Search Results

Search found 14506 results on 581 pages for 'document scanner'.

Page 494/581 | < Previous Page | 490 491 492 493 494 495 496 497 498 499 500 501  | Next Page >

  • opening a new page and passing a parameter to it with Javascript

    - by recipriversexclusion
    I have a JS function that processes XML I GET from a server to dynamically create a table as below // Generate table of services by parsing the returned XML service list. function convertServiceXmlDataToTable(xml) { var tbodyElem = document.getElementById("myTbody"); var trElem, tdElem; var j = 0; $(xml).find("Service").each(function() { trElem = tbodyElem.insertRow(tbodyElem.rows.length); trElem.className = "tr" + (j % 2); // first column -> service ID var serviceID = $(this).attr("service__id"); tdElem = trElem.insertCell(trElem.cells.length); tdElem.className = "col0"; tdElem.innerHTML = serviceID; // second column -> service name tdElem = trElem.insertCell(trElem.cells.length); tdElem.className = "col1"; tdElem.innerHTML = "<a href=javascript:showServiceInfo(" + serviceID + ")>" + $(this).find("name").text() + "</a>"; j++; }); // each service } where showServiceInfo retrieves more detailed information about each service from the server based on the serviceID and displays it in the same page as the services table. So far so good. But, it turns out that I have to display the detailed service information in another page rather than the same page as the table. I have creates a generic service_info.html with an empty layout template, but I don't understand how to pass serviceID to this new page so that it gets customized with the detailed service info. How can I do this? Or, is there a better way to handle these situations? Thanks!

    Read the article

  • jQuery when div is clicked update input field issue

    - by stogdilla
    Hello, I'm rather new to jquery so this may be the issue. I have a script that outputs several divs all with different text data in them. I would like it when I click one of them that an input field's value is updated to that text currently I have: <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.1/jquery.min.js"></script> <script type="text/javascript"> $(document).ready(function() { $("a.results]").click(function() { data= this.text(); $("#updateme").val(data); }); }); </script> <p> <label>Field <input type="text" name="updateme" id="updateme"> </label> </p> <a href="#" class="results">Florida</a> <a href="#" class="results">Florida 2</a> <a href="#" class="results">Florida 3</a> How can I make it so that whatever link is clicked that is the data that gets updated into the input's value? I can get it to take one or I can script out different cases of each changing the class name but I think there has to be a way where it references whatever link is being clicked instead of what it's currently doing. Thanks in advance!

    Read the article

  • Why don't copy this dokument attributes from the source xml file??

    - by siegfried storr
    Hi anyone, i'm working the first time with xslt and i really don't understand why this xsl don't copy attributes from the source xml. Perhaps someone can give me a hint?? <xsl:stylesheet version="2.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:output omit-xml-declaration="yes" indent="yes"/> <xsl:variable name="rpl" select="document('ParamInvoice.xml')"/> <xsl:template match="/"> <xsl:copy> <xsl:apply-templates select="* | @*"/> </xsl:copy> </xsl:template> <xsl:template match="*"> <xsl:variable name="vInvoiceElement" select="$rpl/StoraInvoice/*[name()=name(current())]"/> <xsl:copy> <xsl:if test="$vInvoiceElement/Attribute"> <xsl:call-template name="AttributeErzeugen"> <xsl:with-param name="pAttr" select="$vInvoiceElement/Attribute"/> </xsl:call-template> </xsl:if> <xsl:apply-templates/> </xsl:copy> </xsl:template> <xsl:template name="AttributeErzeugen"> <xsl:param name="pAttr"/> <xsl:for-each select="$pAttr"> <xsl:attribute name="{@name}"><xsl:value-of select="."/></xsl:attribute> </xsl:for-each> </xsl:template> </xsl:stylesheet>

    Read the article

  • Can someone tell me why this JavaScript code isn't lining up an array in order?

    - by DarkLightA
    Live code: http://jsfiddle.net/fCUZC/ //INPUT ARRAY: var input = [28,32,21,11,8,2,14,32,64]; //VARIABLE DECLARATION. a = highest number so far, b = position of that number entireLoop: for (var i = 1; i<=input.length; i++) { if(input[i] > input[i-1]) { for(var o = i; o>=0; o--) { if(input[i-1] > input[o]) { input.splice(i,0,input[o]); input.splice((o+1),1); continue entireLoop; } else if(input[o] > input[0]) { input.splice(0,0,input[o]); input.splice((o+1),1); continue entireLoop; } } } } document.write(input); I'm trying to order the array from largest to smallest, but there's a 32 stuck somewhere. I know there's the sort method, but I'm a newbie and want to try this for myself.

    Read the article

  • How do I get NHibernate to work with .NET Framework 2.0?

    - by Daniel Dolz
    I can not make NHibernate 2.1 work in machines without framework 3.X (basically, windows 2000 SP4, although it happens with XP too). NHibernate doc do not mention this. Maybe you can help? I NEED to make NHibernate 2.1 work in Windows 2000 PCs, do you think this can be done? PD: DataBase is SQL 2000/2005. Error is: NHibernate.MappingException: Could not compile the mapping document: Datos.NH_VEN_ComprobanteBF.hbm.xml ---> NHibernate.HibernateException: Could not instantiate dialect class NHibernate.Dialect.MsSql2000Dialect ---> System.Reflection.TargetInvocationException: Se produjo una excepción en el destino de la invocación. ---> System.TypeInitializationException: Se produjo una excepción en el inicializador de tipo de 'NHibernate.NHibernateUtil'. ---> System.TypeLoadException: No se puede cargar el tipo 'System.DateTimeOffset' del ensamblado'mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089'. en NHibernate.Type.DateTimeOffsetType.get_ReturnedClass() en NHibernate.NHibernateUtil..cctor() --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect..ctor() en NHibernate.Dialect.MsSql2000Dialect..ctor() --- Fin del seguimiento de la pila de la excepción interna --- en System.RuntimeTypeHandle.CreateInstance(RuntimeType type, Boolean publicOnly, Boolean noCheck, Boolean& canBeCached, RuntimeMethodHandle& ctor, Boolean& bNeedSecurityCheck) en System.RuntimeType.CreateInstanceSlow(Boolean publicOnly, Boolean fillCache) en System.RuntimeType.CreateInstanceImpl(Boolean publicOnly, Boolean skipVisibilityChecks, Boolean fillCache) en System.Activator.CreateInstance(Type type, Boolean nonPublic) en NHibernate.Bytecode.ActivatorObjectsFactory.CreateInstance(Type type) en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) en NHibernate.Dialect.Dialect.GetDialect(IDictionary`2 props) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Cfg.Configuration.LogAndThrow(Exception exception) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) en NHibernate.Cfg.Configuration.ProcessMappingsQueue() and continues...

    Read the article

  • JQuery tablesorter - Second click on column header doesn't resort

    - by Jonathan
    I'm using tablesorter in on a table I added to a view in django's admin (although I'm not sure this is relevant). I'm extending the html's header: {% block extrahead %} <script type="text/javascript" src="http://code.jquery.com/jquery-1.4.2.js"></script> <script type="text/javascript" src="http://mysite.com/media/tablesorter/jquery.tablesorter.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#myTable").tablesorter(); } ); </script> {% endblock %} When I click on a column header, it sorts the table using this column in descending order - that's ok. When I click the same column header a second time - it does not reorder to ascending order. What's wrong with it? the table's html looks like: <table id="myTable" border="1"> <thead> <tr> <th>column_name_1</th> <th>column_name_2</th> <th>column_name_3</th> </tr> </thead> <tbody> {% for item in extra.items %} <tr> <td>{{ item.0|safe }} </td> <td>{{ item.1|safe }} </td> <td>{{ item.2|safe }} </td> </tr> {% endfor %} </tbody> </table>

    Read the article

  • Testing approach for multi-threaded software

    - by Shane MacLaughlin
    I have a piece of mature geospatial software that has recently had areas rewritten to take better advantage of the multiple processors available in modern PCs. Specifically, display, GUI, spatial searching, and main processing have all been hived off to seperate threads. The software has a pretty sizeable GUI automation suite for functional regression, and another smaller one for performance regression. While all automated tests are passing, I'm not convinced that they provide nearly enough coverage in terms of finding bugs relating race conditions, deadlocks, and other nasties associated with multi-threading. What techniques would you use to see if such bugs exist? What techniques would you advocate for rooting them out, assuming there are some in there to root out? What I'm doing so far is running the GUI functional automation on the app running under a debugger, such that I can break out of deadlocks and catch crashes, and plan to make a bounds checker build and repeat the tests against that version. I've also carried out a static analysis of the source via PC-Lint with the hope of locating potential dead locks, but not had any worthwhile results. The application is C++, MFC, mulitple document/view, with a number of threads per doc. The locking mechanism I'm using is based on an object that includes a pointer to a CMutex, which is locked in the ctor and freed in the dtor. I use local variables of this object to lock various bits of code as required, and my mutex has a time out that fires my a warning if the timeout is reached. I avoid locking where possible, using resource copies where possible instead. What other tests would you carry out?

    Read the article

  • Add xml-stylesheet and get standalone = yes.

    - by tumba25
    The code at the bottom is what I have. I removed the creation of all tags. At the top in the xml file I get.<?xml version="1.0" encoding="UTF-8" standalone="no"?> Note that standalone is no, even thou I have it set to yes. The first question: How do I get standalone = yes? I would like to add <?xml-stylesheet type="text/xsl" href="my.stylesheet.xsl"?> at line two in the xml file. Second question: How do I do that? Some useful links? Anything? DocumentBuilderFactory dbfac = DocumentBuilderFactory.newInstance(); DocumentBuilder docBuilder = dbfac.newDocumentBuilder(); Document doc = docBuilder.newDocument(); <cut> TransformerFactory transfac = TransformerFactory.newInstance(); transfac.setAttribute("indent-number", new Integer(2)); Transformer trans = transfac.newTransformer(); trans.setOutputProperty(OutputKeys.OMIT_XML_DECLARATION, "no"); trans.setOutputProperty(OutputKeys.STANDALONE, "yes"); trans.setOutputProperty(OutputKeys.INDENT, "yes"); trans.setOutputProperty(OutputKeys.CDATA_SECTION_ELEMENTS, "name"); FileOutputStream fout = new FileOutputStream(filepath); BufferedOutputStream bout= new BufferedOutputStream(fout); trans.transform(new DOMSource(doc), new StreamResult(new OutputStreamWriter(bout, "utf-8")));

    Read the article

  • Jquery Returning values to original

    - by Cam
    So my script works perfectly, but here is the issue, I have buttons (Sprite action here) that are 40px height, but the top 20 only shows perfectly. When you click the button ie img the bottom 20px show perfecto! but... Issue, i included in my script a way to return all others to there default (only one should be selected) now, how can I fix this issue that I seem unable to correct as I can select multiple of them ** USERS can switch ** The last part of the script that is the issue. Thanks $(document).ready(function() { $('.form_sub').hide(); $('.theader').addClass('active'); $('.theader_t').click(function() { $('.form_header').show(); $('.form_sub').hide(); $('.theader').addClass('active'); $('.sub_theader').removeClass('active'); }); $('.sub_theader_t').click(function() { $('.form_header').hide(); $('.form_sub').show(); $('.theader').removeClass('active'); $('.sub_theader').addClass('active'); }); $('.top_head_img').click(function() { $(this).css({ position: 'relative', bottom: '20px' }).siblings().css( 'bottom', '0' ); }); }); <ul class="top_head"> <li> <a href="javascript:void(0)" onClick="selectPic5('top');"><img src="custom/images/top2.jpg" alt="Left" border="0" class="top_head_img"/></a> </li> <li> <a href="javascript:void(0)" onClick="selectPic5('center');"><img src="custom/images/mid2.jpg" alt="Center" border="0" class="top_head_img"/></a> </li> <li> <a href="javascript:void(0)" onClick="selectPic5('bottom');"><img src="custom/images/bot2.jpg" alt="Right" border="0" class="top_head_img"/></a> </li> </ul>

    Read the article

  • jQuery/ajax working on IIS5.1 but not IIS6

    - by Mikejh99
    I'm running a weird issue here. I have code that makes jquery ajax calls to a web service and dynamically adds controls using jquery. Everything works fine on my dev machine running IIS 5.1, but not when deployed to IIS 6. I'm using VS2010/ASP.Net 4.0, C#, jQuery 1.4.2 and jQuery UI 1.8.1. I'm using the same browser for each. It partially works though. The code will add the controls to the page, but they aren't visible until I click them (they aren't visible though). I thought this was a css issue, but the styles are there too. The ajax calls look like this: $.ajax({ url: "/WebServices/AssetManager.asmx/Assets", type: "POST", datatype: "json", async: false, data: "{'q':'" + req.term + "', 'type':'Condition'}", contentType: "application/javascript; charset=utf-8", success: function (data) { res($.map(data.d, function (item) { return { label: item.Name, value: item.Name, id: item.Id, datatype: item.DataType } })) } }) Changing the content-type makes the autocomplete fail. I've quadruple checked and all the paths are correct, there is no document footer enabled in IIS, and I'm not using IIS compression. Any idea why the page will display and work properly in IIS 5 but only partially in IIS 6? (If it failed completely, that'd make more sense!). Is it a jQuery or CSS issue?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Indexing and Searching Over Word Level Annotation Layers in Lucene

    - by dmcer
    I have a data set with multiple layers of annotation over the underlying text, such as part-of-tags, chunks from a shallow parser, name entities, and others from various natural language processing (NLP) tools. For a sentence like The man went to the store, the annotations might look like: Word POS Chunk NER ==== === ===== ======== The DT NP Person man NN NP Person went VBD VP - to TO PP - the DT NP Location store NN NP Location I'd like to index a bunch of documents with annotations like these using Lucene and then perform searches across the different layers. An example of a simple query would be to retrieve all documents where Washington is tagged as a person. While I'm not absolutely committed to the notation, syntactically end-users might enter the query as follows: Query: Word=Washington,NER=Person I'd also like to do more complex queries involving the sequential order of annotations across different layers, e.g. find all the documents where there's a word tagged person followed by the words arrived at followed by a word tagged location. Such a query might look like: Query: "NER=Person Word=arrived Word=at NER=Location" What's a good way to go about approaching this with Lucene? Is there anyway to index and search over document fields that contain structured tokens?

    Read the article

  • Jquery selectors question

    - by Ben
    Hi all, I am not an expert at jquery but trying to get a menu to work. Basically, I have a menu made of up to 3 levels of nested lists. The first level has a little arrow has a background image that opens or close when opening the first level list. Any other nested lists don't need to have the background image. My script opens the menu when you click on it and is also supposed to switch the first level list from a class "inactive" to a class "active". Here is the script: $(document).ready(function(){ $("#left-navigation-holder ul.level1 li.inactive").toggle(function(){ $(this).addClass("active"); }, function () { $(this).removeClass("active"); }); $("#left-navigation-holder li a").click(function(){ menu = $(this).parent('li').children('ul'); menu.toggle(); }); }); The problem is that the toggle function also happens when clicking on second and third level lists causing the arrows to toggle even if the first level list isn't clicked on. I thought using $("#left-navigation-holder ul.level1 li.inactive").toggle would limit the function to the first level list with a class "inactive". Any help would be really appreciated. Ben

    Read the article

  • Syntax for documenting JSON structure

    - by Roman A. Taycher
    So I'm trying to document the format of the json returned by an api I am writing against and I'd like to know if there is any popular format for the documentation of json structure. Note I'm not trying to to test or validate anything, I'm just using this for documentation. Also some ways to add comments to non-constants(items always returned w/ the same value) would be nice. This the not totally thought out scheme I'm currently using: Plain names refer to identifiers or types. Some types have type-comment Strings that appear to be constant(always returned for that type of request) strings are "str" Constant Numbers would be just the number Constant null is null Booleans are true/false for constant booleans or Boolean otherwise [a,b,c] are lists with 3 items a,b,c [... ...] is a list of repeating elements of some types/constants/patterns {a:A,b:B,c:c} and {... ...} is the same for a dictionary. example: story := [header,footer] header := {"data":realHeader,"kind":"Listing"} realHeader := {"after": null, "before": null, "children": [{"data": realRealHeader, "kind": "t3"}], "modhash": ""} footer := {"data":AlmostComments,"kind":"Listing"} AlmostComments := {"data": {"after": null, "before": null, "children": comments, "modhash": ""}, "kind": "t1"} comments := [...{"data":comment, "kind":"t1"}...] realRealHeader := {"author": string, "clicked": boolean, "created": int, "created_utc": int, "domain": "code.reddit.com", "downs": int, "hidden": boolean, "id": string-id, "is_self": boolean, "levenshtein": null, "likes": null, "media": null, "media_embed": { }, "name": string-id, "num_comments": int, "over_18": false, "permalink": string-urlLinkToStoryStartingFrom/r, "saved": false, "score": int, "selftext": string, "selftext_html": string-html, "subreddit": string-subredditname, "subreddit_id": string-id, "thumbnail": "", "title": string, "ups": int, "url": "http://code.reddit.com/" } comments := { "author": string, "body": string-body_html-wout-html, "body_html": string-html-formated, "created": int, "created_utc": int, "downs": int, "id": string-id, "levenshtein": null, "likes": null, "link_id": string-id, "name": string-id", "parent_id": string-id, "replies": AlmostComments or null, "subreddit": string-subredditname, "subreddit_id": string-id, "ups": int }

    Read the article

  • Issue reading in a cell from Excel with Apache POI

    - by Nick
    I am trying to use Apache POI to read in old (pre-2007 and XLS) Excel files. My program goes to the end of the rows and iterates back up until it finds something that's not either null or empty. Then it iterates back up a few times and grabs those cells. This program works just fine reading in XLSX and XLS files made in Office 2010. I get the following error message: Exception in thread "main" java.lang.NumberFormatException: empty String at sun.misc.FloatingDecimal.readJavaFormatString(Unknown Source) at java.lang.Double.parseDouble(Unknown Source) at the line: num = Double.parseDouble(str); from the code: str = cell.toString(); if (str != "" || str != null) { System.out.println("Cell is a string"); num = Double.parseDouble(str); } else { System.out.println("Cell is numeric."); num = cell.getNumericCellValue(); } where the cell is the last cell in the document that's not empty or null. When I try to print the first cell that's not empty or null, it prints nothing, so I think I'm not accessing it correctly.

    Read the article

  • Problem uploading app to google app engine

    - by Oberon
    I'm having problems uploading an app to the google-app-engine from my work place. I believe the problem is related to proxy, because I do not see the same problem when following the same procedure from home. (I do not specify HTTP_PROXY from home). These are the commands I run: HTTP_PROXY=http://proxy.<thehostname>.com:8080 HTTP_PROXY=https://proxy.<thehostname>.com:8080 appcfg.py --insecure update myappfolder When running the commands I get prompted for email and password, as expected, but after that it immediately exits with this errormessage: Error 302: --- begin server output --- <HTML> <HEAD> <TITLE>Moved Temporarily</TITLE> </HEAD> <BODY BGCOLOR="#FFFFFF" TEXT="#000000"> <H1>Moved Temporarily</H1> The document has moved <A HREF="https://www.google.com/accounts/ClientLogin">here</A>. </BODY> </HTML> --- end server output --- Note: I added the --insecure option because else it gave a warning of missing ssl module. Any idea how to solve or workaround this problem?

    Read the article

  • how do I call a javacript function every 60 seconds?

    - by William
    So I'm trying to work on a Canvas demo, and I want this square to move from one side to the other, but I can't figure out how to call javascript in a way that repeats every 60 seconds. Here's what I got so far: <!DOCTYPE html> <html lang="en"> <head> <title>Canvas test</title> <meta charset="utf-8" /> <link href="/bms/style.css" rel="stylesheet" /> <style> body { text-align: center; background-color: #000000;} canvas{ background-color: #ffffff;} </style> <script type="text/javascript"> var x = 50; var y = 250; function update(){ draw(); x = x + 5; } function draw(){ var canvas = document.getElementById('screen1'); if (canvas.getContext){ var ctx = canvas.getContext('2d'); ctx.fillStyle = 'rgb(236,138,68)'; ctx.fillRect(x,y,24,24); } } </script> </head> <body onLoad="setTimeout(update(), 0);"> <canvas id="screen1" width="500" height="500"></canvas> </body> </html>

    Read the article

  • Embedding XSL Stylesheet into XML

    - by user700996
    I have the following XML: <?xml version="1.0" encoding="ISO-8859-1"?> <?xml-stylesheet type="text/xsl" href="http://www.fakedomain.com/sally.xsl"?> And the following content in sally.xsl: <?xml version="1.0" encoding="ISO-8859-1"?> <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:template match="/"> <html> <body> <xsl:for-each select="documentcollection/document"> <p> <xsl:for-each select="rss/channel/item"> <xsl:value-of select="title"/><br /> <xsl:value-of select="description"/><br /> <xsl:value-of select="link"/><br /> </xsl:for-each> </p> </xsl:for-each> </body> </html> </xsl:template> </xsl:stylesheet> However, the browser displays the XML as though the XSL line is not present. Do you know why the browser is ignoring the XSL stylesheet? Is the style sheet wrong? Thanks

    Read the article

  • Set .aspx page title to that of an Eval

    - by user1860529
    I am trying to use an <%# Eval("name") %> to be the title of my page. I can't seem to figure out any solutions online. I have tried the other StackOverflow question but that did now work either. The page is a bio.aspx and on the site it is displayed as bio.aspx?id=123 so the page title needs to vary depending on the ID. I figured I could just use the Eval("name") but no luck yet. I currently am using JavaScript: window.onload = function() { document.title = '<%# Eval("name") %> | Title Line'; } This works, but it still leaves the title tags empty, and it's kind of spammy. Here is the codebehind: using System; using System.Data; using System.Configuration; using System.Collections; using System.Web; using System.Web.Security; using System.Web.UI; using System.Web.UI.WebControls; using System.Web.UI.WebControls.WebParts; using System.Web.UI.HtmlControls; public partial class DoctorBio : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { Page.Title = "Your Page Title"; HtmlMeta metaDescription = new HtmlMeta(); metaDescription.Name = "description"; metaDescription.Content = "brief description"; Page.Header.Controls.Add(metaDescription); HtmlMeta metaKeywords = new HtmlMeta(); metaKeywords.Name = "keywords"; metaKeywords.Content = "keywords, keywords"; Page.Header.Controls.Add(metaKeywords); } protected void SetPageTitle(object title) { this.Title = title.ToString(); } protected string ReplaceLineBreaks(object text) { string newText = text as string; if (newText == null) { return string.Empty; } return newText.Replace("\r\n", "<br />"); } }

    Read the article

  • Choosing a W3C valid DOCTYPE and charset combination?

    - by George Carter
    I have a homepage with the following: <DOCTYPE html> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"> My choice of the DOCTYPE "html" is based on a recommendation for html pages using jQuery. My choice of charset=utf=8 is based on a recommendation to make my pages readable on most browsers. But these choices may be wrong. When I run this page thru the W3C HTML validator, I get messages you see below. Any way I can eliminate the 2 errors? ! Using experimental feature: HTML5 Conformance Checker. The validator checked your document with an experimental feature: HTML5 Conformance Checker. This feature has been made available for your convenience, but be aware that it may be unreliable, or not perfectly up to date with the latest development of some cutting-edge technologies. If you find any issue with this feature, please report them. Thank you. Validation Output: 2 Errors 1. Error Line 18, Column 70: Changing character encoding utf-8 and reparsing. …ntent-Type" content="text/html; charset=utf-8"> 2. Error Line 18, Column 70: Changing encoding at this point would need non-streamable behavior. …ntent-Type" content="text/html; charset=utf-8">

    Read the article

  • How to access child div elements under a given condition with javascript?

    - by hlovdal
    My main question is to calculate the last alert message, but any other information is also welcome. I am trying to learn javascript (to use with greasemonkey later), but I am struggling a bit to grasp the DOM and how to process it. <html> <head> <script type="text/javascript"> function my_test() { var elements = document.getElementsByTagName("div"); // prints "found [object HTMLCollection] with length 8" alert("found " + elements + " with length " + elements.length); // prints "0:[object HTMLDivElement]" alert("0:" + elements[0]); // how to calculate the following? alert("for intereting one is AAAA and three is CCCC"); } </script> </head> <body> <div class="interesing"> <div class="one">AAAA</div> <div class="two">BBBB</div> <div class="three">CCCC</div> </div> <div class="boring"> <div class="one">1111</div> <div class="two">2222</div> <div class="three">3333</div> </div> <input type="button" onclick="my_test()" value="my test" </body> </html> So elements is now an array of elements and I can access each of them individually. But where can I find what methods/properties these elements have?

    Read the article

  • macro collapse all in solution visual studio 2010

    - by rod
    Hi All, I found the CollapseAll macro online that has worked for me in vs2005 and vs2008. However, this half way works in vs2010. It looks like it only collapses the top nodes and not any subnodes that may be expanded? any ideas? Thanks, rod. Sub CollapseAll() ' Get the the Solution Explorer tree Dim UIHSolutionExplorer As UIHierarchy UIHSolutionExplorer = DTE.Windows.Item(Constants.vsext_wk_SProjectWindow).Object() ' Check if there is any open solution If (UIHSolutionExplorer.UIHierarchyItems.Count = 0) Then ' MsgBox("Nothing to collapse. You must have an open solution.") Return End If ' Get the top node (the name of the solution) Dim UIHSolutionRootNode As UIHierarchyItem UIHSolutionRootNode = UIHSolutionExplorer.UIHierarchyItems.Item(1) UIHSolutionRootNode.DTE.SuppressUI = True ' Collapse each project node Dim UIHItem As UIHierarchyItem For Each UIHItem In UIHSolutionRootNode.UIHierarchyItems 'UIHItem.UIHierarchyItems.Expanded = False If UIHItem.UIHierarchyItems.Expanded Then Collapse(UIHItem) End If Next ' Select the solution node, or else when you click ' on the solution window ' scrollbar, it will synchronize the open document ' with the tree and pop ' out the corresponding node which is probably not what you want. UIHSolutionRootNode.Select(vsUISelectionType.vsUISelectionTypeSelect) UIHSolutionRootNode.DTE.SuppressUI = False End Sub Private Sub Collapse(ByVal item As UIHierarchyItem) For Each eitem As UIHierarchyItem In item.UIHierarchyItems If eitem.UIHierarchyItems.Expanded AndAlso eitem.UIHierarchyItems.Count > 0 Then Collapse(eitem) End If Next item.UIHierarchyItems.Expanded = False End Sub End Module

    Read the article

  • How to select LI except first and second ?

    - by Wazdesign
    Here is the structure of the content, I want to select all LI except the first two (ie no-link) jQuery(document).ready(function(){ var nosubnav = jQuery('.first-level li:not(:has(ul))'); var nosubnavsize = jQuery('.first-level li:not(:has(ul))').size(); jQuery(nosubnav).css('border' , '1px solid red'); alert('List item which does not have submenu '+nosubnavsize); }); div class="navigation-container"> <ul class="first-level"> <li><a href="#">No Link</a></li> <li><a href="#">No Link</a></li> <li><a href="#">Link 1</a></li> <li><a href="#">Link 2</a> <ul> <li><a href="#">Link2.1</a></li> <li><a href="#">Link2.2</a> <ul> <li><a href="#">Link 2.2.1</a></li> </ul> </li> </ul> </li> <li><a href="#">Link </a></li> </ul> </div> related Question : http://stackoverflow.com/questions/2771801/how-to-count-li-which-does-not-have-ul

    Read the article

  • Why doesn't Javascript recognize the HTML class attribute?

    - by Cornflake
    Can anyone help me with a Javascript question, please? Why does the following code display only message boxes with the word "null" in them? And I think there are not enough of them either. <html> <head> <script type="text/javascript"> function showElementClasses(node) { var els = node.getElementsByTagName("*"); for(var i=0,j=els.length; i<j; i++) alert(els[i].getAttribute("class")); alert("Class: " + els[i].className); } showElementClasses(document); </script> </head> <body class="bla"> <div class="myclass" style="width: 500; height: 400" id="map"></div> </body> </html>

    Read the article

  • Why aren't these Canvases rendering?

    - by bpapa
    I'm creating a web app that allows users to enter a number of colors, by specifying RGB values. Upon submission, the user will see a canvas with a solid rectangle drawn in the color chosen. On this page, I have 7 canvases. The first one draws just fine, but none of the rest show up. The browser is Safari. Here's the relevant code: First, the script element in the header, which defines the function I use to draw to the canvas. <script language="JavaScript" TYPE="text/javascript"><!-- function drawCanvas(canvasId, red, green, blue) { var theCanvas = document.getElementById("canvas" + canvasId); var context = theCanvas.getContext("2d"); context.clearRect(0,0,100,100); context.setFillColor(red,green,blue,1.0); context.fillRect(0,0,100,100); } // --> </script> Next, the HTML source, where I have my canvas tags and some embedded Javascript to call my drawCanvas function <canvas id="canvas0" width="100" height="100"> </canvas> <script language="JavaScript" TYPE="text/javascript"><!-- drawCanvas(0,250,0,0); // --> </script> . . //more source . <canvas id="canvas1" width="100" height="100"> </canvas> <script language="JavaScript" TYPE="text/javascript"><!-- drawCanvas(1,4,250,6); // --> </script> Also provided is a screenshot. As you can see, the "red" canvas comes up just fine, but the second one, which should be green, doesn't show up at all. Any ideas?

    Read the article

< Previous Page | 490 491 492 493 494 495 496 497 498 499 500 501  | Next Page >