Search Results

Search found 4547 results on 182 pages for 'haskell io'.

Page 49/182 | < Previous Page | 45 46 47 48 49 50 51 52 53 54 55 56  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Store data in file system rather than SQL or Oracle database.

    - by nunu
    Hi All, As I am working on Employee Management system, I have two table (for example) in database as given below. EmployeeMaster (DB table structure) EmployeeID (PK) | EmployeeName | City MonthMaster (DB table structure) Month | Year | EmployeeID (FK) | PrenentDays | BasicSalary Now my question is, I want to store data in file system rather than storing data in SQL or ORACLE. I want my data in file system storage for Insert, Edit and Delete opration with keeping relation with objects too. I am a C# developer, Could anybody have thoughts or idea on it. (To store data in file system with keeping relations between them) Thanks in advance. Any ideas on it?

    Read the article

  • How to read from database and write into text file with C#?

    - by user147685
    How to read from database and write into text file? I want to write/copy (not sure what to call) the record inside my database into a text file. One row record in database is equal to one line in the text file. I'm having no problem in database. For creating text file, it mentions FileStream and StreamWriter. Which one should I use?

    Read the article

  • Write problem - lossing the original data

    - by John
    Every time I write to the text file I will lose the original data, how can I read the file and enter the data in the empty line or the next line which is empty? public void writeToFile() { try { output = new Formatter(myFile); } catch(SecurityException securityException) { System.err.println("Error creating file"); System.exit(1); } catch(FileNotFoundException fileNotFoundException) { System.err.println("Error creating file"); System.exit(1); } Scanner scanner = new Scanner (System.in); String number = ""; String name = ""; System.out.println("Please enter number:"); number = scanner.next(); System.out.println("Please enter name:"); name = scanner.next(); output.format("%s,%s \r\n", number, name); output.close(); }

    Read the article

  • How to run a set of SQL queries from a file, in PHP?

    - by Harish Kurup
    I have some set of SQL queries which is in a file(i.e query.sql), and i want to run those queries in files using PHP, the code that i have wrote is not working, //database config's... $file_name="query.sql"; $query==file($file_name); $array_length=count($query); for($i=0;$i<$array_length;$i++) { $data .= $query[$i]; } echo $data; mysql_query($data); it echos the SQL Query from the file but throws an error at mysql_query() function...

    Read the article

  • Modifying File while in use using Java

    - by Marquinio
    Hi all, I have this recurrent Java JAR program tasks that tries to modify a file every 60seconds. Problem is that if user is viewing the file than Java program will not be able to modify the file. I get the typical IOException. Anyone knows if there is a way in Java to modify a file currently in use? Or anyone knows what would be the best way to solve this problem? I was thinking of using the File canRead(), canWrite() methods to check if file is in use. If file is in use then I'm thinking of making a backup copy of data that could not be written. Then after 60 seconds add some logic to check if backup file is empty or not. If backup file is not empty then add its contents to main file. If empty then just add new data to main file. Of course, the first thing I will always do is check if file is in use. Thanks for all your ideas.

    Read the article

  • Python: How to write data in file in specific format?

    - by sasha
    i have an array called MAC1_Val: MAC1_Val array([ 1.00000000e+00, -1.00000000e+01, -2.06306600e+02, 2.22635749e+02, 1.00000000e+00, 1.00000000e+01, 1.00000000e+01, -2.06306600e+02, 2.22635749e+02, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 0.00000000e+00, 1.00000000e+00, -1.08892735e+01, 1.88607749e+01, 1.03153300e+01, -1.78666757e+01, 3.33333333e-07, -3.33333333e-07, -4.21637021e-05, 4.21637021e-05, 9.98844400e-01, -1.73973001e-03, 1.20938900e-03, 1.87742948e-03, -3.33333333e-03, 6.66666667e-03, -3.33333333e-03, -2.64911064e-01, -2.60959501e+01, 2.81614422e+01, 3.33333333e-03, -6.66666667e-03, 3.33333333e-03, 0.00000000e+00, 0.00000000e+00]) and i want to write in file (.txt) values in specific format like this: 1.000000e+00 -1.000000e+01 -2.063066e+02 2.226357e+02 1.000000e+00 1.000000e+01 ....... note that are 6 digits behind floating point any suggestions how to do this? thanks in advance!

    Read the article

  • Efficient way to delete a line from a text file (C#)

    - by Valentin Vasilyev
    Hello. I need to delete a certain line from a text file. What is the most efficient way of doing this? File can be potentially large(over million records). Thank you. UPDATE: below is the code I'm currently using, but I'm not sure if it is good. internal void DeleteMarkedEntries() { string tempPath=Path.GetTempFileName(); using (var reader = new StreamReader(logPath)) { using (var writer = new StreamWriter(File.OpenWrite(tempPath))) { int counter = 0; while (!reader.EndOfStream) { if (!_deletedLines.Contains(counter)) { writer.WriteLine(reader.ReadLine()); } ++counter; } } } if (File.Exists(tempPath)) { File.Delete(logPath); File.Move(tempPath, logPath); } }

    Read the article

  • MFC: Reading entire file to buffer...

    - by deostroll
    I've meddled with some code but I am unable to read the entire file properly...a lot of junk gets appended to the output. How do I fix this? // wmfParser.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include "wmfParser.h" #include <cstring> #ifdef _DEBUG #define new DEBUG_NEW #endif // The one and only application object CWinApp theApp; using namespace std; int _tmain(int argc, TCHAR* argv[], TCHAR* envp[]) { int nRetCode = 0; // initialize MFC and print and error on failure if (!AfxWinInit(::GetModuleHandle(NULL), NULL, ::GetCommandLine(), 0)) { // TODO: change error code to suit your needs _tprintf(_T("Fatal Error: MFC initialization failed\n")); nRetCode = 1; } else { // TODO: code your application's behavior here. CFile file; CFileException exp; if( !file.Open( _T("c:\\sample.txt"), CFile::modeRead, &exp ) ){ exp.ReportError(); cout<<'\n'; cout<<"Aborting..."; system("pause"); return 0; } ULONGLONG dwLength = file.GetLength(); cout<<"Length of file to read = " << dwLength << '\n'; /* BYTE* buffer; buffer=(BYTE*)calloc(dwLength, sizeof(BYTE)); file.Read(buffer, 25); char* str = (char*)buffer; cout<<"length of string : " << strlen(str) << '\n'; cout<<"string from file: " << str << '\n'; */ char str[100]; file.Read(str, sizeof(str)); cout << "Data : " << str <<'\n'; file.Close(); cout<<"File was closed\n"; //AfxMessageBox(_T("This is a test message box")); system("pause"); } return nRetCode; }

    Read the article

  • Homemade fstat to get file size, always return 0 length.

    - by Fred
    Hello, I am trying to use my own function to get the file size from a file. I'll use this to allocate memory for a data structure to hold the information on the file. The file size function looks like this: long fileSize(FILE *fp){ long start; fflush(fp); rewind(fp); start = ftell(fp); return (fseek(fp, 0L, SEEK_END) - start); } Any ideas what I'm doing wrong here?

    Read the article

  • Java I/O: How to append to an already existing text file.

    - by Joe
    Hi I am having no problem writing to or appending to a file, the only problem is that as soon as I quit the program and then run it again, it creates a new file overwriting my original file. This is a problem, as I am using the text file to keep a running tally. Is there a way to get an already created text file as an object and then append to it? Thanks in advance.

    Read the article

  • unix shell, redirect output but keep on stdin

    - by Mike
    I'd like to have a shell script redirect stdout of a child process in the following manner Redirect stdout to a file Display the output of the process in real time I know I could do something like #!/bin/sh ./child > file cat file But that would not display stdout in real time. For instance, if the child was #!/bin/sh echo 1 sleep 1 echo 2 The user would see "1" and "2" printed at the same time

    Read the article

  • Make Directory.GetFiles() ignore protected folders

    - by Kryptic
    Hello Everyone, I'm using the Directory.GetFiles() method to get a list of files to operate on. This method throws an UnauthorizedAccessException for example when trying to access a protected folder. I would like it to simply skip over such folders and continue. How can I accomplish this with either Directory.GetFiles (preferably) or another method? Update: Here is the code that throws the exception. I am asking the user to select a directory and then retrieving the list of files. I commented out the code (so this is now whole method) that iterates through the files and the problem still occurs. The exception is thrown on the Directory.GetFiles() line. FolderBrowserDialog fbd = new FolderBrowserDialog(); DialogResult dr = fbd.ShowDialog(); if (dr == System.Windows.Forms.DialogResult.Cancel) return; string directory = fbd.SelectedPath; string[] files = Directory.GetFiles(directory, "*.html", SearchOption.AllDirectories);

    Read the article

  • Android: How do you delete a folder starts with period

    - by jclova
    I am trying to delete a folder in sdcard. I can delete normal directories, but a directory that starts with period cannot be deleted. (ex. ".helloDir") if (dir.isDirectory()) { String[] children = dir.list(); for (int i = 0; i < children.length; i++) { new File(dir, children[i]).delete(); } } children is null if dir starts with period (ex. ".helloDir").

    Read the article

  • What is the magic behind perl read() function and buffer which is not a ref ?

    - by alex8657
    I do not get to understand how the Perl read($buf) function is able to modify the content of the $buf variable. $buf is not a reference, so the parameter is given by copy (from my c/c++ knowledge). So how come the $buf variable is modified in the caller ? Is it a tie variable or something ? The C documentation about setbuf is also quite elusive and unclear to me # Example 1 $buf=''; # It is a scalar, not a ref $bytes = $fh->read($buf); print $buf; # $buf was modified, what is the magic ? # Example 2 sub read_it { my $buf = shift; return $fh->read($buf); } my $buf; $bytes = read_it($buf); print $buf; # As expected, this scope $buf was not modified

    Read the article

  • How to copy files without slowing down my app?

    - by Kevin Gebhardt
    I have a bunch of little files in my assets which need to be copied to the SD-card on the first start of my App. The copy code i got from here placed in an IntentService works like a charm. However, when I start to copy many litte files, the whole app gets increddible slow (I'm not really sure why by the way), which is a really bad experience for the user on first start. As I realised other apps running normal in that time, I tried to start a child process for the service, which didn't work, as I can't acess my assets from another process as far as I understood. Has anybody out there an idea how a) to copy the files without blocking my app b) to get through to my assets from a private process (process=":myOtherProcess" in Manifest) or c) solve the problem in a complete different way Edit: To make this clearer: The copying allready takes place in a seperate thread (started automaticaly by IntentService). The problem is not to separate the task of copying but that the copying in a dedicated thread somehow affects the rest of the app (e.g. blocking to many app-specific resources?) but not other apps (so it's not blocking the whole CPU or someting) Edit2: Problem solved, it turns out, there wasn't really a problem. See my answer below.

    Read the article

  • Improving File Read Performance (single file, C++, Windows)

    - by david
    I have large (hundreds of MB or more) files that I need to read blocks from using C++ on Windows. Currently the relevant functions are: errorType LargeFile::read( void* data_out, __int64 start_position, __int64 size_bytes ) const { if( !m_open ) { // return error } else { seekPosition( start_position ); DWORD bytes_read; BOOL result = ReadFile( m_file, data_out, DWORD( size_bytes ), &bytes_read, NULL ); if( size_bytes != bytes_read || result != TRUE ) { // return error } } // return no error } void LargeFile::seekPosition( __int64 position ) const { LARGE_INTEGER target; target.QuadPart = LONGLONG( position ); SetFilePointerEx( m_file, target, NULL, FILE_BEGIN ); } The performance of the above does not seem to be very good. Reads are on 4K blocks of the file. Some reads are coherent, most are not. A couple questions: Is there a good way to profile the reads? What things might improve the performance? For example, would sector-aligning the data be useful? I'm relatively new to file i/o optimization, so suggestions or pointers to articles/tutorials would be helpful.

    Read the article

  • Can't access my files in ASP.NET web site

    - by jumbojs
    I'm having a very difficult time. I am running windows 2008 server, I have an Able Commerce site using ASP.NET with C#. I'm writing an automated task that will ftp some xml files down into a local directory on our web server and then the program parses the xml file and saves information to our database. The problem, once I save the files to our local directory, my program has no access to the files. The NETWORK SERVICE user permissions isn't being inherited by the xml files so my program can't do anything with them. I can manually change the permissions, but this wouldn't be automated and won't work. How can I get this to work? help please, it's very frustrating.

    Read the article

  • VB.NET 2008, Windows 7 and saving files

    - by James Brauman
    Hello, We have to learn VB.NET for the semester, my experience lies mainly with C# - not that this should make a difference to this particular problem. I've used just about the most simple way to save a file using the .NET framework, but Windows 7 won't let me save the file anywhere (or anywhere that I have found yet). Here is the code I am using to save a text file. Dim dialog As FolderBrowserDialog = New FolderBrowserDialog() Dim saveLocation As String = dialog.SelectedPath ... Build up output string ... Try ' Try to write the file. My.Computer.FileSystem.WriteAllText(saveLocation, output, False) Catch PermissionEx As UnauthorizedAccessException ' We do not have permissions to save in this folder. MessageBox.Show("Do not have permissions to save file to the folder specified. Please try saving somewhere different.", "Error", MessageBoxButtons.OK, MessageBoxIcon.Error) Catch Ex As Exception ' Catch any exceptions that occured when trying to write the file. MessageBox.Show("Writing the file was not successful.", "Error", MessageBoxButtons.OK, MessageBoxIcon.Error) End Try The problem is that this using this code throws an UnauthorizedAccessException no matter where I try to save the file. I've tried running the .exe file as administrator, and the IDE as administrator. Is this just Windows 7 being overprotective? And if so, what can I do to solve this problem? The requirements state that I be able to save a file! Thanks.

    Read the article

  • Parsing CSV File to MySQL DB in PHP

    - by Austin
    I have a some 350-lined CSV File with all sorts of vendors that fall into Clothes, Tools, Entertainment, etc.. categories. Using the following code I have been able to print out my CSV File. <?php $fp = fopen('promo_catalog_expanded.csv', 'r'); echo '<tr><td>'; echo implode('</td><td>', fgetcsv($fp, 4096, ',')); echo '</td></tr>'; while(!feof($fp)) { list($cat, $var, $name, $var2, $web, $var3, $phone,$var4, $kw,$var5, $desc) = fgetcsv($fp, 4096); echo '<tr><td>'; echo $cat. '</td><td>' . $name . '</td><td><a href="http://www.' . $web .'" target="_blank">' .$web.'</a></td><td>'.$phone.'</td><td>'.$kw.'</td><td>'.$desc.'</td>' ; echo '</td></tr>'; } fclose($file_handle); show_source(__FILE__); ?> First thing you will probably notice is the extraneous vars within the list(). this is because of how the excel spreadsheet/csv file: Category,,Company Name,,Website,,Phone,,Keywords,,Description ,,,,,,,,,, Clothes,,4imprint,,4imprint.com,,877-466-7746,,"polos, jackets, coats, workwear, sweatshirts, hoodies, long sleeve, pullovers, t-shirts, tees, tshirts,",,An embroidery and apparel company based in Wisconsin. ,,Apollo Embroidery,,apolloemb.com,,1-800-982-2146,,"hats, caps, headwear, bags, totes, backpacks, blankets, embroidery",,An embroidery sales company based in California. One thing to note is that the last line starts with two commas as it is also listed within "Clothes" category. My concern is that I am going about the CSV output wrong. Should I be using a foreach loop instead of this list way? Should I first get rid of any unnecessary blank columns? Please advise any flaws you may find, improvements I can use so I can be ready to import this data to a MySQL DB.

    Read the article

  • iphone file download not working

    - by Anonymous
    Hi, In my app I 'm first connecting to a web service, which in return sends a url for a file. I use the url to download the file and then display it on the new view. I get the correct URL but not able to download file from that location. I have another test app which will download file from the same location and it works like a charm. following is my code for webservice-file download. This is a snippet of the code where i 'm parsing the web service xml and then pass the result to NSData for file download. Any suggestions where am i going wrong -- I 'm referring to the following tutorials. Web Service PDF Viewer if ([elementName isEqualToString:@"PRHPdfResultsResult"]) { NSLog(soapResults); UIAlertView *alert = [[UIAlertView alloc] initWithTitle:@"Report downloaded from:" message:soapResults delegate:self cancelButtonTitle:@"OK" otherButtonTitles:nil]; NSData *pdfData = [[NSData alloc] initWithContentsOfURL:[NSURL URLWithString:soapResults]]; //Store the Data locally as PDF File NSString *resourceDocPath = [[NSString alloc] initWithString:[[[[NSBundle mainBundle] resourcePath] stringByDeletingLastPathComponent] stringByAppendingPathComponent:@"Documents"]]; NSString *filePath = [resourceDocPath stringByAppendingPathComponent:@"myPDF.pdf"]; [pdfData writeToFile:filePath atomically:YES]; [alert show]; [alert release]; [soapResults setString:@""]; elementFound = FALSE; }

    Read the article

< Previous Page | 45 46 47 48 49 50 51 52 53 54 55 56  | Next Page >