Search Results

Search found 34110 results on 1365 pages for 'gdata python client'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 497/1365 | < Previous Page | 493 494 495 496 497 498 499 500 501 502 503 504  | Next Page >

  • Prepopulate drop-box according to another drop-box choice in Django Admin

    - by onorua
    I have models like this: class User(models.Model): Switch = models.ForeignKey(Switch, related_name='SwitchUsers') Port = models.ForeignKey(Port) class Switch(models.Model): Name = models.CharField(max_length=50) class Port(models.Model): PortNum = models.PositiveIntegerField() Switch = models.ForeignKey(Switch, related_name = "Ports") When I'm in Admin interface and choose Switch from Switches available, I would like to have Port prepopulated accordingly with Ports from the related Switch. As far as I understand I need to create some JS script to prepopulate it. Unfortunately I don't have this experience, and I would like to keep things simple as it possible and don't rewrite all Django admin interface. Just add this functionality for one Field. Could you please help me with my problem? Thank you.

    Read the article

  • Counting amount of items in Pythons 'for'

    - by Markum
    Kind of hard to explain, but when I run something like this: fruits = ['apple', 'orange', 'banana', 'strawberry', 'kiwi'] for fruit in fruits: print fruit.capitalize() It gives me this, as expected: Apple Orange Banana Strawberry Kiwi How would I edit that code so that it would "count" the amount of times it's performing the for, and print this? 1 Apple 2 Orange 3 Banana 4 Strawberry 5 Kiwi

    Read the article

  • mod_wsgi daemon mode vs threaded fastcgi

    - by t0ster
    Can someone explain the difference between apache mod_wsgi in daemon mode and django fastcgi in threaded mode. They both use threads for concurrency I think. Supposing that I'm using nginx as front end to apache mod_wsgi. UPDATE: I'm comparing django built in fastcgi(./manage.py method=threaded maxchildren=15) and mod_wsgi in 'daemon' mode(WSGIDaemonProcess example threads=15). They both use threads and acquire GIL, am I right?

    Read the article

  • Setting up relations/mappings for a SQLAlchemy many-to-many database

    - by Brent Ramerth
    I'm new to SQLAlchemy and relational databases, and I'm trying to set up a model for an annotated lexicon. I want to support an arbitrary number of key-value annotations for the words which can be added or removed at runtime. Since there will be a lot of repetition in the names of the keys, I don't want to use this solution directly, although the code is similar. My design has word objects and property objects. The words and properties are stored in separate tables with a property_values table that links the two. Here's the code: from sqlalchemy import Column, Integer, String, Table, create_engine from sqlalchemy import MetaData, ForeignKey from sqlalchemy.orm import relation, mapper, sessionmaker from sqlalchemy.ext.declarative import declarative_base engine = create_engine('sqlite:///test.db', echo=True) meta = MetaData(bind=engine) property_values = Table('property_values', meta, Column('word_id', Integer, ForeignKey('words.id')), Column('property_id', Integer, ForeignKey('properties.id')), Column('value', String(20)) ) words = Table('words', meta, Column('id', Integer, primary_key=True), Column('name', String(20)), Column('freq', Integer) ) properties = Table('properties', meta, Column('id', Integer, primary_key=True), Column('name', String(20), nullable=False, unique=True) ) meta.create_all() class Word(object): def __init__(self, name, freq=1): self.name = name self.freq = freq class Property(object): def __init__(self, name): self.name = name mapper(Property, properties) Now I'd like to be able to do the following: Session = sessionmaker(bind=engine) s = Session() word = Word('foo', 42) word['bar'] = 'yes' # or word.bar = 'yes' ? s.add(word) s.commit() Ideally this should add 1|foo|42 to the words table, add 1|bar to the properties table, and add 1|1|yes to the property_values table. However, I don't have the right mappings and relations in place to make this happen. I get the sense from reading the documentation at http://www.sqlalchemy.org/docs/05/mappers.html#association-pattern that I want to use an association proxy or something of that sort here, but the syntax is unclear to me. I experimented with this: mapper(Word, words, properties={ 'properties': relation(Property, secondary=property_values) }) but this mapper only fills in the foreign key values, and I need to fill in the other value as well. Any assistance would be greatly appreciated.

    Read the article

  • Algorithm to match natural text in mail

    - by snøreven
    I need to separate natural, coherent text/sentences in emails from lists, signatures, greetings and so on before further processing. example: Hi tom, last monday we did bla bla, lore Lorem ipsum dolor sit amet, consectetur adipisici elit, sed eiusmod tempor incidunt ut labore et dolore magna aliqua. list item 2 list item 3 list item 3 Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut aliquid x ea commodi consequat. Quis aute iure reprehenderit in voluptate velit regards, K. ---line-of-funny-characters-####### example inc. 33 evil street, london mobile: 00 234534/234345 Ideally the algorithm would match only the bold parts. Is there any recommended approach - or are there even existing algorithms for that problem? Should I try approximate regular expressions or more statistical stuff based on number of punctation marks, length and so on?

    Read the article

  • grabbing a substring while scraping with Python2.6

    - by Diego
    Hey can someone help with the following? I'm trying to scrape a site that has the following information.. I need to pull just the number after the </strong> tag.. [<li><strong>ISBN-13:</strong> 9780375853401</li>, <li><strong>Pub. Date: </strong> 05/11/2010</li>] [<li><strong>UPC:</strong> 490355000372</li>, <li><strong>Catalog No:</strong> 15024/25</li>, <li><strong>Label:</strong> CAMERATA</li>] here's a piece of the code I've been using to grab the above data using mechanize and BeautifulSoup. I'm stuck here as it won't let me use the find() function for a list br_results = mechanize.urlopen(br_results) html = br_results.read() soup = BeautifulSoup(html) local_links = soup.findAll("a", {"class" : "down-arrow csa"}) upc_code = soup.findAll("ul", {"class" : "bc-meta3"}) for upc in upc_code: upc_text = upc.contents.contents print upc_text

    Read the article

  • What is the Simplest Possible Payment Gateway to Implement? (using Django)

    - by b14ck
    I'm developing a web application that will require users to either make one time deposits of money into their account, or allow users to sign up for recurring billing each month for a certain amount of money. I've been looking at various payment gateways, but most (if not all) of them seem complex and difficult to get working. I also see no real active Django projects which offer simple views for making payments. Ideally, I'd like to use something like Amazon FPS, so that I can see online transaction logs, refund money, etc., but I'm open to other things. I just want the EASIEST possible payment gateway to integrate with my site. I'm not looking for anything fancy, whatever does the job, and requires < 10 hours to get working from start to finish would be perfect. I'll give answer points to whoever can point out a good one. Thanks!

    Read the article

  • Performing non-blocking requests? - Django

    - by RadiantHex
    Hi folks, I have been playing with other frameworks, such as NodeJS, lately. I love the possibility to return a response, and still being able to do further operations. e.g. def view(request): do_something() return HttpResponse() do_more_stuff() #not possible!!! Maybe Django already offers a way to perform operations after returning a request, if that is the case that would be great. Help would be very much appreciated! =D

    Read the article

  • Accented characters in matplotlib

    - by OldJim
    Does anyone know a way to get matplotlib to render accented chars (é,ã,â,etc)? For instance i'm trying to use accented chars on set_yticklabels() and matplot renders squares instead, and when i use unicode() it renders the wrong chars. Is there a way to make this work? Thanks in advance, Jim.

    Read the article

  • How to reload Django models without losing my locals in an interactive session?

    - by Gj
    I'm doing some research with an interactive shell and using a Django app (shell_plus) for storing data and browsing it using the convenient admin. Occasionally I add or change some of the app models, and run a syncdb (or South migration when changing a model). The changes to the models don't take effect in my interactive session even if I re-import the app models. Thus I'm forced to restart the shell_plus and lose my precious locals() in the process. Is there any way to reload the models during a session? Thanks!!

    Read the article

  • Deterministic key serialization

    - by Mike Boers
    I'm writing a mapping class which uses SQLite as the storage backend. I am currently allowing only basestring keys but it would be nice if I could use a couple more types hopefully up to anything that is hashable (ie. same requirements as the builtin dict). To that end I would like to derive a deterministic serialization scheme. Ideally, I would like to know if any implementation/protocol combination of pickle is deterministic for hashable objects (e.g. can only use cPickle with protocol 0). I noticed that pickle and cPickle do not match: >>> import pickle >>> import cPickle >>> def dumps(x): ... print repr(pickle.dumps(x)) ... print repr(cPickle.dumps(x)) ... >>> dumps(1) 'I1\n.' 'I1\n.' >>> dumps('hello') "S'hello'\np0\n." "S'hello'\np1\n." >>> dumps((1, 2, 'hello')) "(I1\nI2\nS'hello'\np0\ntp1\n." "(I1\nI2\nS'hello'\np1\ntp2\n." Another option is to use repr to dump and ast.literal_eval to load. This would only be valid for builtin hashable types. I have written a function to determine if a given key would survive this process (it is rather conservative on the types it allows): def is_reprable_key(key): return type(key) in (int, str, unicode) or (type(key) == tuple and all( is_reprable_key(x) for x in key)) The question for this method is if repr itself is deterministic for the types that I have allowed here. I believe this would not survive the 2/3 version barrier due to the change in str/unicode literals. This also would not work for integers where 2**32 - 1 < x < 2**64 jumping between 32 and 64 bit platforms. Are there any other conditions (ie. do strings serialize differently under different conditions)? (If this all fails miserably then I can store the hash of the key along with the pickle of both the key and value, then iterate across rows that have a matching hash looking for one that unpickles to the expected key, but that really does complicate a few other things and I would rather not do it.) Any insights?

    Read the article

  • how to speed up the code??

    - by kaushik
    i have very huge code about 600 lines plus. cant post the whole thing here. but a particular code snippet is taking so much time,leading to problems. here i post that part of code please tell me what to do speed up the processing.. please suggest the part which may be the reason and measure to improve them if this small part of code is understandable. using_data={} def join_cost(a , b): global using_data #print a #print b save_a=[] save_b=[] print 1 #for i in range(len(m)): #if str(m[i][0])==str(a): save_a=database_index[a] #for i in range(len(m)): # if str(m[i][0])==str(b): #print 'save_a',save_a #print 'save_b',save_b print 2 save_b=database_index[b] using_data[save_a[0]]=save_a s=str(save_a[1]).replace('phone','text') s=str(s)+'.pm' p=os.path.join("c:/begpython/wavnk/",s) x=open(p , 'r') print 3 for i in range(6): x.readline() k2='a' j=0 o=[] while k2 is not '': k2=x.readline() k2=k2.rstrip('\n') oj=k2.split(' ') o=o+[oj] #print o[j] j=j+1 #print j #print o[2][0] temp=long(1232332) end_time=save_a[4] #print end_time k=(j-1) for i in range(k): diff=float(o[i][0])-float(end_time) if diff<0: diff=diff*(-1) if temp>diff: temp=diff pm_row=i #print pm_row #print temp #print o[pm_row] #pm_row=3 q=[] print 4 l=str(p).replace('.pm','.mcep') z=open(l ,'r') for i in range(pm_row): z.readline() k3=z.readline() k3=k3.rstrip('\n') q=k3.split(' ') #print q print 5 s=str(save_b[1]).replace('phone','text') s=str(s)+'.pm' p=os.path.join("c:/begpython/wavnk/",s) x=open(p , 'r') for i in range(6): x.readline() k2='a' j=0 o=[] while k2 is not '': k2=x.readline() k2=k2.rstrip('\n') oj=k2.split(' ') o=o+[oj] #print o[j] j=j+1 #print j #print o[2][0] temp=long(1232332) strt_time=save_b[3] #print strt_time k=(j-1) for i in range(k): diff=float(o[i][0])-float(strt_time) if diff<0: diff=diff*(-1) if temp>diff: temp=diff pm_row=i #print pm_row #print temp #print o[pm_row] #pm_row=3 w=[] l=str(p).replace('.pm','.mcep') z=open(l ,'r') for i in range(pm_row): z.readline() k3=z.readline() k3=k3.rstrip('\n') w=k3.split(' ') #print w cost=0 for i in range(12): #print q[i] #print w[i] h=float(q[i])-float(w[i]) cost=cost+math.pow(h,2) j_cost=math.sqrt(cost) #print cost return j_cost def target_cost(a , b): a=(b+1)*3 b=(a+1)*2 t_cost=(a+b)*5/2 return t_cost r1='shht:ra_77' r2='grx_18' g=[] nodes=[] nodes=nodes+[[r1]] for i in range(len(y_in_db_format)): g=y_in_db_format[i] #print g #print g[0] g.remove(str(g[0])) nodes=nodes+[g] nodes=nodes+[[r2]] print nodes print "lenght of nodes",len(nodes) lists=[] #lists=lists+[r1] for i in range(len(nodes)): for j in range(len(nodes[i])): lists=lists+[nodes[i][j]] #lists=lists+[r2] print lists distance={} for i in range(len(lists)): if i==0: distance[str(lists[i])]=0 else: distance[str(lists[i])]=long(123231223) #print distance group_dist=[] infinity=long(123232323) for i in range(len(nodes)): distances=[] for j in range(len(nodes[i])): #distances=[] if i==0: distances=distances+[[nodes[i][j], 0]] else: distances=distances+[[nodes[i][j],infinity]] group_dist=group_dist+[distances] #print distances print "group_distances",group_dist #print "check",group_dist[0][0][1] #costs={} #for i in range(len(lists)): #if i==0: # costs[str(lists[i])]=1 #else: # costs[str(lists[i])]=get_selfcost(lists[i]) path=[] for i in range(len(nodes)): mini=[] if i!=(len(nodes)-1): #temp=long(123234324) #Now calculate the cost between the current node and each of its neighbour for k in range(len(nodes[(i+1)])): for j in range(len(nodes[i])): current=nodes[i][j] #print "current_node",current j_distance=join_cost( current , nodes[i+1][k]) #t_distance=target_cost( current , nodes[i+1][k]) t_distance=34 #print distance #print "distance between current and neighbours",distance total_distance=(.5*(float(group_dist[i][j][1])+float(j_distance))+.5*(float(t_distance))) #print "total distance between the intial_nodes and current neighbour",total_distance if int(group_dist[i+1][k][1]) > int(total_distance): group_dist[i+1][k][1]=total_distance #print "updated distance",group_dist[i+1][k][1] a=current #print "the neighbour",nodes[i+1][k],"updated the value",a mini=mini+[[str(nodes[i+1][k]),a]] print mini

    Read the article

  • how to speed up the code??

    - by kaushik
    in my program i have a method which requires about 4 files to be open each time it is called,as i require to take some data.all this data from the file i have been storing in list for manupalation. I approximatily need to call this method about 10,000 times.which is making my program very slow? any method for handling this files in a better ways and is storing the whole data in list time consuming what is better alternatives for list? I can give some code,but my previous question was closed as that only confused everyone as it is a part of big program and need to be explained completely to understand,so i am not giving any code,please suggest ways thinking this as a general question... thanks in advance

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Programmatically sync the db in Django

    - by Attila Oláh
    I'm trying to sync my db from a view, something like this: from django import http from django.core import management def syncdb(request): management.call_command('syncdb') return http.HttpResponse('Database synced.') The issue is, it will block the dev server by asking for user input from the terminal. How can I pass it the '--noinput' option to prevent asking me anything? I have other ways of marking users as super-user, so there's no need for the user input, but I really need to call syncdb (and flush) programmatically, without logging on to the server via ssh. Any help is appreciated.

    Read the article

  • Error handling in the RequestHandler without embedding in URI

    - by hyn
    When a user sends a filled form, I want to print an error message in case there is an input error. One of the GAE sample codes does this by embedding the error message in the URI. Inside the form handler (get): self.redirect('/compose?error_message=%s' % message) and in the handler (get) of redirected URI, gets the message from request: values = { 'error_message': self.request.get('error_message'), ... Is there a way to accomplish the same without embedding the message in the URI?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Using Range Function

    - by Michael Alexander Riechmann
    My goal is to make a program that takes an input (Battery_Capacity) and ultimately spits out a list of the (New_Battery_Capacity) and the Number of (Cycle) it takes for it ultimately to reach maximum capacity of 80. Cycle = range (160) Charger_Rate = 0.5 * Cycle Battery_Capacity = float(raw_input("Enter Current Capacity:")) New_Battery_Capacity = Battery_Capacity + Charger_Rate if Battery_Capacity < 0: print 'Battery Reading Malfunction (Negative Reading)' elif Battery_Capacity > 80: print 'Battery Reading Malfunction (Overcharged)' elif float(Battery_Capacity) % 0.5 !=0: print 'Battery Malfunction (Charges Only 0.5 Interval)' while Battery_Capacity >= 0 and Battery_Capacity < 80: print New_Battery_Capacity I was wondering why my Cycle = range(160) isn't working in my program?

    Read the article

  • Is django orm & templates thread safe?

    - by Piotr Czapla
    I'm using django orm and templates to create a background service that is ran as management command. Do you know if django is thread safe? I'd like to use threads to speed up processing. The processing is blocked by I/O not CPU so I don't care about performance hit caused by GIL.

    Read the article

  • How to repeatedly show a Dialog with PyGTK / Gtkbuilder?

    - by Julian
    I have created a PyGTK application that shows a Dialog when the user presses a button. The dialog is loaded in my __init__ method with: builder = gtk.Builder() builder.add_from_file("filename") builder.connect_signals(self) self.myDialog = builder.get_object("dialog_name") In the event handler, the dialog is shown with the command self.myDialog.run(), but this only works once, because after run() the dialog is automatically destroyed. If I click the button a second time, the application crashes. I read that there is a way to use show() instead of run() where the dialog is not destroyed, but I feel like this is not the right way for me because I would like the dialog to behave modally and to return control to the code only after the user has closed it. Is there a simple way to repeatedly show a dialog using the run() method using gtkbuilder? I tried reloading the whole dialog using the gtkbuilder, but that did not really seem to work, the dialog was missing all child elements (and I would prefer to have to use the builder only once, at the beginning of the program). [SOLUTION] As pointed out by the answer below, using hide() does the trick. But one has to take care that the dialog is in fact destroyed if one does not catch its "delete-event". A simple example that works is: import pygtk import gtk class DialogTest: def rundialog(self, widget, data=None): self.dia.show_all() result = self.dia.run() def destroy(self, widget, data=None): gtk.main_quit() def closedialog(self, widget, data=None): self.dia.hide() return True def __init__(self): self.window = gtk.Window(gtk.WINDOW_TOPLEVEL) self.window.connect("destroy", self.destroy) self.dia = gtk.Dialog('TEST DIALOG', self.window, gtk.DIALOG_MODAL | gtk.DIALOG_DESTROY_WITH_PARENT) self.dia.vbox.pack_start(gtk.Label('This is just a Test')) self.dia.connect("delete-event", self.closedialog) self.button = gtk.Button("Run Dialog") self.button.connect("clicked", self.rundialog, None) self.window.add(self.button) self.button.show() self.window.show() if __name__ == "__main__": testApp = DialogTest() gtk.main()

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 493 494 495 496 497 498 499 500 501 502 503 504  | Next Page >