Search Results

Search found 14861 results on 595 pages for 'high speed computing'.

Page 479/595 | < Previous Page | 475 476 477 478 479 480 481 482 483 484 485 486  | Next Page >

  • Is there any special tool for interactive GUI development

    - by niko
    Hi, Currently I am preparing exercises about networks and mobile communications for students. I was thinking about creating an interactive user-interface which enables the user to drag&drop predefined elements and then implement a logic based upon element distances etc. An example would be to place two base stations (a predefined element with several properties), set the scale in the interface and then check the signal interferrence in the environment (user-interface). The first part might be too abstract whereas the example might be too specific, but I was wondering whether there already exists any friendly framework or language which enables developers to create interactive interfaces (for teaching/learning purpouses) in short ammount of time. Usually I write applications for PC environment in .NET but in this case it would take too much time to create a specific interface for every exercise. I would appreciate if anyone could suggest any way to create interactive user-interface in short ammount of time. Are there any special programming languages or development tools for this kind of applications or are there any useful frameworks for .NET, Java or any other language to speed up the development of user-interfaces? Thank you!

    Read the article

  • What is more viable to use? Javascript libraries or UI Programming tools?

    - by Haresh Karkar
    What is more viable to use:- Javascript Libraries: YUI, jQuery, ExtJs OR UI Programming tools: GWT, ExtGWT, SmartGWT It has become very difficult to choose between them as they are constantly increasing their capabilities to meet newer requirements. We all know the power of jQuery in UI manipulations. The latest news from Microsoft about jQuery being officially part of .Net developr’s toolkit will definitely make jQuery a preferred choice against other JavaScript libraries [See link: http://weblogs.asp.net/scottgu/archive/2008/09/28/jquery-and-microsoft.aspx]. But on the other hand, GWT is building a framework which could be used on client as well as on the sever side. This is definitely going to make developers’ life easy as it does not require developer to be an expert in browser quirks, XMLHttpRequest, and JavaScript in order to develop high-performance web applications. It includes SDK (Java API libraries, compiler, and development server which allows to write client-side applications in Java and deploy them as JavaScript), Speed Tracer and plug-in for Eclipse. GWT is used by many products like Google Wave and AdWords. So question is still un-answered, what is more viable to use? Any thoughts?

    Read the article

  • YUI: ensuring DOM elements and scripts are ready

    - by dound
    If I put my inline script after the DOM elements it interacts with, should I still use YUI 3's domready event? I haven't noticed any problems, and it seems like I can count on the browser loading the page sequentially. (I already use YUI().use('node', ... to make sure the YUI functions I need have been loaded since the YUI script is a separate file.) Is there a way to speed up the loading of widgets like YUI 2's calendar? I load the appropriate script in <head> element of my page. I use YUI().use('yui2-calendar', ... to make sure the Calendar widget is available. Unfortunately, this causes a short but noticeable delay when I load my page with the calendar. If I omit the YUI().use('yui2-calendar', ... code then it shows up without a noticeable delay - but I guess this could cause the Calendar to not show up at all if the YUI script doesn't load in time? With regards to #2, is it possible to reduce the visual artifact of the calendar not being present and then showing up? I've made it slightly better by specifying a height and width for the parent div so that at least the space is already allocated = minimal shifting around when it does load.

    Read the article

  • GAE Task Queue oddness

    - by b3nw
    I have been testing the taskqueue with mixed success. Currently I am using the default queue, in default settings ect ect.... I have a test url setup which inserts about 8 tasks into the queue. With short order, all 8 are completed properly. So far so good. The problem comes up when I re-load that url twice under say a minute. Now watching the task queue, all the tasks are added properly, but only the first batch execute it seems. But the "Run in Last Minute" # shows the right number of tasks being run.... The request logs tell a different story. They show only the first set of 8 running, but all task creation urls working successfully. The oddness of this is that if I wait say a minute between the task creation url requests, it will work fine. Oddly enough changing the bucket_size or execution speed does not seem to help. Only the first batch are executed. I have also reduced the number of requests all the way down to 2, and still found only the first 2 execute. Any others added display the same issues as above. Any suggestions? Thanks

    Read the article

  • iPhone - dequeueReusableCellWithIdentifier usage

    - by Jukurrpa
    Hi, I'm working on a iPhone app which has a pretty large UITableView with data taken from the web, so I'm trying to optimize its creation and usage. I found out that dequeueReusableCellWithIdentifier is pretty useful, but after seeing many source codes using this, I'm wondering if the usage I make of this function is the good one. Here is what people usually do: UITableViewCell* cell = [tableView dequeueReusableCellWithIdentifier:@"Cell"]; if (cell == nil) { cell = [[UITableViewCell alloc] initWithFrame:CGRectZero reuseIdentifier:@"Cell"]; // Add elements to the cell return cell; And here is the way I did it: NSString identifier = [NSString stringWithFormat:@"Cell @d", indexPath.row]: // The cell row UITableViewCell* cell = [tableView dequeueReusableCellWithIdentifier:identifier]; if (cell != nil) return cell; cell = [[UITableViewCell alloc] initWithFrame:CGRectZero reuseIdentifier:identifier]; // Add elements to the cell return cell; The difference is that people use the same identifier for every cell, so dequeuing one only avoids to alloc a new one. For me, the point of queuing was to give each cell a unique identifier, so when the app asks for a cell it already displayed, neither allocation nor element adding have to be done. In fine I don't know which is best, the "common" method ceils the table's memory usage to the exact number of cells it display, whislt the method I use seems to favor speed as it keeps all calculated cells, but can cause large memory consumption (unless there's an inner limit to the queue). Am I wrong to use it this way? Or is it just up to the developper, depending on his needs?

    Read the article

  • Haskell Linear Algebra Matrix Library for Arbitrary Element Types

    - by Johannes Weiß
    I'm looking for a Haskell linear algebra library that has the following features: Matrix multiplication Matrix addition Matrix transposition Rank calculation Matrix inversion is a plus and has the following properties: arbitrary element (scalar) types (in particular element types that are not Storable instances). My elements are an instance of Num, additionally the multiplicative inverse can be calculated. The elements mathematically form a finite field (??2256). That should be enough to implement the features mentioned above. arbitrary matrix sizes (I'll probably need something like 100x100, but the matrix sizes will depend on the user's input so it should not be limited by anything else but the memory or the computational power available) as fast as possible, but I'm aware that a library for arbitrary elements will probably not perform like a C/Fortran library that does the work (interfaced via FFI) because of the indirection of arbitrary (non Int, Double or similar) types. At least one pointer gets dereferenced when an element is touched (written in Haskell, this is not a real requirement for me, but since my elements are no Storable instances the library has to be written in Haskell) I already tried very hard and evaluated everything that looked promising (most of the libraries on Hackage directly state that they wont work for me). In particular I wrote test code using: hmatrix, assumes Storable elements Vec, but the documentation states: Low Dimension : Although the dimensionality is limited only by what GHC will handle, the library is meant for 2,3 and 4 dimensions. For general linear algebra, check out the excellent hmatrix library and blas bindings I looked into the code and the documentation of many more libraries but nothing seems to suit my needs :-(. Update Since there seems to be nothing, I started a project on GitHub which aims to develop such a library. The current state is very minimalistic, not optimized for speed at all and only the most basic functions have tests and therefore should work. But should you be interested in using or helping out developing it: Contact me (you'll find my mail address on my web site) or send pull requests.

    Read the article

  • Is SQLDataReader slower than using the command line utility sqlcmd?

    - by Andrew
    I was recently advocating to a colleague that we replace some C# code that uses the sqlcmd command line utility with a SqlDataReader. The old code uses: System.Diagnostics.ProcessStartInfo procStartInfo = new System.Diagnostics.ProcessStartInfo("cmd", "/c " + sqlCmd); wher sqlCmd is something like "sqlcmd -S " + serverName + " -y 0 -h-1 -Q " + "\"" + "USE [" + database + "]" + ";+ txtQuery.Text +"\"";\ The results are then parsed using regular expressions. I argued that using a SQLDataReader woud be more in line with industry practices, easier to debug and maintain and probably faster. However, the SQLDataReader approach is at least the same speed and quite possibly slower. I believe I'm doing everything correctly with SQLDataReader. The code is: using (SqlConnection connection = new SqlConnection()) { try { SqlConnectionStringBuilder builder = new SqlConnectionStringBuilder(connectionString); connection.ConnectionString = builder.ToString(); ; SqlCommand command = new SqlCommand(queryString, connection); connection.Open(); SqlDataReader reader = command.ExecuteReader(); // do stuff w/ reader reader.Close(); } catch (Exception ex) { outputMessage += (ex.Message); } } I've used System.Diagnostics.Stopwatch to time both approaches and the command line utility (called from C# code) does seem faster (20-40%?). The SqlDataReader has the neat feature that when the same code is called again, it's lightening fast, but for this application we don't anticipate that. I have already done some research on this problem. I note that the command line utility sqlcmd uses OLE DB technology to hit the database. Is that faster than ADO.NET? I'm really suprised, especially since the command line utility approach involves starting up a process. I really thought it would be slower. Any thoughts? Thanks, Dave

    Read the article

  • WCF Double Hop questions about Security and Binding.

    - by Ken Maglio
    Background information: .Net Website which calls a service (aka external service) facade on an app server in the DMZ. This external service then calls the internal service which is on our internal app server. From there that internal service calls a stored procedure (Linq to SQL Classes), and passes the serialized data back though to the external service, and from there back to the website. We've done this so any communication goes through an external layer (our external app server) and allows interoperability; we access our data just like our clients consuming our services. We've gotten to the point in our development where we have completed the system and it all works, the double hop acts as it should. However now we are working on securing the entire process. We are looking at using TransportWithMessageCredentials. We want to have WS2007HttpBinding for the external for interoperability, but then netTCPBinding for the bridge through the firewall for security and speed. Questions: If we choose WS2007HttpBinding as the external services binding, and netTCPBinding for the internal service is this possible? I know WS-* supports this as does netTCP, however do they play nice when passing credential information like user/pass? If we go to Kerberos, will this impact anything? We may want to do impersonation in the future. If you can when you answer post any reference links about why you're answering the way you are, that would be very helpful to us. Thanks!

    Read the article

  • What strategy do you use to sync your code when working from home

    - by Ben Daniel
    At my work I currently have my development environment inside a Virtual Machine. When I need to do work from home I copy my VM and any databases I need onto a laptop drive sized external USB drive. After about 10 minutes of copying I put the drive in my pocket and head home, copy back the VM and databases onto my personal computer and I'm ready to work. I follow the same steps to take the work back with me. So if I count the total amount of time I spend waiting around for files to finish copying in order for me to take work home and bring it back again, it comes to around 40 minutes! I do have a VPN connection to my work from home (providing the internet is up at both sites) and a decent internet speed (8mbits down/?up) but I find Remote Desktoping into my work machine laggy enough for me to want to work on my VM directly. So in looking at what other options I have or how I could improve my existing option I'm interested in what strategy you use or recommend to do work at home and keeping your code/environment in sync. EDIT: I'd prefer an option where I don't have to commit my changes into version control before I leave work - as I like to make meaningful descriptive comments in my commits, committing would take longer than just copying my VM onto a portable drive! lol Also I'd prefer a solution where my dev environment stays in sync too. Having said that I'm still very interested in your own solutions even if they don't exactly solve my problem as best as I'd like. :)

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Refactoring ADO.NET - SqlTransaction vs. TransactionScope

    - by marc_s
    I have "inherited" a little C# method that creates an ADO.NET SqlCommand object and loops over a list of items to be saved to the database (SQL Server 2005). Right now, the traditional SqlConnection/SqlCommand approach is used, and to make sure everything works, the two steps (delete old entries, then insert new ones) are wrapped into an ADO.NET SqlTransaction. using (SqlConnection _con = new SqlConnection(_connectionString)) { using (SqlTransaction _tran = _con.BeginTransaction()) { try { SqlCommand _deleteOld = new SqlCommand(......., _con); _deleteOld.Transaction = _tran; _deleteOld.Parameters.AddWithValue("@ID", 5); _con.Open(); _deleteOld.ExecuteNonQuery(); SqlCommand _insertCmd = new SqlCommand(......, _con); _insertCmd.Transaction = _tran; // add parameters to _insertCmd foreach (Item item in listOfItem) { _insertCmd.ExecuteNonQuery(); } _tran.Commit(); _con.Close(); } catch (Exception ex) { // log exception _tran.Rollback(); throw; } } } Now, I've been reading a lot about the .NET TransactionScope class lately, and I was wondering, what's the preferred approach here? Would I gain anything (readibility, speed, reliability) by switching to using using (TransactionScope _scope = new TransactionScope()) { using (SqlConnection _con = new SqlConnection(_connectionString)) { .... } _scope.Complete(); } What you would prefer, and why? Marc

    Read the article

  • Programmatically talking to a Serial Port in OS X or Linux

    - by deadprogrammer
    I have a Prolite LED sign that I like to set up to show scrolling search queries from a apache logs and other fun statistics. The problem is, my G5 does not have a serial port, so I have to use a usb to serial dongle. It shows up as /dev/cu.usbserial and /dev/tty.usbserial . When i do this everything seems to be hunky-dory: stty -f /dev/cu.usbserial speed 9600 baud; lflags: -icanon -isig -iexten -echo iflags: -icrnl -ixon -ixany -imaxbel -brkint oflags: -opost -onlcr -oxtabs cflags: cs8 -parenb Everything also works when I use the serial port tool to talk to it. If I run this piece of code while the above mentioned serial port tool, everthing also works. But as soon as I disconnect the tool the connection gets lost. #!/usr/bin/python import serial ser = serial.Serial('/dev/cu.usbserial', 9600, timeout=10) ser.write("<ID01><PA> \r\n") read_chars = ser.read(20) print read_chars ser.close() So the question is, what magicks do I need to perform to start talking to the serial port without the serial port tool? Is that a permissions problem? Also, what's the difference between /dev/cu.usbserial and /dev/tty.usbserial?

    Read the article

  • count on LINQ union

    - by brechtvhb
    I'm having this link statement: List<UserGroup> domains = UserRepository.Instance.UserIsAdminOf(currentUser.User_ID); query = (from doc in _db.Repository<Document>() join uug in _db.Repository<User_UserGroup>() on doc.DocumentFrom equals uug.User_ID where domains.Contains(uug.UserGroup) select doc) .Union(from doc in _db.Repository<Document>() join uug in _db.Repository<User_UserGroup>() on doc.DocumentTo equals uug.User_ID where domains.Contains(uug.UserGroup) select doc); Running this statement doesn't cause any problems. But when I want to count the resultset the query suddenly runs quite slow. totalRecords = query.Count(); The result of this query is : SELECT COUNT([t5].[DocumentID]) FROM ( SELECT [t4].[DocumentID], [t4].[DocumentFrom], [t4].[DocumentTo] FROM ( SELECT [t0].[DocumentID], [t0].[DocumentFrom], [t0].[DocumentTo FROM [dbo].[Document] AS [t0] INNER JOIN [dbo].[User_UserGroup] AS [t1] ON [t0].[DocumentFrom] = [t1].[User_ID] WHERE ([t1].[UserGroupID] = 2) OR ([t1].[UserGroupID] = 3) OR ([t1].[UserGroupID] = 6) UNION SELECT [t2].[DocumentID], [t2].[DocumentFrom], [t2].[DocumentTo] FROM [dbo].[Document] AS [t2] INNER JOIN [dbo].[User_UserGroup] AS [t3] ON [t2].[DocumentTo] = [t3].[User_ID] WHERE ([t3].[UserGroupID] = 2) OR ([t3].[UserGroupID] = 3) OR ([t3].[UserGroupID] = 6) ) AS [t4] ) AS [t5] Can anyone help me to improve the speed of the count query? Thanks in advance!

    Read the article

  • jQuery image preload/cache halting browser

    - by Nathan Loding
    In short, I have a very large photo gallery and I'm trying to cache as many of the thumbnail images as I can when the first page loads. There could be 1000+ thumbnails. First question -- is it stupid to try to preload/cache that many? Second question -- when the preload() function fires, the entire browser stops responding for a minute to two. At which time the callback fires, so the preload is complete. Is there a way to accomplish "smart preloading" that doesn't impede on the user experience/speed when attempting to load this many objects? The $.preLoadImages function is take from here: http://binarykitten.me.uk/dev/jq-plugins/107-jquery-image-preloader-plus-callbacks.html Here's how I'm implementing it: $(document).ready(function() { setTimeout("preload()", 5000); }); function preload() { var images = ['image1.jpg', ... 'image1000.jpg']; $.preLoadImages(images, function() { alert('done'); }); } 1000 images is a lot. Am I asking too much?

    Read the article

  • Banning by IP with php/mysql

    - by incrediman
    I want to be able to ban users by IP. My idea is to keep a list of IP's as rows in an BannedIPs table (the IP column would be an index). To check users' IP's against the table, I will keep a session variable called $_SESSION['IP'] for each session. If on any request, $_SESSION['IP'] doesn't match $_SERVER['REMOTE_ADDR'], I will update $_SESSION['IP'] and check the BannedIPs table to see if the IP is banned. (A flag will also be saved as a session variable specifying whether or not the user is banned) Here are the things I'm wondering: Does that sound like a good strategy with regards to speed and security (would someone be able to get around the IP ban somehow, other than changing IP's)? What's the best way to structure a mysql query that checks to see if a row exists? That is, what's the best way to query the db to see if a row with a certain IP exists (to check if it's banned)? Should I save the IP's as integers or strings? Note that... I estimate there will be between 1,000-10,000 banned IP's stored in the database. $_SERVER['REMOTE_ADDR'] is the IP from which the current request was sent.

    Read the article

  • Can a GeneralPath be modified?

    - by Dov
    java2d is fairly expressive, but requires constructing lots of objects. In contrast, the older API would let you call methods to draw various shapes, but lacks all the new features like transparency, stroke, etc. Java has fairly high costs associated with object creation. For speed, I would like to create a GeneralPath whose structure does not change, but go in and change the x,y points inside. path = new GeneralPath(GeneralPath.WIND_EVEN_ODD, 10); path.moveTo(x,y); path.lineTo(x2, y2); double len = Math.sqrt((x2-x)*(x2-x) + (y2-y)*(y2-y)); double dx = (x-x2) * headLen / len; double dy = (y-y2) * headLen / len; double dx2 = -dy * (headWidth/headLen); double dy2 = dx * (headWidth/headLen); path.lineTo(x2 + dx + dx2, y2 + dy + dy2); path.moveTo(x2 + dx - dx2, y2 + dy - dy2); path.lineTo(x2,y2); This one isn't even that long. Imagine a much longer sequence of commands, and only the ones on the end are changing. I just want to be able to overwrite commands, to have an iterator effectively. Does that exist?

    Read the article

  • Which persistent & lightweight queue messaging for cross domain (> 2) data exchange with rails integ

    - by Erwan
    Hi all, I'm looking for the right messaging system for my needs. Can you help me ? For now, there won't be a huge amount of data to process, but I don't want to be limited later ... The machines are not just web servers, so the messaging tool should be lightweight, even if processing is not very speed. When some data change on a server, all servers should have the information and process it locally. (should I create one channel per server on each of them ?) The frontend is written on Rails, so it is important, in order to simplify the development, that there is a gem / plugin to manage communications and data sent. At this time : RabbitMQ + workling seems to fit my needs. Could this be a right choice ? ActiveMQ make me afraid, because of Java (I really don't know very well Java, but it seems to me to be big CPU consumer) Others don't seem to be as mature as them. There might be lot of development using this kind of technology, so I can't go to the wrong way ! Thank you for help.

    Read the article

  • Using prepared statements with JDBCTemplate

    - by Bernhard V
    Hi. I'm using the Jdbc template and want to read from the database using prepared statements. I iterate over many lines in a csv file and on every line I execute some sql select queries with it's values. Now I want to speed up my reading from the database but I just can't get the Jdbc template to work with prepared statements. Actually I even don't know how to do it. There is the PreparedStatementCreator and the PreparedStatementCreator. As in this example both of them are created with anonymous inner classes. But inside the PreparedStatementCreator class I don't have access to the values I want to set in the prepared statement. Since I'm iterating through a csv file I can't hard code them as a String because I don't know them. I also can't pass them to the PreparedStatementCreator because there are no arguments for the constructor. I was used to the creation of prepared statements being fairly simple. Something like PreparedStatement updateSales = con.prepareStatement( "UPDATE COFFEES SET SALES = ? WHERE COF_NAME LIKE ? "); updateSales.setInt(1, 75); updateSales.setString(2, "Colombian"); updateSales.executeUpdate(): as in the Java tutorial. Your help would be very appreciated.

    Read the article

  • Serialization Performance and Google Android

    - by Jomanscool2
    I'm looking for advice to speed up serialization performance, specifically when using the Google Android. For a project I am working on, I am trying to relay a couple hundred objects from a server to the Android app, and am going through various stages to get the performance I need. First I tried a terrible XML parser that I hacked together using Scanner specifically for this project, and that caused unbelievably slow performance when loading the objects (~5 minutes for a 300KB file). I then moved away from that and made my classes implement Serializable and wrote the ArrayList of objects I had to a file. Reading that file into the objects the Android, with the file already downloaded mind you, was taking ~15-30 seconds for the ~100KB serialized file. I still find this completely unacceptable for an Android app, as my app requires loading the data when starting the application. I have read briefly about Externalizable and how it can increase performance, but I am not sure as to how one implements it with nested classes. Right now, I am trying to store an ArrayList of the following class, with the nested classes below it. public class MealMenu implements Serializable{ private String commonsName; private long startMillis, endMillis, modMillis; private ArrayList<Venue> venues; private String mealName; } And the Venue class: public class Venue implements Serializable{ private String name; private ArrayList<FoodItem> foodItems; } And the FoodItem class: public class FoodItem implements Serializable{ private String name; private boolean vegan; private boolean vegetarian; } IF Externalizable is the way to go to increase performance, is there any information as to how java calls the methods in the objects when you try to write it out? I am not sure if I need to implement it in the parent class, nor how I would go about serializing the nested objects within each object.

    Read the article

  • JQuery Cycle fails on Page Refresh

    - by Darknight
    In a similar issue as this one: http://stackoverflow.com/questions/1719475/jquery-cycle-firefox-squishing-images I've managed to overcome the initial problem using Jeffs answer in the above link. However now I have noticed a new bug, upon page refresh it simply does not work. I have tried a hard refresh (ctrl+F5) but this does not work. However when you come page to the page it loads fine. here is my modified version (taken from Jeff's): <script type="text/javascript"> $(document).ready(function() { var imagesRemaining = $('#slideshow img').length; $('#slideshow img').bind('load', function(e) { imagesRemaining = imagesRemaining - 1; if (imagesRemaining == 0) { $('#slideshow').show(); $('#slideshow').cycle({ fx: 'shuffle', speed: 1200 }); } }); }); </script> Any ideas? I've also tried JQuery Live but could not implement it correctly. I've also tried Meta tags to force images to load. But it only works first time round.

    Read the article

  • Why is the Clojure Hello World program so slow compared to Java and Python?

    - by viksit
    Hi all, I'm reading "Programming Clojure" and I was comparing some languages I use for some simple code. I noticed that the clojure implementations were the slowest in each case. For instance, Python - hello.py def hello_world(name): print "Hello, %s" % name hello_world("world") and result, $ time python hello.py Hello, world real 0m0.027s user 0m0.013s sys 0m0.014s Java - hello.java import java.io.*; public class hello { public static void hello_world(String name) { System.out.println("Hello, " + name); } public static void main(String[] args) { hello_world("world"); } } and result, $ time java hello Hello, world real 0m0.324s user 0m0.296s sys 0m0.065s and finally, Clojure - hellofun.clj (defn hello-world [username] (println (format "Hello, %s" username))) (hello-world "world") and results, $ time clj hellofun.clj Hello, world real 0m1.418s user 0m1.649s sys 0m0.154s Thats a whole, garangutan 1.4 seconds! Does anyone have pointers on what the cause of this could be? Is Clojure really that slow, or are there JVM tricks et al that need to be used in order to speed up execution? More importantly - isn't this huge difference in performance going to be an issue at some point? (I mean, lets say I was using Clojure for a production system - the gain I get in using lisp seems completely offset by the performance issues I can see here). The machine used here is a 2007 Macbook Pro running Snow Leopard, a 2.16Ghz Intel C2D and 2G DDR2 SDRAM. BTW, the clj script I'm using is from here and looks like, #!/bin/bash JAVA=/System/Library/Frameworks/JavaVM.framework/Versions/1.6/Home/bin/java CLJ_DIR=/opt/jars CLOJURE=$CLJ_DIR/clojure.jar CONTRIB=$CLJ_DIR/clojure-contrib.jar JLINE=$CLJ_DIR/jline-0.9.94.jar CP=$PWD:$CLOJURE:$JLINE:$CONTRIB # Add extra jars as specified by `.clojure` file if [ -f .clojure ] then CP=$CP:`cat .clojure` fi if [ -z "$1" ]; then $JAVA -server -cp $CP \ jline.ConsoleRunner clojure.lang.Repl else scriptname=$1 $JAVA -server -cp $CP clojure.main $scriptname -- $* fi

    Read the article

  • What is the correct way to create dynamic javascript in ASP.net MVC2?

    - by sabbour
    I'm creating a Google Maps partial view/user control in my project that is passed a strongly typed list of objects containing latitude and longitude values. Currently, this is the code I have for the partial: <%@ Control Language="C#" Inherits="System.Web.Mvc.ViewUserControl<IEnumerable<Project.Models.Entities.Location>>" %> <!-- Place for google to put the map --> <div id="report_map_canvas" style="width: 100%; height: 728px; margin-bottom: 2px;"> </div> <script type='text/javascript'> google.load("maps", "2"); $(document).ready(initializeMap); function initializeMap() { if (GBrowserIsCompatible()) { var map = new GMap2(document.getElementById('report_map_canvas')); map.setCenter(new GLatLng(51.5, -0.1167), 2); <% foreach (var item in Model) { %> map.addOverlay(new GMarker(new GLatLng('<%= Html.Encode(item.latitude)%>','<%= Html.Encode(item.longitude)%>'),{ title: '<%= Html.Encode(String.Format("{0:F}",item.speed)) %> km/h '})); <% } %> map.setUIToDefault(); } } </script> Is it right to dynamically create the javascript file this way by looping over the list and emitting javascript? Is there a better way to do it?

    Read the article

  • Direct invocation vs indirect invocation in C

    - by Mohit Deshpande
    I am new to C and I was reading about how pointers "point" to the address of another variable. So I have tried indirect invocation and direct invocation and received the same results (as any C/C++ developer could have predicted). This is what I did: int cost; int *cost_ptr; int main() { cost_ptr = &cost; //assign pointer to cost cost = 100; //intialize cost with a value printf("\nDirect Access: %d", cost); cost = 0; //reset the value *cost_ptr = 100; printf("\nIndirect Access: %d", *cost_ptr); //some code here return 0; //1 } So I am wondering if indirect invocation with pointers has any advantages over direct invocation or vice-versa. Some advantages/disadvantages could include speed, amount of memory consumed performing the operation (most likely the same but I just wanted to put that out there), safeness (like dangling pointers) , good programming practice, etc. 1Funny thing, I am using the GNU C Compiler (gcc) and it still compiles without the return statement and everything is as expected. Maybe because the C++ compiler will automatically insert the return statement if you forget.

    Read the article

  • Is it practical to program with your feet?

    - by bmm
    Has anyone tried using foot pedals in addition to the traditional keyboard and mouse combo to improve your effectiveness in the editor? Any actual experiences out there? Does it work, or is it just for carpal tunnel relief? I found one blog entry from a programmer who actually tried it: So now I can type using my feet for most of the modifier keys. I am using the pedals as I type this. I am still getting used to them, but the burning in my left wrist has definitely reduced. I think I can also type a little faster, but I am too lazy to do the speed tests with and without the pedals to verify this. On the negative side: Working out where to put your feet when you aren’t typing can be a little awkward. The pedals tend to move around the carpet, despite being metal and quite heavy. Some small spikes might have helped. Although the travel on the pedals is small, they are surprisingly stiff. Another programmer's experience: Anybody with hand pain must get foot pedals, since they can remove a tremendous load from your hands. I have two foot pedals, and use one for the SHIFT key, and the other for the CONTROL key. (I still type META by hand.) I have found that in the process of using the Emacs text editor to compose computer programs, I tend to use the SHIFT, CONTROL and META keys constantly, and it is easy to remove most of this load from one's hands. Some foot switch products: Savant Elite Triple Foot Switch FragPedal Bilbo Step On It!

    Read the article

  • Slow Databinding setup time in C# .NET 4.0

    - by Svisstack
    Hello, I have got a problem. I have windows forms application with dynamic generated layout, but i have a problem in performance. In this form i use DataBinding from .NET 4.0 and databinding after setup works fine, but he binding setup time for ONE control blocking my application on approx 0.7 second. I have some controls and time of binging setuping is around 2 minutes. I trying all possible solutions, I dont have any ideas without write self binding class. Why is wrong with my code? case "Boolean": { Binding b = new Binding("Checked", __bindingsource, __ep.Name); CheckBox cb = new CheckBox(); /* * HERE is the problem */ cb.DataBindings.Add(b); /* * HERE is the end of problem */ __flp.Controls.Add(cb); __bindingcontrol.AddBinding(b); break; } Without problem code lines all works fast and without binding ;-( but i want binding turn on in normal speed. PS1. I have suspended layout in generation time. PS2. I have same problem with binding TextBox'es, PictureBoxe's, CheckBox is only example. How to do that?

    Read the article

< Previous Page | 475 476 477 478 479 480 481 482 483 484 485 486  | Next Page >