Search Results

Search found 70655 results on 2827 pages for 'python time'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 479/2827 | < Previous Page | 475 476 477 478 479 480 481 482 483 484 485 486  | Next Page >

  • Prepopulate drop-box according to another drop-box choice in Django Admin

    - by onorua
    I have models like this: class User(models.Model): Switch = models.ForeignKey(Switch, related_name='SwitchUsers') Port = models.ForeignKey(Port) class Switch(models.Model): Name = models.CharField(max_length=50) class Port(models.Model): PortNum = models.PositiveIntegerField() Switch = models.ForeignKey(Switch, related_name = "Ports") When I'm in Admin interface and choose Switch from Switches available, I would like to have Port prepopulated accordingly with Ports from the related Switch. As far as I understand I need to create some JS script to prepopulate it. Unfortunately I don't have this experience, and I would like to keep things simple as it possible and don't rewrite all Django admin interface. Just add this functionality for one Field. Could you please help me with my problem? Thank you.

    Read the article

  • Is django orm & templates thread safe?

    - by Piotr Czapla
    I'm using django orm and templates to create a background service that is ran as management command. Do you know if django is thread safe? I'd like to use threads to speed up processing. The processing is blocked by I/O not CPU so I don't care about performance hit caused by GIL.

    Read the article

  • Testing InlineFormset clean methods

    - by Rory
    I have a Django project, with 2 models, a Structure and Bracket, the Bracket has a ForeignKey to a Structure (i.e. one-to-many, one Structure has many Brackets). I created a TabularInline for the admin site, so that there would be a table of Brackets on the Structure. I added a custom formset with some a custom clean method to do some extra validation, you can't have a Bracket that conflicts with another Bracket on the same Structure etc. The admin looks like this: class BracketInline(admin.TabularInline): model = Bracket formset = BracketInlineFormset class StructureAdmin(admin.ModelAdmin): inlines = [ BracketInline ] admin.site.register(Structure, StructureAdmin) That all works, and the validation works. However now I want to write some unittest to test my complex formset validation logic. My first attempt to validate known-good values is: data = {'form-TOTAL_FORMS': '1', 'form-INITIAL_FORMS': '0', 'form-MAX_NUM_FORMS': '', 'form-0-field1':'good-value', … } formset = BracketInlineFormset(data) self.assertTrue(formset.is_valid()) However that doesn't work and raises the exception: ====================================================================== ERROR: testValid (appname.tests.StructureTestCase) ---------------------------------------------------------------------- Traceback (most recent call last): File "/paht/to/project/tests.py", line 494, in testValid formset = BracketInlineFormset(data) File "/path/to/django/forms/models.py", line 672, in __init__ self.instance = self.fk.rel.to() AttributeError: 'BracketInlineFormset' object has no attribute 'fk' ---------------------------------------------------------------------- The Django documentation (for formset validation) implies one can do this. How come this isn't working? How do I test the custom clean()/validation for my inline formset?

    Read the article

  • Django and mod_python intermittent error?

    - by Peter
    I have a Django site at http://sm.rutgers.edu/relive/af_api/index/. It is supposed to display "Home of the relive APIs". If you refresh this page many times, you can see different renderings. 1) The expected page. 2) Django "It worked!" page. 3) "ImportError at /index/" page. If you scroll down enough to ROOT_URLCONF part, you will see it says 'relive.urls'. But apparently, it should be 'af_api.urls', which is in my settings.py file. Since these results happen randomly, is it possible that either Django or mod_python is working unstably?

    Read the article

  • Algorithm for non-contiguous netmask match

    - by Gianluca
    Hi, I have to write a really really fast algorithm to match an IP address to a list of groups, where each group is defined using a notation like 192.168.0.0/252.255.0.255. As you can see, the bitmask can contain zeros even in the middle, so the traditional "longest prefix match" algorithms won't work. If an IP matches two groups, it will be assigned to the group containing most 1's in the netmask. I'm not working with many entries (let's say < 1000) and I don't want to use a data structure requiring a large memory footprint (let's say 1-2 MB), but it really has to be fast (of course I can't afford a linear search). Do you have any suggestion? Thanks guys. UPDATE: I found something quite interesting at http://www.cse.usf.edu/~ligatti/papers/grouper-conf.pdf, but it's still too memory-hungry for my utopic use case

    Read the article

  • Encoding with url and api

    - by user2950824
    So I have this web app set up and running and it works fine for any username that you request, but when i try http://mrcastelo.pythonanywhere.com/lol/euw/Nazaré, it simply doesnt work - the error that I get on the server is the following: iddata= getJSON(urllolbase+region+urlid+username) #SummonerID UnicodeDecodeError: 'ascii' codec can't decode byte 0xc3 in position 5: ordinal not in range(128) It is annoying me greatly, I've tried some other threads but none of them came to a fix. The api that I am using (www.legendaryapi.com) does accept this because this works. Any idea on how to fix this?

    Read the article

  • SUDS rendering a duplicate node and wrapping everything in it

    - by PylonsN00b
    Here is my code: #Make the SOAP connection url = "https://api.channeladvisor.com/ChannelAdvisorAPI/v1/InventoryService.asmx?WSDL" headers = {'Content-Type': 'text/xml; charset=utf-8'} ca_client_inventory = Client(url, location="https://api.channeladvisor.com/ChannelAdvisorAPI/v1/InventoryService.asmx", headers=headers) #Make the SOAP headers login = ca_client_inventory.factory.create('APICredentials') login.DeveloperKey = 'REMOVED' login.Password = 'REMOVED' #Attach the headers ca_client_inventory.set_options(soapheaders=login) synch_inventory_item_list = ca_client_inventory.factory.create('SynchInventoryItemList') synch_inventory_item_list.accountID = "REMOVED" array_of_inventory_item_submit = ca_client_inventory.factory.create('ArrayOfInventoryItemSubmit') for product in products: inventory_item_submit = ca_client_inventory.factory.create('InventoryItemSubmit') inventory_item_list = get_item_list(product) inventory_item_submit = [inventory_item_list] array_of_inventory_item_submit.InventoryItemSubmit.append(inventory_item_submit) synch_inventory_item_list.itemList = array_of_inventory_item_submit #Call that service baby! ca_client_inventory.service.SynchInventoryItemList(synch_inventory_item_list) Here is what it outputs: <?xml version="1.0" encoding="UTF-8"?> <SOAP-ENV:Envelope xmlns:ns0="http://api.channeladvisor.com/webservices/" xmlns:ns1="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:tns="http://api.channeladvisor.com/webservices/" xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/"> <SOAP-ENV:Header> <tns:APICredentials> <tns:DeveloperKey>REMOVED</tns:DeveloperKey> <tns:Password>REMOVED</tns:Password> </tns:APICredentials> </SOAP-ENV:Header> <ns1:Body> <ns0:SynchInventoryItemList> <ns0:accountID> <ns0:accountID>REMOVED</ns0:accountID> <ns0:itemList> <ns0:InventoryItemSubmit> <ns0:Sku>1872</ns0:Sku> <ns0:Title>The Big Book Of Crazy Quilt Stitches</ns0:Title> <ns0:Subtitle></ns0:Subtitle> <ns0:Description>Embellish the seams and patches of crazy quilt projects with over 75 embroidery stitches and floral motifs. You&apos;ll use this handy reference book again and again to dress up wall hangings, pillows, sachets, clothing, and other nostalgic creations.</ns0:Description> <ns0:Weight>4</ns0:Weight> <ns0:FlagStyle/> <ns0:IsBlocked xsi:nil="true"/> <ns0:ISBN></ns0:ISBN> <ns0:UPC>028906018721</ns0:UPC> <ns0:EAN></ns0:EAN> <ns0:QuantityInfo> <ns0:UpdateType>UnShipped</ns0:UpdateType> <ns0:Total>0</ns0:Total> </ns0:QuantityInfo> <ns0:PriceInfo> <ns0:Cost>0.575</ns0:Cost> <ns0:RetailPrice xsi:nil="true"/> <ns0:StartingPrice xsi:nil="true"/> <ns0:ReservePrice xsi:nil="true"/> <ns0:TakeItPrice>6.95</ns0:TakeItPrice> <ns0:SecondChanceOfferPrice xsi:nil="true"/> <ns0:StorePrice>6.95</ns0:StorePrice> </ns0:PriceInfo> <ns0:ClassificationInfo> <ns0:Name>Books</ns0:Name> <ns0:AttributeList> <ns0:ClassificationAttributeInfo> <ns0:Name>Designer/Author</ns0:Name> <ns0:Value>Patricia Eaton</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Trim Size</ns0:Name> <ns0:Value></ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Binding</ns0:Name> <ns0:Value>Leaflet</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Release Date</ns0:Name> <ns0:Value>11/1/1999 0:00:00</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Skill Level</ns0:Name> <ns0:Value></ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Pages</ns0:Name> <ns0:Value>20</ns0:Value> </ns0:ClassificationAttributeInfo> <ns0:ClassificationAttributeInfo> <ns0:Name>Projects</ns0:Name> <ns0:Value></ns0:Value> </ns0:ClassificationAttributeInfo> </ns0:AttributeList> </ns0:ClassificationInfo> <ns0:ImageList> <ns0:ImageInfoSubmit> <ns0:PlacementName>ITEMIMAGEURL1</ns0:PlacementName> <ns0:FilenameOrUrl>1872.jpg</ns0:FilenameOrUrl> </ns0:ImageInfoSubmit> </ns0:ImageList> </ns0:InventoryItemSubmit> </ns0:itemList> </ns0:accountID> </ns0:SynchInventoryItemList> </ns1:Body> </SOAP-ENV:Envelope> See how it creates the accountID node twice and wraps the whole thing in it? WHY? How do I make it stop that?!

    Read the article

  • Is multi-level polymorphism possible in SQLAlchemy?

    - by Jace
    Is it possible to have multi-level polymorphism in SQLAlchemy? Here's an example: class Entity(Base): __tablename__ = 'entities' id = Column(Integer, primary_key=True) created_at = Column(DateTime, default=datetime.utcnow, nullable=False) entity_type = Column(Unicode(20), nullable=False) __mapper_args__ = {'polymorphic_on': entity_type} class File(Entity): __tablename__ = 'files' id = Column(None, ForeignKey('entities.id'), primary_key=True) filepath = Column(Unicode(255), nullable=False) file_type = Column(Unicode(20), nullable=False) __mapper_args__ = {'polymorphic_identity': u'file', 'polymorphic_on': file_type) class Image(File): __mapper_args__ = {'polymorphic_identity': u'image'} __tablename__ = 'images' id = Column(None, ForeignKey('files.id'), primary_key=True) width = Column(Integer) height = Column(Integer) When I call Base.metadata.create_all(), SQLAlchemy raises the following error: NotImplementedError: Can't generate DDL for the null type IntegrityError: (IntegrityError) entities.entity_type may not be NULL. This error goes away if I remove the Image model and the polymorphic_on key in File. What gives? (Edited: the exception raised was wrong.)

    Read the article

  • How to write data by dynamic parameter name

    - by Maxim Welikobratov
    I need to be able to write data to datastore of google-app-engine for some known entity. But I don't want write assignment code for each parameter of the entity. I meen, I don't want do like this val_1 = self.request.get('prop_1') val_2 = self.request.get('prop_2') ... val_N = self.request.get('prop_N') item.prop_1 = val_1 item.prop_2 = val_2 ... item.prop_N = val_N item.put() instead, I want to do something like this args = self.request.arguments() for prop_name in args: item.set(prop_name, self.request.get(prop_name)) item.put() dose anybody know how to do this trick?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • django test client trouble

    - by Anton Koval'
    I've got a problem... we're writing project using django, and i'm trying to use django.test.client with nose test-framework for tests. Our code is like this: from simplejson import loads from urlparse import urljoin from django.test.client import Client TEST_URL = "http://smakly.localhost:9090/" def test_register(): cln = Client() ref_data = {"email": "[email protected]", "name": "???????", "website": "http://hot.bear.com", "xhr": "true"} print urljoin(TEST_URL, "/accounts/register/") response = loads(cln.post(urljoin(TEST_URL, "/accounts/register/"), ref_data)) print response["message"] and in nose output I catch: Traceback (most recent call last): File "/home/psih/work/svn/smakly/eggs/nose-0.11.1-py2.6.egg/nose/case.py", line 183, in runTest self.test(*self.arg) File "/home/psih/work/svn/smakly/src/smakly.tests/smakly/tests/frontend/test_profile.py", line 25, in test_register response = loads(cln.post(urljoin(TEST_URL, "/accounts/register/"), ref_data)) File "/home/psih/work/svn/smakly/parts/django/django/test/client.py", line 313, in post response = self.request(**r) File "/home/psih/work/svn/smakly/parts/django/django/test/client.py", line 225, in request response = self.handler(environ) File "/home/psih/work/svn/smakly/parts/django/django/test/client.py", line 69, in __call__ response = self.get_response(request) File "/home/psih/work/svn/smakly/parts/django/django/core/handlers/base.py", line 78, in get_response urlconf = getattr(request, "urlconf", settings.ROOT_URLCONF) File "/home/psih/work/svn/smakly/parts/django/django/utils/functional.py", line 273, in __getattr__ return getattr(self._wrapped, name) AttributeError: 'Settings' object has no attribute 'ROOT_URLCONF' My settings.py file does have this attribute. If I get the data from the server with standard urllib2.urllopen().read() it works in the proper way. Any ideas how I can solve this case?

    Read the article

  • Problem with anchor tags in Django after using lighttpd + fastcgi

    - by Drew A
    I just started using lighttpd and fastcgi for my django site, but I've noticed my anchor links are no longer working. I used the anchor links for sorting links on the page, for example I use an anchor to sort links by the number of points (or votes) they have received. For example: the code in the html template: ... {% load sorting_tags %} ... {% ifequal sort_order "points" %} {% trans "total points" %} {% trans "or" %} {% anchor "date" "date posted" %} {% order_by_votes links request.direction %} {% else %} {% anchor "points" "total points" %} {% trans "or" %} {% trans "date posted" %} ... The anchor link on "www.mysite.com/my_app/" for total points will be directed to "my_app/?sort=points" But the correct URL should be "www.mysite.com/my_app/?sort=points" All my other links work, the problem is specific to anchor links. The {% anchor %} tag is taken from django-sorting, the code can be found at http://github.com/directeur/django-sorting Specifically in django-sorting/templatetags/sorting_tags.py Thanks in advance.

    Read the article

  • How can I handle dynamic calculated attributes in a model in Django?

    - by bullfish
    In Django I calculate the breadcrumb (a list of fathers) for an geographical object. Since it is not going to change very often, I am thinking of pre calculating it once the object is saved or initialized. 1.) What would be better? Which solution would have a better performance? To calculate it at _init_ or to calculate it when the object is saved (the object takes about 500-2000 characters in the DB)? 2.) I tried to overwrite the _init_ or save() methods but I don't know how to use attributes of the just saved object. Accessing *args, **kwargs did not work. How can I access them? Do I have to save, access the father and then save again? 3.) If I decide to save the breadcrumb. Whats the best way to do it? I used http://www.djangosnippets.org/snippets/1694/ and have crumb = PickledObjectField(). Thats the method to calculate the attribute crumb() def _breadcrumb(self): breadcrumb = [ ] x = self while True: x = x.father try: if hasattr(x, 'country'): breadcrumb.append(x.country) elif hasattr(x, 'region'): breadcrumb.append(x.region) elif hasattr(x, 'city'): breadcrumb.append(x.city) else: break except: break breadcrumb.reverse() return breadcrumb Thats my save-Method: def save(self,*args, **kwargs): # how can I access the father ob the object? father = self.father # does obviously not work father = kwargs['father'] # does not work either # the breadcrumb gets calculated here self.crumb = self._breadcrumb(father) super(GeoObject, self).save(*args,**kwargs) Please help me out. I am working on this for days now. Thank you.

    Read the article

  • Creating a new plugin for mpld3

    - by sjp14051
    Toward learning how to create a new mpld3 plugin, I took an existing example, LinkedDataPlugin (http://mpld3.github.io/examples/heart_path.html), and modified it slightly by deleting references to lines object. That is, I created the following: class DragPlugin(plugins.PluginBase): JAVASCRIPT = r""" mpld3.register_plugin("drag", DragPlugin); DragPlugin.prototype = Object.create(mpld3.Plugin.prototype); DragPlugin.prototype.constructor = DragPlugin; DragPlugin.prototype.requiredProps = ["idpts", "idpatch"]; DragPlugin.prototype.defaultProps = {} function DragPlugin(fig, props){ mpld3.Plugin.call(this, fig, props); }; DragPlugin.prototype.draw = function(){ var patchobj = mpld3.get_element(this.props.idpatch, this.fig); var ptsobj = mpld3.get_element(this.props.idpts, this.fig); var drag = d3.behavior.drag() .origin(function(d) { return {x:ptsobj.ax.x(d[0]), y:ptsobj.ax.y(d[1])}; }) .on("dragstart", dragstarted) .on("drag", dragged) .on("dragend", dragended); patchobj.path.attr("d", patchobj.datafunc(ptsobj.offsets, patchobj.pathcodes)); patchobj.data = ptsobj.offsets; ptsobj.elements() .data(ptsobj.offsets) .style("cursor", "default") .call(drag); function dragstarted(d) { d3.event.sourceEvent.stopPropagation(); d3.select(this).classed("dragging", true); } function dragged(d, i) { d[0] = ptsobj.ax.x.invert(d3.event.x); d[1] = ptsobj.ax.y.invert(d3.event.y); d3.select(this) .attr("transform", "translate(" + [d3.event.x,d3.event.y] + ")"); patchobj.path.attr("d", patchobj.datafunc(ptsobj.offsets, patchobj.pathcodes)); } function dragended(d, i) { d3.select(this).classed("dragging", false); } } mpld3.register_plugin("drag", DragPlugin); """ def __init__(self, points, patch): print "Points ID : ", utils.get_id(points) self.dict_ = {"type": "drag", "idpts": utils.get_id(points), "idpatch": utils.get_id(patch)} However, when I try to link the plugin to a figure, as in plugins.connect(fig, DragPlugin(points[0], patch)) I get an error, 'module' is not callable, pointing to this line. What does this mean and why doesn't it work? Thanks. I'm adding additional code to show that linking more than one Plugin might be problematic. But this may be entirely due to some silly mistake on my part, or there is a way around it. The following code based on LinkedViewPlugin generates three panels, in which the top and the bottom panel are supposed to be identical. Mouseover in the middle panel was expected to control the display in the top and bottom panels, but updates occur in the bottom panel only. It would be nice to be able to figure out how to reflect the changes in multiple panels. Thanks. import matplotlib import matplotlib.pyplot as plt import numpy as np import mpld3 from mpld3 import plugins, utils class LinkedView(plugins.PluginBase): """A simple plugin showing how multiple axes can be linked""" JAVASCRIPT = """ mpld3.register_plugin("linkedview", LinkedViewPlugin); LinkedViewPlugin.prototype = Object.create(mpld3.Plugin.prototype); LinkedViewPlugin.prototype.constructor = LinkedViewPlugin; LinkedViewPlugin.prototype.requiredProps = ["idpts", "idline", "data"]; LinkedViewPlugin.prototype.defaultProps = {} function LinkedViewPlugin(fig, props){ mpld3.Plugin.call(this, fig, props); }; LinkedViewPlugin.prototype.draw = function(){ var pts = mpld3.get_element(this.props.idpts); var line = mpld3.get_element(this.props.idline); var data = this.props.data; function mouseover(d, i){ line.data = data[i]; line.elements().transition() .attr("d", line.datafunc(line.data)) .style("stroke", this.style.fill); } pts.elements().on("mouseover", mouseover); }; """ def __init__(self, points, line, linedata): if isinstance(points, matplotlib.lines.Line2D): suffix = "pts" else: suffix = None self.dict_ = {"type": "linkedview", "idpts": utils.get_id(points, suffix), "idline": utils.get_id(line), "data": linedata} class LinkedView2(plugins.PluginBase): """A simple plugin showing how multiple axes can be linked""" JAVASCRIPT = """ mpld3.register_plugin("linkedview", LinkedViewPlugin2); LinkedViewPlugin2.prototype = Object.create(mpld3.Plugin.prototype); LinkedViewPlugin2.prototype.constructor = LinkedViewPlugin2; LinkedViewPlugin2.prototype.requiredProps = ["idpts", "idline", "data"]; LinkedViewPlugin2.prototype.defaultProps = {} function LinkedViewPlugin2(fig, props){ mpld3.Plugin.call(this, fig, props); }; LinkedViewPlugin2.prototype.draw = function(){ var pts = mpld3.get_element(this.props.idpts); var line = mpld3.get_element(this.props.idline); var data = this.props.data; function mouseover(d, i){ line.data = data[i]; line.elements().transition() .attr("d", line.datafunc(line.data)) .style("stroke", this.style.fill); } pts.elements().on("mouseover", mouseover); }; """ def __init__(self, points, line, linedata): if isinstance(points, matplotlib.lines.Line2D): suffix = "pts" else: suffix = None self.dict_ = {"type": "linkedview", "idpts": utils.get_id(points, suffix), "idline": utils.get_id(line), "data": linedata} fig, ax = plt.subplots(3) # scatter periods and amplitudes np.random.seed(0) P = 0.2 + np.random.random(size=20) A = np.random.random(size=20) x = np.linspace(0, 10, 100) data = np.array([[x, Ai * np.sin(x / Pi)] for (Ai, Pi) in zip(A, P)]) points = ax[1].scatter(P, A, c=P + A, s=200, alpha=0.5) ax[1].set_xlabel('Period') ax[1].set_ylabel('Amplitude') # create the line object lines = ax[0].plot(x, 0 * x, '-w', lw=3, alpha=0.5) ax[0].set_ylim(-1, 1) ax[0].set_title("Hover over points to see lines") linedata = data.transpose(0, 2, 1).tolist() plugins.connect(fig, LinkedView(points, lines[0], linedata)) # second set of lines exactly the same but in a different panel lines2 = ax[2].plot(x, 0 * x, '-w', lw=3, alpha=0.5) ax[2].set_ylim(-1, 1) ax[2].set_title("Hover over points to see lines #2") plugins.connect(fig, LinkedView2(points, lines2[0], linedata)) mpld3.show()

    Read the article

  • How to inject a key string to andoid device through ADB?

    - by Nandi
    Hi, Can somebody help me for the following. I want to select a perticular string in the list displayed in android phone. If i take example of phone book. i want to pass a person name to the device using adb interface and that name should get highlighted in the list. I tried all adb commands for this but could pass string and key events to the screen but not able to select the respective string. please help. Thanks in advance.

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Trying to output a list using class

    - by captain morgan
    Am trying to get the moving average of a price..but i keep getting an attribute error in my Moving_Average class. ('Moving_Average' object has no attribute 'days'). Here is what I have: class Moving_Average: def calculation(self, alist:list,days:int): m = self.days prices = alist[1::2] average = [0]* len(prices) signal = ['']* len(prices) for m in range(0,len(prices)-days+1): average[m+2] = sum(prices[m:m+days])/days if prices[m+2] < average[m+2]: signal[m+2]='SELL' elif prices[m+2] > average[m+2] and prices[m+1] < average[m+1]: signal[m+2]='BUY' else: signal[m+2] ='' return average,signal def print_report(symbol:str,strategy:str): print('SYMBOL: ', symbol) print('STRATEGY: ', strategy) print('Date Closing Strategy Signal') def user(): strategy = ''' Which of the following strategy would you like to use? * Simple Moving Average [S] * Directional Indicator[D] Please enter your choice: ''' if signal_strategy in 'Ss': days = input('Please enter the number of days for the average') days = int(days) strategy = 'Simple Moving Average {}-days'.format(str(days)) m = Moving_Average() ma = m.calculation(gg, days) print(ma) gg is an list that contains date and prices. [2013-10-01,60,2013-10-02,60] The output is supposed to look like: Date Price Average Signal 2013-10-01 60.0 2013-10-02 60.0 60.00 BUY

    Read the article

  • Matplotlib autodatelocator custom date formatting?

    - by jawonlee
    I'm using Matplotlib to dynamically generate .png charts from a database. The user may set as the x-axis any given range of datetimes, and I need to account for all of it. While Matplotlib has the dates.AutoDateLocator(), I want the datetime format printed on the chart to be context-specific - e.g. if the user is charting from 3 p.m. to 5 p.m., the year/month/day information doesn't need to be displayed. Right now, I'm manually creating Locator and Formatter objects thusly: def get_ticks(start, end): from datetime import timedelta as td delta = end - start if delta <= td(minutes=10): loc = mdates.MinuteLocator() fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(minutes=30): loc = mdates.MinuteLocator(byminute=range(0,60,5)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(hours=1): loc = mdates.MinuteLocator(byminute=range(0,60,15)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(hours=6): loc = mdates.HourLocator() fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(days=1): loc = mdates.HourLocator(byhour=range(0,24,3)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(days=3): loc = mdates.HourLocator(byhour=range(0,24,6)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(weeks=2): loc = mdates.DayLocator() fmt = mdates.DateFormatter('%b %d') elif delta <= td(weeks=12): loc = mdates.WeekdayLocator() fmt = mdates.DateFormatter('%b %d') elif delta <= td(weeks=52): loc = mdates.MonthLocator() fmt = mdates.DateFormatter('%b') else: loc = mdates.MonthLocator(interval=3) fmt = mdates.DateFormatter('%b %Y') return loc,fmt Is there a better way of doing this?

    Read the article

  • How to make Universal Feed Parser only parse feeds?

    - by piquadrat
    I'm trying to get content from external feeds on my Django web site with Universal Feed Parser. I want to have some user error handling, e.g. if the user supplies a URL that is not a feed. When I tried how feedparser responds to faulty input, I was surprised to see that feedparser does not throw any Exceptions at all. E.g. on HTML content, it tries to parse some information from the HTML code, and on non-existing domains, it returns a mostly empty dictionary: {'bozo': 1, 'bozo_exception': URLError(gaierror(-2, 'Name or service not known'),), 'encoding': 'utf-8', 'entries': [], 'feed': {}, 'version': None} Other faulty input manifest themselves in the status_code or the namespaces values in the returned dictionary. So, what's the best approach to have sane error checking without resorting to an endless cascade of if .. elif .. elif ...?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 475 476 477 478 479 480 481 482 483 484 485 486  | Next Page >