Search Results

Search found 36279 results on 1452 pages for 'html element'.

Page 484/1452 | < Previous Page | 480 481 482 483 484 485 486 487 488 489 490 491  | Next Page >

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Add an event to HTML elements with a specific class.

    - by Juan C. Rois
    Hello everybody, I'm working on a modal window, and I want to make the function as reusable as possible. Said that, I want to set a few anchor tags with a class equals to "modal", and when a particular anchor tag is clicked, get its Id and pass it to a function that will execute another function based on the Id that was passed. This is what I have so far: // this gets an array with all the elements that have a class equals to "modal" var anchorTrigger = document.getElementsByClassName('modal'); Then I tried to set the addEventListener for each item in the array by doing this: var anchorTotal = anchorTrigger.length; for(var i = 0; i < anchorTotal ; i++){ anchorTrigger.addEventListener('click', fireModal, false); } and then run the last function "fireModal" that will open the modal, like so: function fireModal(){ //some more code here ... } My problem is that in the "for" loop, I get an error saying that anchorTrigger.addEvent ... is not a function. I can tell that the error might be related to the fact that I'm trying to set up the "addEventListener" to an array as oppose to individual elements, but I don't know what I'm supposed to do. Any help would be greatly appreciated.

    Read the article

  • Accessing jQuery objects in the module pattern

    - by Stewart
    Hello, Really getting in to javascript and looking around at some patterns. One I have come accross is the module pattern. Its seems like a nice way to think of chucks of functionality so I went ahead and tried to implement it with jQuery. I ran in to a snag though. Consider the following code <!DOCTYPE html> <html> <head> <meta http-equiv="Content-type" content="text/html; charset=utf-8"> <title>index</title> <script type="text/javascript" charset="utf-8" src="https://ajax.googleapis.com/ajax/libs/jquery/1.4.4/jquery.min.js"></script> <script type="text/javascript" charset="utf-8"> $(document).ready(function(){ var TestClass2 = (function(){ var someDiv; return { thisTest: function () { someDiv = document.createElement("div"); $(someDiv).append("#index"); $(someDiv).html("hello"); $(someDiv).addClass("test_class"); } } })(); TestClass2.thisTest(); }); </script> </head> <body id="index" onload=""> <div id="name"> this is content </div> </body> </html> The above code alerts the html content of the div and then adds a class. These both use jQuery methods. The problem is that the .html() method works fine however i can not add the class. No errors result and the class does not get added. What is happening here? Why is the class not getting added to the div?

    Read the article

  • Javascript (and HTML rendering) engine without a GUI for automation?

    - by MTsoul
    Are there any libraries or frameworks that provide the functionality of a browser, but do not need to actually render physically onto the screen? I want to automate navigation on web pages (Mechanize does this, for example), but I want the full browser experience, including Javascript. Thus, I'd like to have a virtual browser of some sort, that I can use to "click on links" programmatically, have DOM elements and JS scripts render within it, and manipulate these elements. Solution preferably in Python, but I can manage others.

    Read the article

  • Writing to a xml file in java

    - by user243680
    import java.io.*; import javax.xml.parsers.*; import javax.xml.transform.*; import javax.xml.transform.dom.*; import javax.xml.transform.stream.*; import org.w3c.dom.*; public class CreatXMLFile { public static void main(String[] args) throws Exception { BufferedReader bf = new BufferedReader(new InputStreamReader(System.in)); // System.out.print("Enter number to add elements in your XML file: "); // String str = bf.readLine(); int no=2; // System.out.print("Enter root: "); String root = "SMS"; DocumentBuilderFactory documentBuilderFactory =DocumentBuilderFactory.newInstance(); DocumentBuilder documentBuilder =documentBuilderFactory.newDocumentBuilder(); Document document = documentBuilder.newDocument(); Element rootElement = document.createElement(root); document.appendChild(rootElement); // for (int i = 1; i <= no; i++) // System.out.print("Enter the element: "); // String element = bf.readLine(); String element ="Number"; System.out.print("Enter the Number: "); String data = bf.readLine(); Element em = document.createElement(element); em.appendChild(document.createTextNode(data)); rootElement.appendChild(em); String element1 ="message"; System.out.print("Enter the SMS: "); String data1 = bf.readLine(); Element em1 = document.createElement(element1); em1.appendChild(document.createTextNode(data1)); rootElement.appendChild(em1); TransformerFactory transformerFactory = TransformerFactory.newInstance(); Transformer transformer = transformerFactory.newTransformer(); DOMSource source = new DOMSource(document); StreamResult result = new StreamResult(System.out); transformer.transform(source, result); } } i am working on the above code and it gives the following output run: Enter the Number: 768678 Enter the SMS: ytu <?xml version="1.0" encoding="UTF-8" standalone="no"?><SMS><Number>768678</Number><message>ytu</message></SMS>BUILD SUCCESSFUL (total time: 8 seconds) Now i want to write the output generated(<?xml version="1.0" encoding="UTF-8" standalone="no"?><SMS><Number>768678</Number><message>ytu</message></SMS>) to a XML file on the hard disk.How do i do it?

    Read the article

  • Choosing a W3C valid DOCTYPE and charset combination?

    - by George Carter
    I have a homepage with the following: <DOCTYPE html> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"> My choice of the DOCTYPE "html" is based on a recommendation for html pages using jQuery. My choice of charset=utf=8 is based on a recommendation to make my pages readable on most browsers. But these choices may be wrong. When I run this page thru the W3C HTML validator, I get messages you see below. Any way I can eliminate the 2 errors? ! Using experimental feature: HTML5 Conformance Checker. The validator checked your document with an experimental feature: HTML5 Conformance Checker. This feature has been made available for your convenience, but be aware that it may be unreliable, or not perfectly up to date with the latest development of some cutting-edge technologies. If you find any issue with this feature, please report them. Thank you. Validation Output: 2 Errors 1. Error Line 18, Column 70: Changing character encoding utf-8 and reparsing. …ntent-Type" content="text/html; charset=utf-8"> 2. Error Line 18, Column 70: Changing encoding at this point would need non-streamable behavior. …ntent-Type" content="text/html; charset=utf-8">

    Read the article

  • JavaScript automatically converts some special characters

    - by noplacetoh1de
    I need to extract a HTML-Substring with JS which is position dependent. I store special characters HTML-encoded. For example: HTML <div id="test"><p>l&ouml;sen &amp; gr&uuml;&szlig;en</p></div>? Text lösen & grüßen My problem lies in the JS-part, for example when I try to extract the fragment lö, which has the HTML-dependent starting position of 3 and the end position of 9 inside the <div> block. JS seems to convert some special characters internally so that the count from 3 to 9 is wrongly interpreted as "lösen " and not "l&ouml;". Other special characters like the &amp; are not affected by this. So my question is, if someone knows why JS is behaving in that way? Characters like &auml; or &ouml; are being converted while characters like &amp; or &nbsp; are plain. Is there any possibility to avoid this conversion? I've set up a fiddle to demonstrate this: JSFiddle Thanks for any help! EDIT: Maybe I've explained it a bit confusing, sorry for that. What I want is the HTML: <p>l&ouml;sen &amp; gr&uuml;&szlig;en</p> . Every special character should be unconverted, except the HTML-Tags. Like in the HTML above. But JS converts the &ouml; or &uuml; into ö or ü automatically, what I need to avoid.

    Read the article

  • 503 server response for Googlebot

    - by Hallik
    I put an .htaccess file in my webroot with the following contents RewriteBase / RewriteCond %{HTTP_USER_AGENT} ^.*(Googlebot|Googlebot|Mediapartners|Adsbot|Feedfetcher)-?(Google|Image)? [NC] RewriteRule .* /var/www/503.html This website is in maintenance mode, and I don't want anything indexed yet. I tested the code with a firefox User-Agent switcher plugin, and looking at the access log it shows this at the end of each log entry, but watching in TamperData or Firebug, it still returns a 200 server response instead of a 503. What am I doing wrong? "Mozilla/5.0 (compatible; Googlebot/2.1; +http://www.google.com/bot.html)" contents of /var/www/503.html <!DOCTYPE html PUBLIC "-//W3C//DTD HTML 3.2//EN"> <html> <head> <title>503 - Service temporary unavailable</title> </head> <body> <h1>503 - Service temporary unavailable</h1> <p>Sorry, this website is currently down for maintainance please retry later</p> </body> </html> I get this in my error log. LogLevel debug, would that go into the vhost in a specific place? Every answer I see on google is something different. Request exceeded the limit of 10 internal redirects due to probable configuration error. Use 'LimitInternalRecursion' to increase the limit if necessary. Use 'LogLevel debug' to get a backtrace.

    Read the article

  • HOWTO: implement a jQuery version of ASP.Net MVC "Strongly Typed Partial Views"

    - by Sam Carleton
    I am working on a multi-page assessment form where the questions/responses are database driven. Currently I the basic system working with Html.BeginForm via standard ASP.Net MVC. At this point in time, the key to the whole system is the 'Strongly Typed Partial Views'. When the question/response is read from the database, the response type determines which derived model is created and added to the collection. The main view it iterates through the collection and uses the 'Strongly Typed Partial Views' system of ASP.Net MVC to determine which view to render the correct type of response (radio button, drop down, or text box). I would like to change this process from a Html.BeginForm to Ajax.BeginForm. The problem is I don't have a clue as to how to implement the dynamic creation of the question/response in the JavaScript/jQuery world. Any thoughts and/or suggestions? Here is the current code to generate the dynamic form: @using (Html.BeginForm(new { mdsId = @Model.MdsId, sectionId = @Model.SectionId })) { <div class="SectionTitle"> <span>Section @Model.SectionName - @Model.SectionDescription</span> <span style="float: right">@Html.CheckBoxFor(x => x.ShowUnansweredQuestions) Show only unaswered questions</span> </div> @Html.HiddenFor(x => x.PrevSectionId) @Html.HiddenFor(x => x.NextSectionId) for (var i = 0; i < Model.answers.Count(); i++) { @Html.EditorFor(m => m.answers[i]); } }

    Read the article

  • Trouble with building up a string in Clojure

    - by Aki Iskandar
    Hi gang - [this may seem like my problem is with Compojure, but it isn't - it's with Clojure] I've been pulling my hair out on this seemingly simple issue - but am getting nowhere. I am playing with Compojure (a light web framework for Clojure) and I would just like to generate a web page showing showing my list of todos that are in a PostgreSQL database. The code snippets are below (left out the database connection, query, etc - but that part isn't needed because specific issue is that the resulting HTML shows nothing between the <body> and </body> tags). As a test, I tried hard-coding the string in the call to main-layout, like this: (html (main-layout "Aki's Todos" "Haircut<br>Study Clojure<br>Answer a question on Stackoverfolw")) - and it works fine. So the real issue is that I do not believe I know how to build up a string in Clojure. Not the idiomatic way, and not by calling out to Java's StringBuilder either - as I have attempted to do in the code below. A virtual beer, and a big upvote to whoever can solve it! Many thanks! ============================================================= ;The master template (a very simple POC for now, but can expand on it later) (defn main-layout "This is one of the html layouts for the pages assets - just like a master page" [title body] (html [:html [:head [:title title] (include-js "todos.js") (include-css "todos.css")] [:body body]])) (defn show-all-todos "This function will generate the todos HTML table and call the layout function" [] (let [rs (select-all-todos) sbHTML (new StringBuilder)] (for [rec rs] (.append sbHTML (str rec "<br><br>"))) (html (main-layout "Aki's Todos" (.toString sbHTML))))) ============================================================= Again, the result is a web page but with nothing between the body tags. If I replace the code in the for loop with println statements, and direct the code to the repl - forgetting about the web page stuff (ie. the call to main-layout), the resultset gets printed - BUT - the issue is with building up the string. Thanks again. ~Aki

    Read the article

  • Is there a way to preserve HTML Formatting in LiveDocX?

    - by Peter Schultheiss
    I have a large amount of content stored in a database as XHTML. I need to be able to pull this formatted content into a simple LiveDocX template with the formatting (bold, italic, bulleted lists, etc) preserved. Is this possible? If so, can anybody post a working example or link to an article? If not, are there other applications that I could look into? The client needs to be able to export content in the .doc/.docx file format. Thanks, Peter

    Read the article

  • Desktop-like UI implementations for Java web applications?

    - by localshred
    At work we're discussing upgrading our view layer for our web application. We're currently running an old and "modified" version of FreeMarker Classic, which is a pain to work with. One of our developers suggested using a Component UI style architecture similar to desktop style environments. Essentially, this would mean that you would build custom HTML components as Java Classes that the controller would render into the Document view. This would completely take away the need to write HTML into a view layer. The Components would generate the view layer for you. For instance, the following rendered HTML: <h1>I am a title</h1> <p>I am a paragraph.</p> Would be generated by doing something like: String titleString = "I am a title"; html.elements.Heading heading = new html.elements.Heading(Heading.H1, titleString); String paraString = "I am a paragraph."; html.elements.Paragraph paragraph = new html.elements.Paragraph(paraString); PrintWriter somePrintWriter = new PrintWriter(); Document document = new Document(); document.addElement(heading); document.addElement(paragraph); document.compose(somePrintWriter); The above code is just an example, don't critique the names or style, I just wrote it for a quick demonstration of what we may be trying to accomplish. I'm trying to determine if this has been done before in Java, and if so if there are any links I can be pointed to. I've been researching it as much as I can, but haven't found any implementations that completely remove the template layer (such as JSP or JSF). Thanks!

    Read the article

  • Why might ASP.NET be putting JavaScript in HTML Comment blocks, not CDATA?

    - by d4nt
    We have an ASP.NET 2.0 WebForms app that uses MS Ajax 1.0. It's working fine on all our environments (dev, test, IE6 VMs etc.). However, at the customer site the client side validation is not happening. We're currently trying to eliminate all the various factors and along the way we asked them to get their page source and send it to us, and we found something interesting. In our environment, our page has ASP.NET javascript in CDATA blocks: <script type="text/javascript"> //<![CDATA[ . . . //]]> </script> In their environment, the same code looks like this: <script type="text/javascript"> <!-- . . . //--> </script> This may be a red herring, but I'd like to eliminate it as the cause of the validation issues. Does anyone know whether specific configurations/patches/versions of ASP.NET will make it do this?

    Read the article

  • Is there a way to enforce/preserve order of XML elements in an XML Schema?

    - by MarcoS
    Let's consider the following XML Schema: <?xml version="1.0" encoding="UTF-8"?> <schema targetNamespace="http://www.example.org/library" elementFormDefault="qualified" xmlns="http://www.w3.org/2001/XMLSchema" xmlns:lib="http://www.example.org/library"> <element name="library" type="lib:libraryType"></element> <complexType name="libraryType"> <sequence> <element name="books" type="lib:booksType"></element> </sequence> </complexType> <complexType name="booksType"> <sequence> <element name="book" type="lib:bookType" maxOccurs="unbounded" minOccurs="1"></element> </sequence> </complexType> <complexType name="bookType"> <attribute name="title" type="string"></attribute> </complexType> </schema> and a corresponding XML example: <?xml version="1.0" encoding="UTF-8"?> <lib:library xmlns:lib="http://www.example.org/library" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.example.org/library src/library.xsd "> <lib:books> <lib:book title="t1"/> <lib:book title="t2"/> <lib:book title="t3"/> </lib:books> </lib:library> Is there a way to guarantee that the order of <lib:book .../> elements is preserved? I want to be sure that any parser reading the XML will return books in the specified oder, that is first the book with title="t1", then the book with title="t2", and finally the book with title="t3". As far as I know XML parsers are not required to preserve order. I wonder whether one can enforce this through XML Schema? One quick solution for me would be adding an index attribute to the <lib:book .../> element, and delegate order preservation to the application reading the XML. Comments? Suggestions?

    Read the article

  • "loading" div automatically appended when using cordova (phonegap)

    - by Vlad Ioffe
    I am using cordova for mobile app development on android platform. I have this html code in www/index.html file: <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.w3.org/TR/html4/loose.dtd"> <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <meta http-equiv="Content-Language" content="en" /> <script src="cordova-2.2.0.js" type="text/javascript"></script> <script src="jquery/jquery.js" type="text/javascript"></script> <script src="jquery.mobile/jquery.mobile-1.1.0.js" type="text/javascript"></script> <script src="JS/main.js" type="text/javascript"></script> <link rel="stylesheet" href="CSS/main.css"/> </head> <body id="body" class="body"> <div id="box" class="bodyBlack"> </div> </body> </html> I don't know why but when I am running this app (also when just opening on pc browser) i am having this div appended at the bottom of the page: <div ui-loader ui-corner-all ui-body-a ui-loader-default> <span ui-loader ui-corner-all ui-body-a ui-loader-default></span> <h1>loading</h1> Why and from where dose it getting from? how I am preventing it to do so? Thanks!!!

    Read the article

  • authorise user from mysql database

    - by Jacksta
    I suck at php, and cant find the error here. The script gets 2 variables "username" and "password" from a html from then check them against a MySQL databse. When I run this I get the follow error "Query was empty" <? if ((!$_POST[username]) || (!$_POST[password])) { header("Location: show_login.html"); exit; } $db_name = "testDB"; $table_name = "auth_users"; $connection = @mysql_connect("localhost", "admin", "pass") or die(mysql_error()); $db = @mysql_select_db($db_name, $connection) or die(mysql_error()); $slq = "SELECT * FROM $table_name WHERE username ='$_POST[username]' AND password = password('$_POST[password]')"; $result = @mysql_query($sql, $connection) or die(mysql_error()); $num = mysql_num_rows($result); if ($num != 0) { $msg = "<p>Congratulations, you're authorised!</p>"; } else { header("Location: show_login.html"); exit; } ?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Secret Area</title> </head> <body> <? echo "$msg"; ?> </body> </html>

    Read the article

  • How do you submit an authenticated HTML form using XUL (Firefox extension) Javascript?

    - by machineghost
    I am working on a Firefox extension, and in that extension I am trying to use AJAX to submit a form on a webpage. I am using: var request = Components.classes["@mozilla.org/xmlextras/xmlhttprequest;1"].createInstance(Components.interfaces.nsIXMLHttpRequest); request.onload = loadHandler; request.open("POST", url, true); request.send(values); to make the request, and it works ... mostly. The one problem is that the form has an authentication token on it, and I need to submit that token with my POST. I tried doing a GET separately to get this token, but by the time I made my second (POST) request my session had (evidently) changed, and the authenticity token was considered invalid. Does anyone know of a way to use the XUL/Chrome Javscript to maintain a constant session across multiple requests (all "behind the scenes") for something this? I'm still a XUL n00b, so there may be a totally obvious alternative that I'm missing (eg. hidden IFRAME; I tried that briefly but couldn't get it to work).

    Read the article

  • How would I show an HTML page in Eclipse at Design Time?

    - by 1.21 gigawatts
    When I'm writing crappy code in eclipse and I'm looking at a website for help I am constantly flipping back and forth between the browser and eclipse. To help me write crappy code faster is there a way to have a View that has a web page in it? I need to be able to set the URL and if I'm navigating around the site have a button to have it return to the original URL. So a URL Address box and 1 favorite link. BTW I'm not a Eclipse plugin developer.

    Read the article

< Previous Page | 480 481 482 483 484 485 486 487 488 489 490 491  | Next Page >