Search Results

Search found 1783 results on 72 pages for 'computation theory'.

Page 48/72 | < Previous Page | 44 45 46 47 48 49 50 51 52 53 54 55  | Next Page >

  • Problem with Boost::Asio for C++

    - by Martin Lauridsen
    Hi there, For my bachelors thesis, I am implementing a distributed version of an algorithm for factoring large integers (finding the prime factorisation). This has applications in e.g. security of the RSA cryptosystem. My vision is, that clients (linux or windows) will download an application and compute some numbers (these are independant, thus suited for parallelization). The numbers (not found very often), will be sent to a master server, to collect these numbers. Once enough numbers have been collected by the master server, it will do the rest of the computation, which cannot be easily parallelized. Anyhow, to the technicalities. I was thinking to use Boost::Asio to do a socket client/server implementation, for the clients communication with the master server. Since I want to compile for both linux and windows, I thought windows would be as good a place to start as any. So I downloaded the Boost library and compiled it, as it said on the Boost Getting Started page: bootstrap .\bjam It all compiled just fine. Then I try to compile one of the tutorial examples, client.cpp, from Asio, found (here.. edit: cant post link because of restrictions). I am using the Visual C++ compiler from Microsoft Visual Studio 2008, like this: cl /EHsc /I D:\Downloads\boost_1_42_0 client.cpp But I get this error: /out:client.exe client.obj LINK : fatal error LNK1104: cannot open file 'libboost_system-vc90-mt-s-1_42.lib' Anyone have any idea what could be wrong, or how I could move forward? I have been trying pretty much all week, to get a simple client/server socket program for c++ working, but with no luck. Serious frustration kicking in. Thank you in advance.

    Read the article

  • Pump Messages During Long Operations + C#

    - by Newbie
    Hi I have a web service that is doing huge computation and is taking more than a minute. I have generated the proxy file of the web service and then from my client end I am using the dll(of course I generated the proxy dll). My client side code is TimeSeries3D t = new TimeSeries3D(); int portfolioId = 4387919; string[] str = new string[2]; str[0] = "MKT_CAP"; DateRange dr = new DateRange(); dr.mStartDate = DateTime.Today; dr.mEndDate = DateTime.Today; Service1 sc = new Service1(); t = sc.GetAttributesForPortfolio(portfolioId, true, str, dr); But since it is taking to much time for the server to compute, after 1 minute I am receiving an error message The CLR has been unable to transition from COM context 0x33caf30 to COM context 0x33cb0a0 for 60 seconds. The thread that owns the destination context/apartment is most likely either doing a non pumping wait or processing a very long running operation without pumping Windows messages. This situation generally has a negative performance impact and may even lead to the application becoming non responsive or memory usage accumulating continually over time. To avoid this problem, all single threaded apartment (STA) threads should use pumping wait primitives (such as CoWaitForMultipleHandles) and routinely pump messages during long running operations. Kindly guide me what to do? Thanks

    Read the article

  • Thread-safety of read-only memory access

    - by Edmund
    I've implemented the Barnes-Hut gravity algorithm in C as follows: Build a tree of clustered stars. For each star, traverse the tree and apply the gravitational forces from each applicable node. Update the star velocities and positions. Stage 2 is the most expensive stage, and so is implemented in parallel by dividing the set of stars. E.g. with 1000 stars and 2 threads, I have one thread processing the first 500 stars and the second thread processing the second 500. In practice this works: it speeds the computation by about 30% with two threads on a two-core machine, compared to the non-threaded version. Additionally, it yields the same numerical results as the original non-threaded version. My concern is that the two threads are accessing the same resource (namely, the tree) simultaneously. I have not added any synchronisation to the thread workers, so it's likely they will attempt to read from the same location at some point. Although access to the tree is strictly read-only I am not 100% sure it's safe. It has worked when I've tested it but I know this is no guarantee of correctness! Questions Do I need to make a private copy of the tree for each thread? Even if it is safe, are there performance problems of accessing the same memory from multiple threads?

    Read the article

  • Which OpenGL functions are not GPU-accelerated?

    - by Xavier Ho
    I was shocked when I read this (from the OpenGL wiki): glTranslate, glRotate, glScale Are these hardware accelerated? No, there are no known GPUs that execute this. The driver computes the matrix on the CPU and uploads it to the GPU. All the other matrix operations are done on the CPU as well : glPushMatrix, glPopMatrix, glLoadIdentity, glFrustum, glOrtho. This is the reason why these functions are considered deprecated in GL 3.0. You should have your own math library, build your own matrix, upload your matrix to the shader. For a very, very long time I thought most of the OpenGL functions use the GPU to do computation. I'm not sure if this is a common misconception, but after a while of thinking, this makes sense. Old OpenGL functions (2.x and older) are really not suitable for real-world applications, due to too many state switches. This makes me realise that, possibly, many OpenGL functions do not use the GPU at all. So, the question is: Which OpenGL function calls don't use the GPU? I believe knowing the answer to the above question would help me become a better programmer with OpenGL. Please do share some of your insights.

    Read the article

  • Numerical calculations in Prolog

    - by user8472
    While reading SICP I came across logic programming chapter 4.4. Then I started looking into the Prolog programming language and tried to understand some simple assignments in Prolog. I found that Prolog seems to have troubles with numerical calculations. Here is the computation of a factorial in standard Prolog: f(0, 1). f(A, B) :- A > 0, C is A-1, f(C, D), B is A*D. The issues I find is that I need to introduce two auxiliary variables (C and D), a new syntax (is) and that the problem is non-reversible (i.e., f(5,X) works as expected, but f(X,120) does not). Naively, I expect that at the very least C is A-1, f(C, D) above may be replaced by f(A-1,D), but even that does not work. My question is: Why do I need to do this extra "stuff" in numerical calculations but not in other queries? I do understand (and SICP is quite clear about it) that in general information on "what to do" is insufficient to answer the question of "how to do it". So the declarative knowledge in (at least some) math problems is insufficient to actually solve these problems. But that begs the next question: How does this extra "stuff" in Prolog help me to restrict the formulation to just those problems where "what to do" is sufficient to answer "how to do it"?

    Read the article

  • web service slowdown

    - by user238591
    Hi, I have a web service slowdown. My (web) service is in gsoap & managed C++. It's not IIS/apache hosted, but speaks xml. My client is in .NET The service computation time is light (<0.1s to prepare reply). I expect the service to be smooth, fast and have good availability. I have about 100 clients, response time is 1s mandatory. Clients have about 1 request per minute. Clients are checking web service presence by tcp open port test. So, to avoid possible congestion, I turned gSoap KeepAlive to false. Until there everything runs fine : I bearly see connections in TCPView (sysinternals) New special synchronisation program now calls the service in a loop. It's higher load but everything is processed in less 30 seconds. With sysinternals TCPView, I see that about 1 thousands connections are in TIME_WAIT. They slowdown the service and It takes seconds for the service to reply, now. Could it be that I need to reset the SoapHttpClientProtocol connection ? Someone has TIME_WAIT ghosts with a web service call in a loop ?

    Read the article

  • Longer execution through Java shell than console?

    - by czuk
    I have a script in Python which do some computations. When I run this script in console it takes about 7 minutes to complete but when I run it thought Java shell it takes three times longer. I use following code to execute the script in Java: this.p = Runtime.getRuntime().exec("script.py --batch", envp); this.input = new BufferedReader(new InputStreamReader(p.getInputStream())); this.output = new BufferedWriter(new OutputStreamWriter(p.getOutputStream())); this.error = new BufferedReader(new InputStreamReader(p.getErrorStream())); Do you have any suggestion why the Python script runs three time longer in Java than in a console? update The computation goes as follow: Java sends data to the Python. Python reads the data. Python generates a decision tree --- this is a long operation. Python sends a confirmation that the tree is ready. Java receives the confirmation. Later there is a series of communications between Java and Python but it takes only several second.

    Read the article

  • What OpenGL functions are not GPU accelerated?

    - by Xavier Ho
    I was shocked when I read this (from the OpenGL wiki): glTranslate, glRotate, glScale Are these hardware accelerated? No, there are no known GPUs that execute this. The driver computes the matrix on the CPU and uploads it to the GPU. All the other matrix operations are done on the CPU as well : glPushMatrix, glPopMatrix, glLoadIdentity, glFrustum, glOrtho. This is the reason why these functions are considered deprecated in GL 3.0. You should have your own math library, build your own matrix, upload your matrix to the shader. For a very, very long time I thought most of the OpenGL functions use the GPU to do computation. I'm not sure if this is a common misconception, but after a while of thinking, this makes sense. Old OpenGL functions (2.x and older) are really not suitable for real-world applications, due to too many state switches. This makes me realise that, possibly, many OpenGL functions do not use the GPU at all. So, the question is: Which OpenGL function calls don't use the GPU? I believe knowing the answer to the above question would help me become a better programmer with OpenGL. Please do share some of your insights.

    Read the article

  • Java: fastest way to do random reads on huge disk file(s)

    - by cocotwo
    I've got a moderately big set of data, about 800 MB or so, that is basically some big precomputed table that I need to speed some computation by several orders of magnitude (creating that file took several mutlicores computers days to produce using an optimized and multi-threaded algo... I do really need that file). Now that it has been computed once, that 800MB of data is read only. I cannot hold it in memory. As of now it is one big huge 800MB file but splitting in into smaller files ain't a problem if it can help. I need to read about 32 bits of data here and there in that file a lot of time. I don't know before hand where I'll need to read these data: the reads are uniformly distributed. What would be the fastest way in Java to do my random reads in such a file or files? Ideally I should be doing these reads from several unrelated threads (but I could queue the reads in a single thread if needed). Is Java NIO the way to go? I'm not familiar with 'memory mapped file': I think I don't want to map the 800 MB in memory. All I want is the fastest random reads I can get to access these 800MB of disk-based data. btw in case people wonder this is not at all the same as the question I asked not long ago: http://stackoverflow.com/questions/2346722/java-fast-disk-based-hash-set

    Read the article

  • Template trick to optimize out allocations

    - by anon
    I have: struct DoubleVec { std::vector<double> data; }; DoubleVec operator+(const DoubleVec& lhs, const DoubleVec& rhs) { DoubleVec ans(lhs.size()); for(int i = 0; i < lhs.size(); ++i) { ans[i] = lhs[i]] + rhs[i]; // assume lhs.size() == rhs.size() } return ans; } DoubleVec someFunc(DoubleVec a, DoubleVec b, DoubleVec c, DoubleVec d) { DoubleVec ans = a + b + c + d; } Now, in the above, the "a + b + c + d" will cause the creation of 3 temporary DoubleVec's -- is there a way to optimize this away with some type of template magic ... i.e. to optimize it down to something equivalent to: DoubleVec ans(a.size()); for(int i = 0; i < ans.size(); i++) ans[i] = a[i] + b[i] + c[i] + d[i]; You can assume all DoubleVec's have the same # of elements. The high level idea is to have do some type of templateied magic on "+", which "delays the computation" until the =, at which point it looks into itself, goes hmm ... I'm just adding thes numbers, and syntheizes a[i] + b[i] + c[i] + d[i] ... instead of all the temporaries. Thanks!

    Read the article

  • Instrumenting a string

    - by George Polevoy
    Somewhere in C++ era i have crafted a library, which enabled string representation of the computation history. Having a math expression like: TScalar Compute(TScalar a, TScalar b, TScalar c) { return ( a + b ) * c; } I could render it's string representation: r = Compute(VerbalScalar("a", 1), VerbalScalar("b", 2), VerbalScalar("c", 3)); Assert.AreEqual(9, r.Value); Assert.AreEqual("(a+b)*c==(1+2)*3", r.History ); C++ operator overloading allowed for substitution of a simple type with a complex self-tracking entity with an internal tree representation of everything happening with the objects. Now i would like to have the same possibility for NET strings, only instead of variable names i would like to see a stack traces of all the places in code which affected a string. And i want it to work with existing code, and existing compiled assemblies. Also i want all this to hook into visual studio debugger, so i could set a breakpoint, and see everything that happened with a string. Which technology would allow this kind of things? I know it sound like an utopia, but I think visual studio code coverage tools actually do the same kind of job while instrumenting the assemblies.

    Read the article

  • Can redirection of screen output to file change the result of a C++ code?

    - by Biga
    I am having this very weird behaviour with a C++ code: It gives me different results when running with and without redirecting the screen output to a file (reproducible in cygwin and linux). I mean, if I get the same executable and run it like ./run or run it like ./run >out.log, I get different results! I use std::cout to output to screen, all lines ending with endl; I use ifstream for the input file; I use ofstream for output, all lines ending with endl. I am using g++ 4. Any idea what is going on? UPDATE: I have hard-coded the input data, so 'ifstream' is not used, and problem persists. UPDATE 2: That's getting interesting. I have probed three variables that are computed initially, and that's what I get when using with and without redirecting the output to file redirected to file: 0 -0.02 0 direct to screen: 0 -0.02 1.04083e-17 So there's a round-off difference in the code variables with and without redirecting the output! Now, why redirecting would interefere with an internal computation of the code? UPDATE 3: If I redirect to /dev/null, I get the sam behaviour as outputing direct to screen, instead of redirecting to file.

    Read the article

  • Can piping of screen to file change the result of a C++ code?

    - by Biga
    I am having this very weird behaviour with a C++ code: It gives me different results when running with and without piping the screen to a file (reproducible in cygwin and linux). I mean, if I get the same executable and run it like './run' or run it like './run out.log', I get different results! I use std::cout to output to screen, all lines ending with endl; I use ifstream for the input file; I use ofstream for output, all lines ending with endl. I am using g++ 4. Any idea what is going on? UPDATE: I have hard-coded the input data, so 'ifstream' is not used, and problem persists. UPDATE 2: That's getting interesting. I have output three variables that are computed initially, and that's what I get with and without piping direct to screen: 0 -0.02 0 piped: 0 -0.02 1.04083e-17 So there's a round-off difference with and without piping the output! Now, why piping would interefere with an internal computation of the code?

    Read the article

  • Load page for validation but do not display it to user in ASP.NET

    - by Kevin
    We have a site requiring users pay $2 to view the details of a record. We occasionally get complaints because we send them to the payment page, and once they pay it turns out the record isn't valid, or it was lost, or the data couldn't be generated. So we want to add in a check to ensure the page constructs properly before the user is required to pay for it. However, we don't want the user to have access to the page until they pay for it. Is there anything in ASP.NET 3.5 or just general web design that would allow something like this? The data on the record is real time and computed on a backend server before sent to the client. Occasionally this computation fails for whatever reason. Our alternative is to call all of the loading methods and validate the data, then redirect them to the payment page. The problem is A) this will be a relatively involved process rewriting all of these methods to return validation information, and B) it still doesn't guarentee us the page will load properly. Any thoughts?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Migrating Ajax web application to web socket

    - by Bastan
    Hi, I think i'm just missing a little detail that is preventing me from seeing the whole picture. I have a web application which use ajax request every x time to update client with new information or tasks. I also have a long running process on the server which is a java computation engine. I would like this engine to send update to the client. I am wondering how to migrate my web app to using websocket. Probably phpwebsocket or similar. Can my server 'decide' to send information to a specific client? It seems possible looking at the php-websocket. Can my java backend long process use the websocket server to send notification to a specific client. How? well I can say that my java app could use a class that could send over websocket instead of http. But how the websocket server knows to which client to send the 'info'. I am puzzle by all this. Any document that explain this in more details? It seems that the websocket could create an instance of my web application. Thanks

    Read the article

  • Outer product using CBLAS

    - by The Dude
    I am having trouble utilizing CBLAS to perform an Outer Product. My code is as follows: //===SET UP===// double x1[] = {1,2,3,4}; double x2[] = {1,2,3}; int dx1 = 4; int dx2 = 3; double X[dx1 * dx2]; for (int i = 0; i < (dx1*dx2); i++) {X[i] = 0.0;} //===DO THE OUTER PRODUCT===// cblas_dgemm(CblasRowMajor, CblasNoTrans, CblasTrans, dx1, dx2, 1, 1.0, x1, dx1, x2, 1, 0.0, X, dx1); //===PRINT THE RESULTS===// printf("\nMatrix X (%d x %d) = x1 (*) x2 is:\n", dx1, dx2); for (i=0; i<4; i++) { for (j=0; j<3; j++) { printf ("%lf ", X[j+i*3]); } printf ("\n"); } I get: Matrix X (4 x 3) = x1 (*) x2 is: 1.000000 2.000000 3.000000 0.000000 -1.000000 -2.000000 -3.000000 0.000000 7.000000 14.000000 21.000000 0.000000 But the correct answer is found here: https://www.sharcnet.ca/help/index.php/BLAS_and_CBLAS_Usage_and_Examples I have seen: Efficient computation of kronecker products in C But, it doesn't help me because they don't actually say how to utilize dgemm to actually do this... Any help? What am I doing wrong here?

    Read the article

  • Triangulation & Direct linear transform

    - by srand
    Following Hartley/Zisserman's Multiview Geometery, Algorithm 12: The optimal triangulation method (p318), I got the corresponding image points xhat1 and xhat2 (step 10). In step 11, one needs to compute the 3D point Xhat. One such method is Direct Linear Transform (DLT), mentioned in 12.2 (p312) and 4.1 (p88). The homogenous method (DLT), p312-313, states that it finds a solution as the unit singular vector corresponding to the smallest singular value of A, thus, A = [xhat1(1) * P1(3,:)' - P1(1,:)' ; xhat1(2) * P1(3,:)' - P1(2,:)' ; xhat2(1) * P2(3,:)' - P2(1,:)' ; xhat2(2) * P2(3,:)' - P2(2,:)' ]; [Ua Ea Va] = svd(A); Xhat = Va(:,end); plot3(Xhat(1),Xhat(2),Xhat(3), 'r.'); However, A is a 16x1 matrix, resulting in a Va that is 1x1. What am I doing wrong (and a fix) in getting the 3D point? For what its worth sample data: xhat1 = 1.0e+009 * 4.9973 -0.2024 0.0027 xhat2 = 1.0e+011 * 2.0729 2.6624 0.0098 P1 = 699.6674 0 392.1170 0 0 701.6136 304.0275 0 0 0 1.0000 0 P2 = 1.0e+003 * -0.7845 0.0508 -0.1592 1.8619 -0.1379 0.7338 0.1649 0.6825 -0.0006 0.0001 0.0008 0.0010 A = <- my computation 1.0e+011 * -0.0000 0 0.0500 0 0 -0.0000 -0.0020 0 -1.3369 0.2563 1.5634 2.0729 -1.7170 0.3292 2.0079 2.6624

    Read the article

  • converting a UTC time to a local time zone in Java

    - by aloo
    I know this subject has been beaten to death but after searching for a few hours to this problem I had to ask. My Problem: do calculations on dates on a server based on the current time zone of a client app (iphone). The client app tells the server, in seconds, how far away its time zone is away from GMT. I would like to then use this information to do computation on dates in the server. The dates on the server are all stored as UTC time. So I would like to get the HOUR of a UTC Date object after it has been converted to this local time zone. My current attempt: int hours = (int) Math.floor(secondsFromGMT / (60.0 * 60.0)); int mins = (int) Math.floor((secondsFromGMT - (hours * 60.0 * 60.0)) / 60.0); String sign = hours > 0 ? "+" : "-"; Calendar now = Calendar.getInstance(); TimeZone t = TimeZone.getTimeZone("GMT" + sign + hours + ":" + mins); now.setTimeZone(t); now.setTime(someDateTimeObject); int hourOfDay = now.get(Calendar.HOUR_OF_DAY); The variables hour and mins represent the hour and mins the local time zone is away from GMT. After debugging this code - the variables hour, mins and sign are correct. The problem is hourOfDay does not return the correct hour - it is returning the hour as of UTC time and not local time. Ideas?

    Read the article

  • A good way to write unit tests

    - by bobobobo
    So, I previously wasn't really in the practice of writing unit tests - now I kind of am and I need to check if I'm on the right track. Say you have a class that deals with math computations. class Vector3 { public: // Yes, public. float x,y,z ; // ... ctors ... } ; Vector3 operator+( const Vector3& a, const Vector3 &b ) { return Vector3( a.x + b.y /* oops!! hence the need for unit testing.. */, a.y + b.y, a.z + b.z ) ; } There are 2 ways I can really think of to do a unit test on a Vector class: 1) Hand-solve some problems, then hard code the numbers into the unit test and pass only if equal to your hand and hard-coded result bool UnitTest_ClassVector3_operatorPlus() { Vector3 a( 2, 3, 4 ) ; Vector3 b( 5, 6, 7 ) ; Vector3 result = a + b ; // "expected" is computed outside of computer, and // hard coded here. For more complicated operations like // arbitrary axis rotation this takes a bit of paperwork, // but only the final result will ever be entered here. Vector3 expected( 7, 9, 11 ) ; if( result.isNear( expected ) ) return PASS ; else return FAIL ; } 2) Rewrite the computation code very carefully inside the unit test. bool UnitTest_ClassVector3_operatorPlus() { Vector3 a( 2, 3, 4 ) ; Vector3 b( 5, 6, 7 ) ; Vector3 result = a + b ; // "expected" is computed HERE. This // means all you've done is coded the // same thing twice, hopefully not having // repeated the same mistake again Vector3 expected( 2 + 5, 6 + 3, 4 + 7 ) ; if( result.isNear( expected ) ) return PASS ; else return FAIL ; } Or is there another way to do something like this?

    Read the article

  • How (and if) to write a single-consumer queue using the task parallel library?

    - by Eric
    I've heard a bunch of podcasts recently about the TPL in .NET 4.0. Most of them describe background activities like downloading images or doing a computation, using tasks so that the work doesn't interfere with a GUI thread. Most of the code I work on has more of a multiple-producer / single-consumer flavor, where work items from multiple sources must be queued and then processed in order. One example would be logging, where log lines from multiple threads are sequentialized into a single queue for eventual writing to a file or database. All the records from any single source must remain in order, and records from the same moment in time should be "close" to each other in the eventual output. So multiple threads or tasks or whatever are all invoking a queuer: lock( _queue ) // or use a lock-free queue! { _queue.enqueue( some_work ); _queueSemaphore.Release(); } And a dedicated worker thread processes the queue: while( _queueSemaphore.WaitOne() ) { lock( _queue ) { some_work = _queue.dequeue(); } deal_with( some_work ); } It's always seemed reasonable to dedicate a worker thread for the consumer side of these tasks. Should I write future programs using some construct from the TPL instead? Which one? Why?

    Read the article

  • Travelling software. Is that a concept?

    - by Bubba88
    Hi! This is barely a sensible question. I would like to ask if there existed a program, which were intended to travel (for example following some physical forces) across the planet, possibly occupying and freeing computational resources/nodes. Literally that means that some agent-based system is just regularly changing it's location and (inevitably to some extent) configuration. An example would be: suppose you have external sensors, and free computers - nodes - across the space; would it make sense to self-replicate agents to follow the initializers from sensors, but in such restrictive manner that the computation is only localized at where the physical business is going on. I want to stress that this question is just for 'theoretical' fun, cause I cannot see any practical benefits of the restrictions mentioned, apart from the optimization of 'outdated' (outplaced?) agent disposal. But maybe it could be of some interest. Thank you! EDIT: It's obvious that a virus is fitting example, although the deletion of such agents is rarely of concern of the developers. More precisely, I'm interested in 'travelling' software - that is, when the count (or at least order) of the agents is kind of constant, and it's just the whole system who travels.

    Read the article

  • C non-trivial constants

    - by user525869
    I want to make several constants in C with #define to speed up computation. Two of them are not simply trivial numbers, where one is a right shift, the other is a power. math.h in C gives the function pow() for doubles, whereas I need powers for integers, so I wrote my own function, ipow, so I wouldn't need to be casting everytime. My question is this: One of the #define constants I want to make is a power, say ipow(M, T), where M and T were also #define constants. ipow is a function in the actual code, so this actually seems to slows things down when I run the code (is it running ipow everytime the constant is mentioned?). However, when I ues the built in pow function and just do (int)pow(M,T), the code is sped up. I'm confused as to why this is, since the ipow and pow functions are just as fast. On a more general note, can I define constants using #define using functions inside the actual code? The above example has me confused on whether this speeds things up or actually slows things down.

    Read the article

  • Unit Conversion from feet to meters

    - by user1742419
    I have to write a program that reads in a length in feet and inches and outputs the equivalent length in meters and centimeters. I have to create three functions: one for input, one or more for calculating, and one for output; And include a loop that lets the user repeat this computation for new input values until the user says he or she wants to end the program. I can't seem to get the input from one function to be used in the conversion function and then outputted by the next function. How do I do that? Thank you. #include <iostream> #include <conio.h> using namespace std; double leng; void length(double leng); double conv(double leng); void output(double leng); int main() { length(leng); conv(leng); output(leng); _getche(); return 0; } void length(double leng) { cout<<"Enter a length in feet, then enter a length in inches if needed: "; cin>>leng; return; } double conv(double leng) { return leng = leng * .3048; } void output(double leng) { cout<<"Your input is converted to "<<leng; return; }

    Read the article

  • WCF WS-Security and WSE Nonce Authentication

    - by Rick Strahl
    WCF makes it fairly easy to access WS-* Web Services, except when you run into a service format that it doesn't support. Even then WCF provides a huge amount of flexibility to make the service clients work, however finding the proper interfaces to make that happen is not easy to discover and for the most part undocumented unless you're lucky enough to run into a blog, forum or StackOverflow post on the matter. This is definitely true for the Password Nonce as part of the WS-Security/WSE protocol, which is not natively supported in WCF. Specifically I had a need to create a WCF message on the client that includes a WS-Security header that looks like this from their spec document:<soapenv:Header> <wsse:Security soapenv:mustUnderstand="1" xmlns:wsse="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-wssecurity-secext-1.0.xsd"> <wsse:UsernameToken wsu:Id="UsernameToken-8" xmlns:wsu="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-wssecurity-utility-1.0.xsd"> <wsse:Username>TeStUsErNaMe1</wsse:Username> <wsse:Password Type="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-username-token-profile-1.0#PasswordText" >TeStPaSsWoRd1</wsse:Password> <wsse:Nonce EncodingType="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-soap-message-security-1.0#Base64Binary" >f8nUe3YupTU5ISdCy3X9Gg==</wsse:Nonce> <wsu:Created>2011-05-04T19:01:40.981Z</wsu:Created> </wsse:UsernameToken> </wsse:Security> </soapenv:Header> Specifically, the Nonce and Created keys are what WCF doesn't create or have a built in formatting for. Why is there a nonce? My first thought here was WTF? The username and password are there in clear text, what does the Nonce accomplish? The Nonce and created keys are are part of WSE Security specification and are meant to allow the server to detect and prevent replay attacks. The hashed nonce should be unique per request which the server can store and check for before running another request thus ensuring that a request is not replayed with exactly the same values. Basic ServiceUtl Import - not much Luck The first thing I did when I imported this service with a service reference was to simply import it as a Service Reference. The Add Service Reference import automatically detects that WS-Security is required and appropariately adds the WS-Security to the basicHttpBinding in the config file:<?xml version="1.0" encoding="utf-8" ?> <configuration> <system.serviceModel> <bindings> <basicHttpBinding> <binding name="RealTimeOnlineSoapBinding"> <security mode="Transport" /> </binding> <binding name="RealTimeOnlineSoapBinding1" /> </basicHttpBinding> </bindings> <client> <endpoint address="https://notarealurl.com:443/services/RealTimeOnline" binding="basicHttpBinding" bindingConfiguration="RealTimeOnlineSoapBinding" contract="RealTimeOnline.RealTimeOnline" name="RealTimeOnline" /> </client> </system.serviceModel> </configuration> If if I run this as is using code like this:var client = new RealTimeOnlineClient(); client.ClientCredentials.UserName.UserName = "TheUsername"; client.ClientCredentials.UserName.Password = "ThePassword"; … I get nothing in terms of WS-Security headers. The request is sent, but the the binding expects transport level security to be applied, rather than message level security. To fix this so that a WS-Security message header is sent the security mode can be changed to: <security mode="TransportWithMessageCredential" /> Now if I re-run I at least get a WS-Security header which looks like this:<s:Envelope xmlns:s="http://schemas.xmlsoap.org/soap/envelope/" xmlns:u="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-wssecurity-utility-1.0.xsd"> <s:Header> <o:Security s:mustUnderstand="1" xmlns:o="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-wssecurity-secext-1.0.xsd"> <u:Timestamp u:Id="_0"> <u:Created>2012-11-24T02:55:18.011Z</u:Created> <u:Expires>2012-11-24T03:00:18.011Z</u:Expires> </u:Timestamp> <o:UsernameToken u:Id="uuid-18c215d4-1106-40a5-8dd1-c81fdddf19d3-1"> <o:Username>TheUserName</o:Username> <o:Password Type="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-username-token-profile-1.0#PasswordText" >ThePassword</o:Password> </o:UsernameToken> </o:Security> </s:Header> Closer! Now the WS-Security header is there along with a timestamp field (which might not be accepted by some WS-Security expecting services), but there's no Nonce or created timestamp as required by my original service. Using a CustomBinding instead My next try was to go with a CustomBinding instead of basicHttpBinding as it allows a bit more control over the protocol and transport configurations for the binding. Specifically I can explicitly specify the message protocol(s) used. Using configuration file settings here's what the config file looks like:<?xml version="1.0"?> <configuration> <system.serviceModel> <bindings> <customBinding> <binding name="CustomSoapBinding"> <security includeTimestamp="false" authenticationMode="UserNameOverTransport" defaultAlgorithmSuite="Basic256" requireDerivedKeys="false" messageSecurityVersion="WSSecurity10WSTrustFebruary2005WSSecureConversationFebruary2005WSSecurityPolicy11BasicSecurityProfile10"> </security> <textMessageEncoding messageVersion="Soap11"></textMessageEncoding> <httpsTransport maxReceivedMessageSize="2000000000"/> </binding> </customBinding> </bindings> <client> <endpoint address="https://notrealurl.com:443/services/RealTimeOnline" binding="customBinding" bindingConfiguration="CustomSoapBinding" contract="RealTimeOnline.RealTimeOnline" name="RealTimeOnline" /> </client> </system.serviceModel> <startup> <supportedRuntime version="v4.0" sku=".NETFramework,Version=v4.0"/> </startup> </configuration> This ends up creating a cleaner header that's missing the timestamp field which can cause some services problems. The WS-Security header output generated with the above looks like this:<s:Header> <o:Security s:mustUnderstand="1" xmlns:o="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-wssecurity-secext-1.0.xsd"> <o:UsernameToken u:Id="uuid-291622ca-4c11-460f-9886-ac1c78813b24-1"> <o:Username>TheUsername</o:Username> <o:Password Type="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-username-token-profile-1.0#PasswordText" >ThePassword</o:Password> </o:UsernameToken> </o:Security> </s:Header> This is closer as it includes only the username and password. The key here is the protocol for WS-Security:messageSecurityVersion="WSSecurity10WSTrustFebruary2005WSSecureConversationFebruary2005WSSecurityPolicy11BasicSecurityProfile10" which explicitly specifies the protocol version. There are several variants of this specification but none of them seem to support the nonce unfortunately. This protocol does allow for optional omission of the Nonce and created timestamp provided (which effectively makes those keys optional). With some services I tried that requested a Nonce just using this protocol actually worked where the default basicHttpBinding failed to connect, so this is a possible solution for access to some services. Unfortunately for my target service that was not an option. The nonce has to be there. Creating Custom ClientCredentials As it turns out WCF doesn't have support for the Digest Nonce as part of WS-Security, and so as far as I can tell there's no way to do it just with configuration settings. I did a bunch of research on this trying to find workarounds for this, and I did find a couple of entries on StackOverflow as well as on the MSDN forums. However, none of these are particularily clear and I ended up using bits and pieces of several of them to arrive at a working solution in the end. http://stackoverflow.com/questions/896901/wcf-adding-nonce-to-usernametoken http://social.msdn.microsoft.com/Forums/en-US/wcf/thread/4df3354f-0627-42d9-b5fb-6e880b60f8ee The latter forum message is the more useful of the two (the last message on the thread in particular) and it has most of the information required to make this work. But it took some experimentation for me to get this right so I'll recount the process here maybe a bit more comprehensively. In order for this to work a number of classes have to be overridden: ClientCredentials ClientCredentialsSecurityTokenManager WSSecurityTokenizer The idea is that we need to create a custom ClientCredential class to hold the custom properties so they can be set from the UI or via configuration settings. The TokenManager and Tokenizer are mainly required to allow the custom credentials class to flow through the WCF pipeline and eventually provide custom serialization. Here are the three classes required and their full implementations:public class CustomCredentials : ClientCredentials { public CustomCredentials() { } protected CustomCredentials(CustomCredentials cc) : base(cc) { } public override System.IdentityModel.Selectors.SecurityTokenManager CreateSecurityTokenManager() { return new CustomSecurityTokenManager(this); } protected override ClientCredentials CloneCore() { return new CustomCredentials(this); } } public class CustomSecurityTokenManager : ClientCredentialsSecurityTokenManager { public CustomSecurityTokenManager(CustomCredentials cred) : base(cred) { } public override System.IdentityModel.Selectors.SecurityTokenSerializer CreateSecurityTokenSerializer(System.IdentityModel.Selectors.SecurityTokenVersion version) { return new CustomTokenSerializer(System.ServiceModel.Security.SecurityVersion.WSSecurity11); } } public class CustomTokenSerializer : WSSecurityTokenSerializer { public CustomTokenSerializer(SecurityVersion sv) : base(sv) { } protected override void WriteTokenCore(System.Xml.XmlWriter writer, System.IdentityModel.Tokens.SecurityToken token) { UserNameSecurityToken userToken = token as UserNameSecurityToken; string tokennamespace = "o"; DateTime created = DateTime.Now; string createdStr = created.ToString("yyyy-MM-ddThh:mm:ss.fffZ"); // unique Nonce value - encode with SHA-1 for 'randomness' // in theory the nonce could just be the GUID by itself string phrase = Guid.NewGuid().ToString(); var nonce = GetSHA1String(phrase); // in this case password is plain text // for digest mode password needs to be encoded as: // PasswordAsDigest = Base64(SHA-1(Nonce + Created + Password)) // and profile needs to change to //string password = GetSHA1String(nonce + createdStr + userToken.Password); string password = userToken.Password; writer.WriteRaw(string.Format( "<{0}:UsernameToken u:Id=\"" + token.Id + "\" xmlns:u=\"http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-wssecurity-utility-1.0.xsd\">" + "<{0}:Username>" + userToken.UserName + "</{0}:Username>" + "<{0}:Password Type=\"http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-username-token-profile-1.0#PasswordText\">" + password + "</{0}:Password>" + "<{0}:Nonce EncodingType=\"http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-soap-message-security-1.0#Base64Binary\">" + nonce + "</{0}:Nonce>" + "<u:Created>" + createdStr + "</u:Created></{0}:UsernameToken>", tokennamespace)); } protected string GetSHA1String(string phrase) { SHA1CryptoServiceProvider sha1Hasher = new SHA1CryptoServiceProvider(); byte[] hashedDataBytes = sha1Hasher.ComputeHash(Encoding.UTF8.GetBytes(phrase)); return Convert.ToBase64String(hashedDataBytes); } } Realistically only the CustomTokenSerializer has any significant code in. The code there deals with actually serializing the custom credentials using low level XML semantics by writing output into an XML writer. I can't take credit for this code - most of the code comes from the MSDN forum post mentioned earlier - I made a few adjustments to simplify the nonce generation and also added some notes to allow for PasswordDigest generation. Per spec the nonce is nothing more than a unique value that's supposed to be 'random'. I'm thinking that this value can be any string that's unique and a GUID on its own probably would have sufficed. Comments on other posts that GUIDs can be potentially guessed are highly exaggerated to say the least IMHO. To satisfy even that aspect though I added the SHA1 encryption and binary decoding to give a more random value that would be impossible to 'guess'. The original example from the forum post used another level of encoding and decoding to string in between - but that really didn't accomplish anything but extra overhead. The header output generated from this looks like this:<s:Header> <o:Security s:mustUnderstand="1" xmlns:o="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-wssecurity-secext-1.0.xsd"> <o:UsernameToken u:Id="uuid-f43d8b0d-0ebb-482e-998d-f544401a3c91-1" xmlns:u="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-wssecurity-utility-1.0.xsd"> <o:Username>TheUsername</o:Username> <o:Password Type="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-username-token-profile-1.0#PasswordText">ThePassword</o:Password> <o:Nonce EncodingType="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-soap-message-security-1.0#Base64Binary" >PjVE24TC6HtdAnsf3U9c5WMsECY=</o:Nonce> <u:Created>2012-11-23T07:10:04.670Z</u:Created> </o:UsernameToken> </o:Security> </s:Header> which is exactly as it should be. Password Digest? In my case the password is passed in plain text over an SSL connection, so there's no digest required so I was done with the code above. Since I don't have a service handy that requires a password digest,  I had no way of testing the code for the digest implementation, but here is how this is likely to work. If you need to pass a digest encoded password things are a little bit trickier. The password type namespace needs to change to: http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-username-token-profile-1.0#Digest and then the password value needs to be encoded. The format for password digest encoding is this: Base64(SHA-1(Nonce + Created + Password)) and it can be handled in the code above with this code (that's commented in the snippet above): string password = GetSHA1String(nonce + createdStr + userToken.Password); The entire WriteTokenCore method for digest code looks like this:protected override void WriteTokenCore(System.Xml.XmlWriter writer, System.IdentityModel.Tokens.SecurityToken token) { UserNameSecurityToken userToken = token as UserNameSecurityToken; string tokennamespace = "o"; DateTime created = DateTime.Now; string createdStr = created.ToString("yyyy-MM-ddThh:mm:ss.fffZ"); // unique Nonce value - encode with SHA-1 for 'randomness' // in theory the nonce could just be the GUID by itself string phrase = Guid.NewGuid().ToString(); var nonce = GetSHA1String(phrase); string password = GetSHA1String(nonce + createdStr + userToken.Password); writer.WriteRaw(string.Format( "<{0}:UsernameToken u:Id=\"" + token.Id + "\" xmlns:u=\"http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-wssecurity-utility-1.0.xsd\">" + "<{0}:Username>" + userToken.UserName + "</{0}:Username>" + "<{0}:Password Type=\"http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-username-token-profile-1.0#Digest\">" + password + "</{0}:Password>" + "<{0}:Nonce EncodingType=\"http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-soap-message-security-1.0#Base64Binary\">" + nonce + "</{0}:Nonce>" + "<u:Created>" + createdStr + "</u:Created></{0}:UsernameToken>", tokennamespace)); } I had no service to connect to to try out Digest auth - if you end up needing it and get it to work please drop a comment… How to use the custom Credentials The easiest way to use the custom credentials is to create the client in code. Here's a factory method I use to create an instance of my service client:  public static RealTimeOnlineClient CreateRealTimeOnlineProxy(string url, string username, string password) { if (string.IsNullOrEmpty(url)) url = "https://notrealurl.com:443/cows/services/RealTimeOnline"; CustomBinding binding = new CustomBinding(); var security = TransportSecurityBindingElement.CreateUserNameOverTransportBindingElement(); security.IncludeTimestamp = false; security.DefaultAlgorithmSuite = SecurityAlgorithmSuite.Basic256; security.MessageSecurityVersion = MessageSecurityVersion.WSSecurity10WSTrustFebruary2005WSSecureConversationFebruary2005WSSecurityPolicy11BasicSecurityProfile10; var encoding = new TextMessageEncodingBindingElement(); encoding.MessageVersion = MessageVersion.Soap11; var transport = new HttpsTransportBindingElement(); transport.MaxReceivedMessageSize = 20000000; // 20 megs binding.Elements.Add(security); binding.Elements.Add(encoding); binding.Elements.Add(transport); RealTimeOnlineClient client = new RealTimeOnlineClient(binding, new EndpointAddress(url)); // to use full client credential with Nonce uncomment this code: // it looks like this might not be required - the service seems to work without it client.ChannelFactory.Endpoint.Behaviors.Remove<System.ServiceModel.Description.ClientCredentials>(); client.ChannelFactory.Endpoint.Behaviors.Add(new CustomCredentials()); client.ClientCredentials.UserName.UserName = username; client.ClientCredentials.UserName.Password = password; return client; } This returns a service client that's ready to call other service methods. The key item in this code is the ChannelFactory endpoint behavior modification that that first removes the original ClientCredentials and then adds the new one. The ClientCredentials property on the client is read only and this is the way it has to be added.   Summary It's a bummer that WCF doesn't suport WSE Security authentication with nonce values out of the box. From reading the comments in posts/articles while I was trying to find a solution, I found that this feature was omitted by design as this protocol is considered unsecure. While I agree that plain text passwords are rarely a good idea even if they go over secured SSL connection as WSE Security does, there are unfortunately quite a few services (mosly Java services I suspect) that use this protocol. I've run into this twice now and trying to find a solution online I can see that this is not an isolated problem - many others seem to have struggled with this. It seems there are about a dozen questions about this on StackOverflow all with varying incomplete answers. Hopefully this post provides a little more coherent content in one place. Again I marvel at WCF and its breadth of support for protocol features it has in a single tool. And even when it can't handle something there are ways to get it working via extensibility. But at the same time I marvel at how freaking difficult it is to arrive at these solutions. I mean there's no way I could have ever figured this out on my own. It takes somebody working on the WCF team or at least being very, very intricately involved in the innards of WCF to figure out the interconnection of the various objects to do this from scratch. Luckily this is an older problem that has been discussed extensively online and I was able to cobble together a solution from the online content. I'm glad it worked out that way, but it feels dirty and incomplete in that there's a whole learning path that was omitted to get here… Man am I glad I'm not dealing with SOAP services much anymore. REST service security - even when using some sort of federation is a piece of cake by comparison :-) I'm sure once standards bodies gets involved we'll be right back in security standard hell…© Rick Strahl, West Wind Technologies, 2005-2012Posted in WCF  Web Services   Tweet !function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0];if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src="//platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs"); (function() { var po = document.createElement('script'); po.type = 'text/javascript'; po.async = true; po.src = 'https://apis.google.com/js/plusone.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(po, s); })();

    Read the article

< Previous Page | 44 45 46 47 48 49 50 51 52 53 54 55  | Next Page >