (Platform specific entry point) can be written in whatever necessary to get the job done, this is a small amount of code, doesn't matter to me. (Platform specific helpers) is the sticky thing. This is stuff like parsing XML, accessing databases, graphics toolkit stuff, whatever. Things that aren't easy in C. Things that modern languages/frameworks will give for free. On OS X this code will be written in Objective-C interfacing with Cocoa. On Windows I'm thinking my best bet is to use C# So on Windows my architecture (simplified) looks like (C# or C?) - ANSI C - C# Is this possible? Some thoughts/suggestions so far.. 1) Compile my C core as a .dll -- this is fine, but seems there's no way to call my C# helpers unless I can somehow get function pointers and pass them to my core, but that seems unlikely 2) Compile a C .exe and a C# .exe and have them talk via shared memory or some kind of IPC. I'm not entirely opposed to this but it obviously introduces a lot of complexity so it doesn't seem ideal 3) Instead of C# use C++, it gets me some nice data management stuff and nice helper code. And I can mix it pretty easily. And the work I do could probably easily port to Linux. But I really don't like C++, and I don't want this to turn in to a 3rd-party-library-fest. Not that it's a huge deal, but it's 2010.. anything for basic data management should be built in. And targetting Linux is really not a priority. Note that no "total" alternatives are OK as suggested in other similar questions on SO I've seen; java, RealBasic, mono.. this is an extremely performance intensive application doing soft realtime for game/simulation purposes, I need C & friends here to do it right (maybe you don't, but I do)

    Read the article

  • Primary language - C++/Qt, C#, Java?

    - by Airjoe
    I'm looking for some input, but let me start with a bit of background (for tl;dr skip to end). I'm an IT major with a concentration in networking. While I'm not a CS major nor do I want to program as a vocation, I do consider myself a programmer and do pretty well with the concepts involved. I've been programming since about 6th grade, started out with a proprietary game creation language that made my transition into C++ at college pretty easy. I like to make programs for myself and friends, and have been paid to program for local businesses. A bit about that- I wrote some programs for a couple local businesses in my senior year in high school. I wrote management systems for local shops (inventory, phone/pos orders, timeclock, customer info, and more stuff I can't remember). It definitely turned out to be over my head, as I had never had any formal programming education. It was a great learning experience, but damn was it crappy code. Oh yeah, by the way, it was all vb6. So, I've used vb6 pretty extensively, I've used c++ in my classes (intro to programming up to algorithms), used Java a little bit in another class (had to write a ping client program, pretty easy) and used Java for some simple Project Euler problems to help learn syntax and such when writing the program for the class. I've also used C# a bit for my own simple personal projects (simple programs, one which would just generate an HTTP request on a list of websites and notify if one responded unexpectedly or not at all, and another which just held a list of things to do and periodically reminded me to do them), things I would've written in vb6 a year or two ago. I've just started using Qt C++ for some undergrad research I'm working on. Now I've had some formal education, I [think I] understand organization in programming a lot better (I didn't even use classes in my vb6 programs where I really should have), how it's important to structure code, split into functions where appropriate, document properly, efficiency both in memory and speed, dynamic and modular programming etc. I was looking for some input on which language to pick up as my "primary". As I'm not a "real programmer", it will be mostly hobby projects, but will include some 'real' projects I'm sure. From my perspective: QtC++ and Java are cross platform, which is cool. Java and C# run in a virtual machine, but I'm not sure if that's a big deal (something extra to distribute, possibly a bit slower? I think Qt would require additional distributables too, right?). I don't really know too much more than this, so I appreciate any help, thanks! TL;DR Am an avocational programmer looking for a language, want quick and straight forward development, liked vb6, will be working with database driven GUI apps- should I go with QtC++, Java, C#, or perhaps something else?

    Read the article

  • Rewrite code from Threads to AnyEvent

    - by user1779868
    I wrote a code: use LWP::UserAgent; use HTTP::Cookies; use threads; use threads::shared; $| = 1; $threads = 50; my @urls : shared = loadf('url.txt'); my @thread_list = (); $thread_list[$_] = threads->create(\&thread) for 0 .. $threads - 1; $_->join for @thread_list; thread(); sub thread { my ($web, $ck) = browser(); while(1) { my $url = shift @urls; if(!$url) { last; } $code = $web->get($url)->code; print "[+] $url - code: $code\n"; if($code == 200) { open F, ">>200.txt"; print F $url."\n"; close F; } elsif($code == 301) { open F, ">>301.txt"; print F $url."\n"; close F; } else { open F, ">>else.txt"; print F "$url code - $code\n"; close F; } } } sub loadf { open (F, "<".$_[0]) or erroropen($_[0]); chomp(my @data = <F>); close F; return @data; } sub browser { my $web = new LWP::UserAgent; my $ck = new HTTP::Cookies; $web->cookie_jar($ck); $web->agent('Opera/9.80 (Windows 7; U; en) Presto/2.9.168 Version/11.50'); $web->timeout(5); return $web, $ck; } After its working for some time physical storage is full. Can u help me to re-write it with AnyEvent. I tried but my code didn't work. I read that it will help me to safe some memory. Thanks a lot to any helpers.

    Read the article

  • Merge entries in XMLfile (SimpleXML in PHP)

    - by Cudos
    Hello. I have this in my XML file: <product name="iphone"> <variant name="iphone" product_number="12345" price="500" picture="iphone.jpg"> <description><![CDATA[iphone]]></description> <short_description><![CDATA[]]></short_description> <deliverytime><![CDATA[]]></deliverytime> <options> <option group="Color" option="Black" /> </options> </variant> </product> <product name="iphone"> <variant name="iphone" product_number="12345" price="500" picture="iphone.jpg"> <description><![CDATA[iphone]]></description> <short_description><![CDATA[]]></short_description> <deliverytime><![CDATA[]]></deliverytime> <options> <option group="Color" option="White" /> </options> </variant> </product> I want to merge it into this (Note that I merge the options tag): <product name="iphone"> <variant name="iphone" product_number="12345" price="500" picture="iphone.jpg"> <description><![CDATA[iphone]]></description> <short_description><![CDATA[]]></short_description> <deliverytime><![CDATA[]]></deliverytime> <options> <option group="Color" option="Black" /> <option group="Color" option="White" /> </options> </variant> </product> Preferably I want to do it all in the memory since I will process it further afterwards.

    Read the article

  • [N]Hibernate: view-like fetching properties of associated class

    - by chiccodoro
    (Felt quite helpless in formulating an appropriate title...) In my C# app I display a list of "A" objects, along with some properties of their associated "B" objects and properties of B's associated "C" objects: A.Name B.Name B.SomeValue C.Name Foo Bar 123 HelloWorld Bar Hello 432 World ... To clarify: A has an FK to B, B has an FK to C. (Such as, e.g. BankAccount - Person - Company). I have tried two approaches to load these properties from the database (using NHibernate): A fast approach and a clean approach. My eventual question is how to do a fast & clean approach. Fast approach: Define a view in the database which joins A, B, C and provides all these fields. In the A class, define properties "BName", "BSomeValue", "CName" Define a hibernate mapping between A and the View, whereas the needed B and C properties are mapped with update="false" insert="false" and do actually stem from B and C tables, but Hibernate is not aware of that since it uses the view. This way, the listing only loads one object per "A" record, which is quite fast. If the code tries to access the actual associated property, "A.B", I issue another HQL query to get B, set the property and update the faked BName and BSomeValue properties as well. Clean approach: There is no view. Class A is mapped to table A, B to B, C to C. When loading the list of A, I do a double left-join-fetch to get B and C as well: from A a left join fetch a.B left join fetch a.B.C B.Name, B.SomeValue and C.Name are accessed through the eagerly loaded associations. The disadvantage of this approach is that it gets slower and takes more memory, since it needs to created and map 3 objects per "A" record: An A, B, and C object each. Fast and clean approach: I feel somehow uncomfortable using a database view that hides a join and treat that in NHibernate as if it was a table. So I would like to do something like: Have no views in the database. Declare properties "BName", "BSomeValue", "CName" in class "A". Define the mapping for A such that NHibernate fetches A and these properties together using a join SQL query as a database view would do. The mapping should still allow for defining lazy many-to-one associations for getting A.B.C My questions: Is this possible? Is it [un]artful? Is there a better way?

    Read the article

  • DataGridView live display of datatable using virtual mode

    - by Chris
    I have a DataGridView that will display records (log entries) from a database. The amount of records that can exist at a time is very large. I would like to use the virtual mode feature of the DataGridView to display a page of data, and to minimize the amount of data that has to be transferred across a network at a given time. Polling for data is out of the question. There will be several clients running at a time, all of which are on the same network and viewing the records. If they all poll for data, the network will run very slowly. The data is read-only to the user; they won't be able to edit any of it, just view it. I need to know when updates occur in the database, and I need to update the screen with those updates accordingly using virtual mode. If a page of data a user is viewing contains data that has change, he/she will see those updates on that page. If updates were made to data in the database, but not in the data the user is viewing, then not much really changes on the user screen (Maybe just the scroll bar if records were added or removed). My current approach is using SQL server change tracking with the sync framework. Each client has a local SQL Server CE instance and database file that is kept in sync with the main database server. I use the information from the synchronization event to see if any changes were made to the main database and were sync'ed to the client. I need to use the DataGridView virtual mode here because I can't have thousands of records loaded into the DataGridView at once, otherwise memory usage goes through the roof. The main challenge right now is knowing how to use virtual mode to provide a seamless experience to the user by allowing them to scroll up and down through the records, and also have records update on the fly without interfering with the user inappropriately. Has anybody dealt with this issue before, and if so, where I can see how they did it? I've gone through some of the MSDN documentation and examples on virtual mode. So far, I haven't found documentation and/or examples on their site that explains how to do what I am trying to accomplish.

    Read the article

  • Function returning MYSQL_ROW

    - by Gabe
    I'm working on a system using lots of MySQL queries and I'm running into some memory problems I'm pretty sure have to do with me not handling pointers right... Basically, I've got something like this: MYSQL_ROW function1() { string query="SELECT * FROM table limit 1;"; MYSQL_ROW return_row; mysql_init(&connection); // "connection" is a global variable if (mysql_real_connect(&connection,HOST,USER,PASS,DB,0,NULL,0)){ if (mysql_query(&connection,query.c_str())) cout << "Error: " << mysql_error(&connection); else{ resp = mysql_store_result(&connection); //"resp" is also global if (resp) return_row = mysql_fetch_row(resp); mysql_free_result(resp); } mysql_close(&connection); }else{ cout << "connection failed\n"; if (mysql_errno(&connection)) cout << "Error: " << mysql_errno(&connection) << " " << mysql_error(&connection); } return return_row; } And function2(): MYSQL_ROW function2(MYSQL_ROW row) { string query = "select * from table2 where code = '" + string(row[2]) + "'"; MYSQL_ROW retorno; mysql_init(&connection); if (mysql_real_connect(&connection,HOST,USER,PASS,DB,0,NULL,0)){ if (mysql_query(&connection,query.c_str())) cout << "Error: " << mysql_error(&conexao); else{ // My "debugging" shows me at this point `row[2]` is already fubar resp = mysql_store_result(&connection); if (resp) return_row = mysql_fetch_row(resp); mysql_free_result(resp); } mysql_close(&connection); }else{ cout << "connection failed\n"; if (mysql_errno(&connection)) cout << "Error : " << mysql_errno(&connection) << " " << mysql_error(&connection); } return return_row; } And main() is an infinite loop basically like this: int main( int argc, char* args[] ){ MYSQL_ROW row = NULL; while (1) { row = function1(); if(row != NULL) function2(row); } } (variable and function names have been generalized to protect the innocent) But after the 3rd or 4th call to function2, that only uses row for reading, row starts losing its value coming to a segfault error... Anyone's got any ideas why? I'm not sure the amount of global variables in this code is any good, but I didn't design it and only got until tomorrow to fix and finish it, so workarounds are welcome! Thanks!

    Read the article

  • Is it Bad Practice to use C++ only for the STL containers?

    - by gmatt
    First a little background ... In what follows, I use C,C++ and Java for coding (general) algorithms, not gui's and fancy program's with interfaces, but simple command line algorithms and libraries. I started out learning about programming in Java. I got pretty good with Java and I learned to use the Java containers a lot as they tend to reduce complexity of book keeping while guaranteeing great performance. I intermittently used C++, but I was definitely not as good with it as with Java and it felt cumbersome. I did not know C++ enough to work in it without having to look up every single function and so I quickly reverted back to sticking to Java as much as possible. I then made a sudden transition into cracking and hacking in assembly language, because I felt I was concentrated too much attention on a much too high level language and I needed more experience with how a CPU interacts with memory and whats really going on with the 1's and 0's. I have to admit this was one of the most educational and fun experiences I've had with computers to date. For obviously reasons, I could not use assembly language to code on a daily basis, it was mostly reserved for fun diversions. After learning more about the computer through this experience I then realized that C++ is so much closer to the "level of 1's and 0's" than Java was, but I still felt it to be incredibly obtuse, like a swiss army knife with far too many gizmos to do any one task with elegance. I decided to give plain vanilla C a try, and I quickly fell in love. It was a happy medium between simplicity and enough "micromanagent" to not abstract what is really going on. However, I did miss one thing about Java: the containers. In particular, a simple container (like the stl vector) that expands dynamically in size is incredibly useful, but quite a pain to have to implement in C every time. Hence my code currently looks like almost entirely C with containers from C++ thrown in, the only feature I use from C++. I'd like to know if its consider okay in practice to use just one feature of C++, and ignore the rest in favor of C type code?

    Read the article

  • nodejs async.waterfall method

    - by user1513388
    Update 2 Complete code listing var request = require('request'); var cache = require('memory-cache'); var async = require('async'); var server = '172.16.221.190' var user = 'admin' var password ='Passw0rd' var dn ='\\VE\\Policy\\Objects' var jsonpayload = {"Username": user, "Password": password} async.waterfall([ //Get the API Key function(callback){ request.post({uri: 'http://' + server +'/sdk/authorize/', json: jsonpayload, headers: {'content_type': 'application/json'} }, function (e, r, body) { callback(null, body.APIKey); }) }, //List the credential objects function(apikey, callback){ var jsonpayload2 = {"ObjectDN": dn, "Recursive": true} request.post({uri: 'http://' + server +'/sdk/Config/enumerate?apikey=' + apikey, json: jsonpayload2, headers: {'content_type': 'application/json'} }, function (e, r, body) { var dns = []; for (var i = 0; i < body.Objects.length; i++) { dns.push({'name': body.Objects[i].Name, 'dn': body.Objects[i].DN}) } callback(null, dns, apikey); }) }, function(dns, apikey, callback){ // console.log(dns) var cb = []; for (var i = 0; i < dns.length; i++) { //Retrieve the credential var jsonpayload3 = {"CredentialPath": dns[i].dn, "Pattern": null, "Recursive": false} console.log(dns[i].dn) request.post({uri: 'http://' + server +'/sdk/credentials/retrieve?apikey=' + apikey, json: jsonpayload3, headers: {'content_type': 'application/json'} }, function (e, r, body) { // console.log(body) cb.push({'cl': body.Classname}) callback(null, cb, apikey); console.log(cb) }); } } ], function (err, result) { // console.log(result) // result now equals 'done' }); Update: I'm building a small application that needs to make multiple HTTP calls to a an external API and amalgamates the results into a single object or array. e.g. Connect to endpoint and get auth key - pass auth key to step 2 Connect to endpoint using auth key and get JSON results - create an object containing summary results and pass to step 3. Iterate over passed object summary results and call API for each item in the object to get detailed information for each summary line Create a single JSON data structure that contains the summary and detail information. The original question below outlines what I've tried so far! Original Question: Will the async.waterfall method support multiple callbacks? i.e. Iterate over an array thats passed from a previous item in the chain, then invoke multiple http requests each of which would have their own callbacks. e.g, sync.waterfall([ function(dns, key, callback){ var cb = []; for (var i = 0; i < dns.length; i++) { //Retrieve the credential var jsonpayload3 = {"Cred": dns[i].DN, "Pattern": null, "Recursive": false} console.log(dns[i].DN) request.post({uri: 'http://' + vedserver +'/api/cred/retrieve?apikey=' + key, json: jsonpayload3, headers: {'content_type': 'application/json'} }, function (e, r, body) { console.log(body) cb.push({'cl': body.Classname}) callback(null, cb, key); }); } }

    Read the article

  • why gcc emits segmentation ,after my code run

    - by gcc
    every time ,why have I encountered with segmentation fault ? still,I have not found my fault sometimes, gcc emits segmentation fault ,sometimes, memory satck limit is exceeded I think you will understand (easily) what is for that code void my_main() { char *tutar[50],tempc; int i=0,temp,g=0,a=0,j=0,d=1,current=0,command=0,command2=0; do{ tutar[i]=malloc(sizeof(int)); scanf("%s",tutar[i]); temp=*tutar[i]; } while(temp=='x'); i=0; num_arrays=atoi(tutar[i]); i=1; tempc=*tutar[i]; if(tempc!='x' && tempc!='d' && tempc!='a' && tempc!='j') { current=1; arrays[current]=malloc(sizeof(int)); l_arrays[current]=calloc(1,sizeof(int)); c_arrays[current]=calloc(1,sizeof(int));} i=1; current=1; while(1) { tempc=*tutar[i]; if(tempc=='x') break; if(tempc=='n') { ++current; arrays[current]=malloc(sizeof(int)); l_arrays[current]=calloc(1,sizeof(int)); c_arrays[current]=calloc(1,sizeof(int)); ++i; continue; } if(tempc=='d') { ++i; command=atoi(tutar[i])-1; free(arrays[command]); free(l_arrays[command]); free(c_arrays[command]); ++i; continue; } if(tempc=='j') { ++i; current=atoi(tutar[i])-1; if(arrays[current]==NULL) { arrays[current]=malloc(sizeof(int)); l_arrays[current]=calloc(1,sizeof(int)); c_arrays[current]=calloc(1,sizeof(int)); ++i; } else { a=l_arrays[current]; j=l_arrays[current]; ++i;} continue; } } }

    Read the article

  • A case-insensitive related implementation problem

    - by Robert
    Hi All, I am going through a final refinement posted by the client, which needs me to do a case-insesitive query. I will basically walk through how this simple program works. First of all, in my Java class, I did a fairly simple webpage parsing: title=(String)results.get("title"); doc = docBuilder.parse("http://" + server + ":" + port + "/exist/rest/db/wb/xql/media_lookup.xql?" + "&title=" + title); This Java statement references an XQuery file "media_lookup.xql" which is stored on localhost, and the only parameter we are passing is the string "title". Secondly, let's take at look at that XQuery file: $title := request:get-parameter('title',""), $mediaNodes := doc('/db/wb/portfolio/media_data.xml'), $query := $mediaNodes//media[contains(title,$title)], Then it will evaluate that query. This XQuery will get the "title" parameter that are passes from our Java class, and query the "media_data" xml file stored in the database, which contains a bunch of media nodes with a 'title' element node. As you may expect, this simple query will just match those media nodes whose 'title' element contains a substring of what the value of string 'title' is. So if our 'title' is "Chi", it will return media nodes whose title may be "Chicago" or "Chicken". The refinment request posted by the client is that there should be NO case-sensitivity. The very intuitive way is to modify the XQuery statement by using a lower-case funtion in it, like: $query := $mediaNodes//media[contains(lower-case(title/text(),lower-case($title))], However, the question comes: this modified query will run my machine into memory overflow. Since my "media_data.xml" is quite huge and contains thouands of millions of media nodes, I assume the lower-case() function will run on each of the entries, thus causing the machine to crash. I've talked with some experienced XQuery programmer, and they think I should use an index to solve this problem, and I will definitely research into that. But before that, I am just posting this problem here to get other ideas or any suggestions, do you think any other way may help? for example, could I tweak the Java parse statement to realize the case-insensitivity? Since I think I saw some people did some string concatination by using "contains." in Java before passing it to the server. Any idea or help is welcomed, thanks in advance.

    Read the article

  • How to Transfer Large File from MS Word Add-In (VBA) to Web Server?

    - by Ian Robinson
    Overview I have a Microsoft Word Add-In, written in VBA (Visual Basic for Applications), that compresses a document and all of it's related contents (embedded media) into a zip archive. After creating the zip archive it then turns the file into a byte array and posts it to an ASMX web service. This mostly works. Issues The main issue I have is transferring large files to the web site. I can successfully upload a file that is around 40MB, but not one that is 140MB (timeout/general failure). A secondary issue is that building the byte array in the VBScript Word Add-In can fail by running out of memory on the client machine if the zip archive is too large. Potential Solutions I am considering the following options and am looking for feedback on either option or any other suggestions. Option One Opening a file stream on the client (MS Word VBA) and reading one "chunk" at a time and transmitting to ASMX web service which assembles the "chunks" into a file on the server. This has the benefit of not adding any additional dependencies or components to the application, I would only be modifying existing functionality. (Fewer dependencies is better as this solution should work in a variety of server environments and be relatively easy to set up.) Question: Are there examples of doing this or any recommended techniques (either on the client in VBA or in the web service in C#/VB.NET)? Option Two I understand WCF may provide a solution to the issue of transferring large files by "chunking" or streaming data. However, I am not very familiar with WCF, and am not sure what exactly it is capable of or if I can communicate with a WCF service from VBA. This has the downside of adding another dependency (.NET 3.0). But if using WCF is definitely a better solution I may not mind taking that dependency. Questions: Does WCF reliably support large file transfers of this nature? If so, what does this involve? Any resources or examples? Are you able to call a WCF service from VBA? Any examples?

    Read the article

  • How can I run an android frame animation without it skewing?

    - by GameDev123
    I have a small state machine that runs a series of frame by frame animations in an ImageView, in a nested hierarchy of layouts. There is more than adequate space to display each frame of the animation. Each frame of the animation is cropped to fit the minimum amount of area, in order to save memory. If a frame only contains 50x50 worth of pixels then the png is 50x50. There is no transparent padding to keep them the same size. The ImageView is directly within a RelativeLayout, and is anchored to the bottom left with some padding. The general idea being that the character in the animation performs some action, which results in individual frames of the animation growing or shrinking. The issue is that individual frames of animation are skewed, and there does not appear to be any way of preventing this. If I set the source of the imageview directly to one of the frames of animation, it displays fine in the layout manager. I have tried this with Adjust View Bounds set to true, false, and undefined. I have tried using the background and the src attribute of imageview to set the animation drawable, I have tried every configuration of layout manager and setting minimum/maximum size that I can think of, and it still stretches the character on various frames depending on the size of the source png. In essence, all I want to do is say "I want this ImageView to anchor in the bottom left and then display any frame that happens to be in it without stretching or skewing it in any way aside from that which occurred when the frame png's were loaded." Seems simple, but I have yet to come across any way of doing it. Here is the layout of the imageview as of my last test, I had to remove bits of the XML to get it to display but nothing pertinent: RelativeLayout android:orientation="horizontal" android:layout_above="@+id/MenuOptions" android:layout_width="fill_parent" android:id="@+id/AnimationLayout" android:clipChildren="false" android:minHeight="180dp" android:layout_height="fill_parent" android:layout_below="@+id/GameBarLayout" ImageView android:id="@+id/animatedImg" android:layout_height="wrap_content" android:layout_width="wrap_content" android:visibility="visible" android:baselineAlignBottom="true" android:minHeight="180dp" android:minWidth="200dp" android:adjustViewBounds="true" android:layout_alignParentBottom="true" android:paddingLeft="30dp" android:paddingBottom="10dp" android:src="@drawable/idle01"/ImageView /RelativeLayout Here is how an animation is set up: animationDrawable = new AnimationDrawable(); animationDrawable.addFrame(res.getDrawable(R.drawable.idle01), 16); animationDrawable.addFrame(res.getDrawable(R.drawable.idle02), 16); animationDrawable.addFrame(res.getDrawable(R.drawable.idle03), 16);

    Read the article

  • Defined variables and arrays vs functions in php

    - by Frank Presencia Fandos
    Introduction I have some sort of values that I might want to access several times each page is loaded. I can take two different approaches for accessing them but I'm not sure which one is 'better'. Three already implemented examples are several options for the Language, URI and displaying text that I describe here: Language Right now it is configured in this way: lang() is a function that returns different values depending on the argument. Example: lang("full") returns the current language, "English", while lang() returns the abbreviation of the current language, "en". There are many more options, like lang("select"), lang("selectact"), etc that return different things. The code is too long and irrelevant for the case so if anyone wants it just ask for it. Url The $Url array also returns different values depending on the request. The whole array is fully defined in the beginning of the page and used to get shorter but accurate links of the current page. Example: $Url['full'] would return "http://mypage.org/path/to/file.php?page=1" and $Url['file'] would return "file.php". It's useful for action="" within the forms and many other things. There are more values for $Url['folder'], $Url['file'], etc. Same thing about the code, if wanted, just request it. Text [You can skip this section] There's another array called $Text that is defined in the same way than $Url. The whole array is defined at the beginning, making a mysql call and defining all $Text[$i] for current page with a while loop. I'm not sure if this is more efficient than multiple calls for a single mysql cell. Example: $Text['54'] returns "This is just a test array!" which this could perfectly be implemented with a function like text(54). Question With the 3 examples you can see that I use different methods to do almost the same function (no pun intended), but I'm not sure which one should become the standard one for my code. I could create a function called url() and other called text() to output what I want. I think that working with functions in those cases is better, but I'm not sure why. So I'd really appreciate your opinions and advice. Should I mix arrays and functions in the way I described or should I just use funcions? Please, base your answer in this: The source needs to be readable and reusable by other developers Resource consumption (processing, time and memory). The shorter the code the better. The more you explain the reasons the better. Thank you PS, now I know the differences between $Url and $Uri.

    Read the article

  • iOS dynamic object creation

    - by Abdul Ahmad
    I've worked with Xcode and iOS on a few personal projects and have always used non-object-oriented designs for everything... just because I've been doing mostly learning/experimenting with things. Now I've been trying to implement some object oriented design into one game I've made previously. The idea is, I have a space ship that can shoot bullets. In the past I basically added the UIImageView to the storyboard and then connected it to the .h file and from there did things on it like move it around or whatever (using CGPointMake). The idea now is to make a method (and a whole other class soon) that will create a UIImageView programmatically, allocate it, add it to the superview etc... I've got this working so far, easy stuff, but the next part is a bit harder. Where do I store this local variable "bullet"? I've been saving it to an NSMutableArray and doing the following: (actually here are the methods that I have) -(void)movement { for (int i = 0; i < [array1 count]; i ++) { UIImageView *a = [array1 objectAtIndex:i]; a.center = CGPointMake(a.center.x + 2, a.center.y); if (a.center.x > 500) { [array1 removeObjectAtIndex:i]; [a removeFromSuperview]; } } } -(void)getBullet { UIImageView *bullet = [[UIImageView alloc] initWithFrame:CGRectMake(ship.center.x + 20, ship.center.y - 2, 15, 3)]; bullet.image = [UIImage imageNamed:@"bullet2.png"]; bullet.hidden = NO; [self.view addSubview:bullet]; [array1 addObject:bullet]; } (by the way, array1 is declared in the .h file) and theres a timer that controls the movement method timer = [NSTimer scheduledTimerWithTimeInterval:0.5 target:self selector:@selector(movement) userInfo:nil repeats:YES]; first question is: what is the correct way of doing this? Storing a bullet for example until it is removed from the superview, should I store it another way? and another question is, when I remove a UIImageView from the superview, does that remove it from memory so its not using up system resources? Thank you for the help! (will update if I Think of other questions

    Read the article

  • C - How to use both aio_read() and aio_write().

    - by Slav
    I implement game server where I need to both read and write. So I accept incoming connection and start reading from it using aio_read() but when I need to send something, I stop reading using aio_cancel() and then use aio_write(). Within write's callback I resume reading. So, I do read all the time but when I need to send something - I pause reading. It works for ~20% of time - in other case call to aio_cancel() fails with "Operation now in progress" - and I cannot cancel it (even within permanent while cycle). So, my added write operation never happens. How to use these functions well? What did I missed? EDIT: Used under Linux 2.6.35. Ubuntu 10 - 32 bit. Example code: void handle_read(union sigval sigev_value) { /* handle data or disconnection */ } void handle_write(union sigval sigev_value) { /* free writing buffer memory */ } void start() { const int acceptorSocket = socket(AF_INET, SOCK_STREAM, 0); struct sockaddr_in addr; memset(&addr, 0, sizeof(struct sockaddr_in)); addr.sin_family = AF_INET; addr.sin_addr.s_addr = INADDR_ANY; addr.sin_port = htons(port); bind(acceptorSocket, (struct sockaddr*)&addr, sizeof(struct sockaddr_in)); listen(acceptorSocket, SOMAXCONN); struct sockaddr_in address; socklen_t addressLen = sizeof(struct sockaddr_in); for(;;) { const int incomingSocket = accept(acceptorSocket, (struct sockaddr*)&address, &addressLen); if(incomingSocket == -1) { /* handle error ... */} else { //say socket to append outcoming messages at writing: const int currentFlags = fcntl(incomingSocket, F_GETFL, 0); if(currentFlags < 0) { /* handle error ... */ } if(fcntl(incomingSocket, F_SETFL, currentFlags | O_APPEND) == -1) { /* handle another error ... */ } //start reading: struct aiocb* readingAiocb = new struct aiocb; memset(readingAiocb, 0, sizeof(struct aiocb)); readingAiocb->aio_nbytes = MY_SOME_BUFFER_SIZE; readingAiocb->aio_fildes = socketDesc; readingAiocb->aio_buf = mySomeReadBuffer; readingAiocb->aio_sigevent.sigev_notify = SIGEV_THREAD; readingAiocb->aio_sigevent.sigev_value.sival_ptr = (void*)mySomeData; readingAiocb->aio_sigevent.sigev_notify_function = handle_read; if(aio_read(readingAiocb) != 0) { /* handle error ... */ } } } } //called at any time from server side: send(void* data, const size_t dataLength) { //... some thread-safety precautions not needed here ... const int cancellingResult = aio_cancel(socketDesc, readingAiocb); if(cancellingResult != AIO_CANCELED) { //this one happens ~80% of the time - embracing previous call to permanent while cycle does not help: if(cancellingResult == AIO_NOTCANCELED) { puts(strerror(aio_return(readingAiocb))); // "Operation now in progress" /* don't know what to do... */ } } //otherwise it's okay to send: else { aio_write(...); } }

    Read the article

  • Calling managed code from unmanaged win32 assembly dll - crash

    - by JustGreg
    I'm developing a serial port dll in win32 assembly (MASM32). It has its own thread checking multiple events and at a specified buffer treshold it'd notify the managed main application by calling a callback function. It just a call with no arguments/return value. At startup the main application stores the callback function's address by calling a function in the dll: pCallBackFunction dd 0 SetCallBackPointer proc pcb:DWORD mov eax, pcb mov pCallBackFunction, eax call DWORD ptr pCallBackFunction ; verify it immediately ret SetCallBackPointer endp The upper function immediately calls back the managed application callback routine for verification purposes. It is working fine. However, when I place the call instruction to other functions in the dll it crashes the application. It doesn't matter if the call is in a simple function or in the threadproc of the dll. For example: OpenPort proc pn:byte,br:dword, inputbuffersize: dword, outputbuffersize:dword, tresholdsize: dword LOCAL dcb: DCB LOCAL SerialTimeOuts: COMMTIMEOUTS call DWORD ptr pCallBackFunction xor eax, eax mov al, pn mov [com_port+3],al etc. etc. will crash at call DWORD ptr pCallBackFunction always. Since I call SetCallBackPointer first to store a valid address in pCallBackFunction, it should have a valid address. My managed app is written in C# and the relevant part is: public partial class Form1 : Form { public delegate void CallBackDelegate(); public static CallBackDelegate mydelegate; [DllImport("serialport.dll")] private static extern void SetCallBackPointer(CallBackDelegate Delegate); [DllImport("serialport.dll")] public static extern int OpenPort(byte com, uint br, uint inbufsize, uint outbufsize, uint treshsize); public Form1() { InitializeComponent(); mydelegate =new CallBackDelegate(CallbackFunction); SetCallBackPointer(mydelegate); unsafe { int sysstat; int hResult; hResult = OpenPort(Convert.ToByte('5'), 9600, 306, 4, 4); } } public static void CallbackFunction() { MessageBox.Show( "CallBack Function Called by Windows DLL"); } The VS debugger reported that the dll had tried to read/write from/to a protected memory address. But when calling SetCallBackPointer there is no such problem. What am I doing wrong here? Any tips would be great!

    Read the article

< Previous Page | 474 475 476 477 478 479 480 481 482 483 484 485  | Next Page >