Search Results

Search found 46949 results on 1878 pages for 'name matching'.

Page 5/1878 | < Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >

  • Perl script matching a certain patern

    - by kivien
    Assuming the file.txt is as follows:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The perl code is as follows:- open ( FILE, "file.txt" ) || die "can't open file!"; @lines = <FILE>; close (FILE); $string = "John Depp"; foreach $line (@lines) { if ($line =~ $string) { print "$line"; } } The output is going to be first and fourth line. I want to make it working for the file having random line breaks rather than one English sentence per line. I mean it should also work for the following:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The output should be first and fourth sentence. Any ideas please?

    Read the article

  • Pattern matching in Perl ala Haskell

    - by Paul Nathan
    In Haskell (F#, Ocaml, and others), I can do this: sign x | x > 0 = 1 | x == 0 = 0 | x < 0 = -1 Which calculates the sign of a given integer. This can concisely express certain logic flows; I've encountered one of these flows in Perl. Right now what I am doing is sub frobnicator { my $frob = shift; return "foo" if $frob eq "Foomaticator"; return "bar" if $frob eq "Barmaticator"; croak("Unable to frob legit value: $frob received"); } Which feels inexpressive and ugly. This code has to run on Perl 5.8.8, but of course I am interested in more modern techniques as well.

    Read the article

  • F# pattern matching

    - by Roger Alsing
    What would be the most effective way to express the following code? match cond.EvalBool() with | true -> match body.Eval() with | :? ControlFlowModifier as e -> match e with | Break(scope) -> e :> obj //Break is a DU element of ControlFlowModifier | _ -> next() //other members of CFM should call next() | _ -> next() | false -> null cond.EvalBool returns a boolean result where false should return null and true should either run the entire block again (its wrapped in a func called next) or if the special value of break is found, then the loop should exit and return the break value. Is there any way to compress that block of code to something smaller?

    Read the article

  • "Pattern matching" of algebraic type data constructors

    - by jetxee
    Let's consider a data type with many constructors: data T = Alpha Int | Beta Int | Gamma Int Int | Delta Int I want to write a function to check if two values are produced with the same constructor: sameK (Alpha _) (Alpha _) = True sameK (Beta _) (Beta _) = True sameK (Gamma _ _) (Gamma _ _) = True sameK _ _ = False Maintaining sameK is not much fun, it is potentially buggy. For example, when new constructors are added to T, it's easy to forget to update sameK. I omitted one line to give an example: -- it’s easy to forget: -- sameK (Delta _) (Delta _) = True The question is how to avoid boilerplate in sameK? Or how to make sure it checks for all T constructors? The workaround I found is to use separate data types for each of the constructors, deriving Data.Typeable, and declaring a common type class, but I don't like this solution, because it is much less readable and otherwise just a simple algebraic type works for me: {-# LANGUAGE DeriveDataTypeable #-} import Data.Typeable class Tlike t where value :: t -> t value = id data Alpha = Alpha Int deriving Typeable data Beta = Beta Int deriving Typeable data Gamma = Gamma Int Int deriving Typeable data Delta = Delta Int deriving Typeable instance Tlike Alpha instance Tlike Beta instance Tlike Gamma instance Tlike Delta sameK :: (Tlike t, Typeable t, Tlike t', Typeable t') => t -> t' -> Bool sameK a b = typeOf a == typeOf b

    Read the article

  • OpenCV shape matching

    - by MAckerman
    I'm new to OpenCV (am actually using Emgu CV C# wrapper) and am attempting to do some object detection. I'm attempting to determine if an object matches a predefined set of objects (that I will have to define). The background is well lit and does not move. My objects that I am starting with are bottles and cans. My current approach is: Do absDiff with a previously taken background image to separate the background. Then dilate 4x to make the lighter areas (in labels) shrink. Then I do a binary threshold to get a big blog, followed by finding contours in this image. I then take the largest contour and draw it, which becomes my shape to either save to the accepted set or compare with the accepted set. Currently I'm using cvMatchShapes, but the double return value seems to vary widely. I'm guessing it is because it doesn't take into account rotation. Is this approach a good one? It isn't working well for glass bottles since the edges are hard to find... I've read about haar classifiers, but thinking that might be overkill for my task.

    Read the article

  • Extract string between matching braces in Perl

    - by Srilesh
    My input file is as below : HEADER {ABC|*|DEF {GHI 0 1 0} {{Points {}}}} {ABC|*|DEF {GHI 0 2 0} {{Points {}}}} {ABC|*|XYZ:abc:def {GHI 0 22 0} {{Points {{F1 1.1} {F2 1.2} {F3 1.3} {F4 1.4}}}}} {ABC|*|XYZ:ghi:jkl {JKL 0 372 0} {{Points {}}}} {ABC|*|XYZ:mno:pqr {GHI 0 34 0} {{Points {}}}} { ABC|*|XYZ:abc:pqr {GHI 0 68 0} {{Points {{F1 11.11} {F2 12.10} {F3 14.11} {F4 16.23}}}} } TRAILER I want to extract the file into an array as below : $array[0] = "{ABC|*|DEF {GHI 0 1 0} {{Points {}}}}" $array[1] = "{ABC|*|DEF {GHI 0 2 0} {{Points {}}}}" $array[2] = "{ABC|*|XYZ:abc:def {GHI 0 22 0} {{Points {{F1 1.1} {F2 1.2} {F3 1.3} {F4 1.4}}}}}" .. .. $array[5] = "{ ABC|*|XYZ:abc:pqr {GHI 0 68 0} {{Points {{F1 11.11} {F2 12.10} {F3 14.11} {F4 16.23}}}} }" Which means, I need to match the first opening curly brace with its closing curly brace and extract the string in between. I have checked the below link, but this doesnt apply to my question. http://stackoverflow.com/questions/413071/regex-to-get-string-between-curly-braces-i-want-whats-between-the-curly-braces I am trying but would really help if someone can assist me with their expertise ... Thanks Sri ...

    Read the article

  • Regular expressions and matching question marks in URLs

    - by James P.
    I'm having trouble finding a regular expression that matches the following String. Korben;http://feeds.feedburner.com/KorbensBlog-UpgradeYourMind?format=xml;1 One problem is escaping the question mark. Java's pattern matcher doesn't seem to accept \? as a valid escape sequence but it also fails to work with the tester at myregexp.com. Here's what I have so far: ([a-zA-Z0-9])+;http://([a-zA-Z0-9./-]+);[0-9]+ Any suggestions?

    Read the article

  • pattern matching and returning new object based on pattern

    - by Rune FS
    Say I'v got some code like this match exp with | Addition(lhs,rhs,_) -> Addition(fix lhs,fix rhs) | Subtraction(lhs,rhs,_) -> Subtraction(fix lhs,fix rhs) is there any way that would allow me to do something like match exp with | Addition(lhs,rhs,_) | Subtraction(lhs,rhs,_) -> X(fix lhs,fix rhs) where X be based on the actual pattern being matched

    Read the article

  • Pattern Matching with XSLT

    - by genesis11
    I'm trying to match a pattern into a string in XSLT/XPath using the matches function, as follows: <xsl:when test="matches('awesome','awe')"> ... </xsl:when> However, in both Firefox 3.5.9 and IE8, it doesn't show up. IE8 tells me that "'matches' is not a valid XSLT or XPath function." Is this due to XSLT 2.0 not being supported, and is there a way around this?

    Read the article

  • Excel Matching problem with logic expression

    - by abelenky
    (I understand Excel is only borderline programming) I have a block of data that represents the steps in a process and the possible errors: ProcessStep Status FeesPaid OK FormRecvd OK RoleAssigned OK CheckedIn Not Checked In. ReadyToStart Not Ready for Start I want to find the first Status that is not "OK". I have attempted this: =Match("<>""OK""", StatusRange, 0) which is supposed to return the index of the first element in the range that is NOT-EQUAL (<) to "OK" But this doesn't work, instead returning #N/A. I expect it to return 4 (index #4, in a 1-based index, representing that CheckedIn is the first non-OK element) Any ideas how to do this?

    Read the article

  • Regex and Pattern Matching in Scala

    - by Bruce Ferguson
    I am not strong in regex, and pretty new to Scala. I would like to be able to find a match between the first letter of a word, and one of the letters in a group such as "ABC". In pseudocode, this might look something like: case Process(word) => word.firstLetter match { case([a-c][A-C]) => case _ => } } but I don't know how to grab the first letter in Scala instead of Java, how to express the regular expression properly, nor if it's possible to do this within a case class. Any suggestions? Thanks in advance. Bruce

    Read the article

  • Haskell: Pattern Matching with Lists

    - by user1670032
    I'm trying to make a function that takes in a list, and if one of the elements is negative, then any elements in that list that are equal to its positive counterpart should be changed to 0. Eg, if there is a -2 in a list, then all 2's in that list should be changed to 0. Any ideas why it only works for some cases and not others? I'm not understanding why this is, I've looked it over several times. changeToZero [] = [] changeToZero [x] = [x] changeToZero (x:zs:y:ws) | (x < 0) && ((-1)*(x) == y) = x : zs : 0 : changeToZero ws changeToZero (x:xs) = x : changeToZero xs *Main changeToZero [-1,1,-2,2,-3,3] [-1,1,-2,2,-3,3] *Main changeToZero [-2,1,2,3] [-2,1,0,3] *Main changeToZero [-2,1,2,3,2] [-2,1,0,3,2] *Main changeToZero [1,-2,2,2,1] [1,-2,2,0,1]

    Read the article

  • F# pattern matching when mixing DU's and other values

    - by Roger Alsing
    What would be the most effective way to express the following code? match cond.EvalBool() with | true -> match body.Eval() with | :? ControlFlowModifier as e -> match e with | Break(scope) -> e :> obj //Break is a DU element of ControlFlowModifier | _ -> next() //other members of CFM should call next() | _ -> next() //all other values should call next() | false -> null cond.EvalBool returns a boolean result where false should return null and true should either run the entire block again (its wrapped in a func called next) or if the special value of break is found, then the loop should exit and return the break value. Is there any way to compress that block of code to something smaller?

    Read the article

  • How to implement best matching logic in TSQL (SQL Server 2000)

    - by sanjay-kumar1911
    I have two tables X and Y: Table X C1 C2 C3 1 A 13 2 B 16 3 C 8 Table Y C1 C2 C3 C4 1 A 2 N 2 A 8 N 3 A 12 N 4 A 5 N 5 B 7 N 6 B 16 N 7 B 9 N 8 B 5 N 9 C 8 N 10 C 2 N 11 C 8 N 12 C 6 N Records in Table Y can be n number CREATE TABLE X(C1 INT, C2 CHAR(1), C3 INT); CREATE TABLE Y(C1 INT, C2 CHAR(1), C3 INT, C4 CHAR(1)); with following data: INSERT INTO X VALUES (1 'A',13 ); INSERT INTO X VALUES (2 'B',16 ); INSERT INTO X VALUES (3 'C',8 ); INSERT INTO Y VALUES (1,'A', 2,'N'); INSERT INTO Y VALUES (2,'A', 8,'N'); INSERT INTO Y VALUES (3,'A', 12,'N'); INSERT INTO Y VALUES (4,'A', 5,'N'); INSERT INTO Y VALUES (5,'B', 7,'N'); INSERT INTO Y VALUES (6,'B', 16,'N'); INSERT INTO Y VALUES (7,'B', 9,'N'); INSERT INTO Y VALUES (8,'B', 5,'N'); INSERT INTO Y VALUES (9,'C', 8,'N'); INSERT INTO Y VALUES (10,'C', 2,'N'); INSERT INTO Y VALUES (11,'C', 8,'N'); INSERT INTO Y VALUES (12,'C', 6,'N'); EXPECTED RESULT Table Y C1 C2 C3 C4 1 A 2 N 2 A 8 Y 3 A 12 N 4 A 5 Y 5 B 7 N 6 B 16 Y 7 B 9 N 8 B 5 N 9 C 8 Y 10 C 2 N 11 C 8 N 12 C 6 N How do I compare value of column C3 in Table X with all possible matches of column C3 of Table Y and to mark records as matched and unmatched in column C4 of Table Y? Possible matches for A (i.e. value of column C2 in Table X) would be (where R is row number i.e. value of column C1 in Table Y): R1, R2, R3, R4, R1+R2, R1+R3, R1+R4, R2+R3, R2+R4, R3+R4, R4+R5, R1+R2+R3, R1+R2+R4, R2+R3+R4, R1+R2+R3+R4

    Read the article

  • Is it possible, with simple F# pattern matching transformations, to ignore unmatched values without

    - by Phobis
    So, I previously asked this question: http://stackoverflow.com/questions/2820234/can-someone-help-me-compare-using-f-over-c-in-this-specific-example-ip-address I was looking at the posted code and I was wondering if this code could be written without it producing a warning: let [|a;b;c;d|] = s.Split [|'.'|] IP(parseOrParts a, parseOrParts b, parseOrParts c, parseOrParts d) Is it possible to do something for the match _ pattern ot ignore? Without adding in something like Active Patterns? i want to keep the code as simple as possible... can I do this without drastically changing this code? NOTE: Warning is as follows Warning Incomplete pattern matches on this expression. For example, the value '[|_; _; _; _; _|]' may indicate a case not covered by the pattern(s).

    Read the article

  • Correct syntax for matching a string inside a variable against an array

    - by Jamex
    Hi, I have a variable, $var, that contains a string of characters, this is a dynamic variable that contains the values from inputs. $var could be 'abc', or $var could be 'blu', I want to match the string inside variable against an array, and return all the matches. $array = array("blue", "red", "green"); What is the correct syntax for writing the code in php, my rough code is below $match = preg_grep($var, $array); (incorrect syntax of course) I tried to put quotes and escape slashes, but so far no luck. Any suggestion? TIA

    Read the article

  • Matching a rotated bitmap to a collage image

    - by Dmi
    Hi, My problem is that I have an image of a detailed street map. On this map, there can be a certain small image of a sign (such as a traffic light icon) rotated at any angle, maybe resized. I have this small image in a bitmap. Is there any algorithm or technique by which I can locate this bitmap if a copy of it exists, rotated and maybe resized, in the large collage image? This is similar to the problem with Augmented Reality and locating the marker image, but mine is only 2D with no perspective distortion.

    Read the article

  • How to start matching and saving matched from exact point in a text

    - by yuliya
    I have a text and I write a parser for it using regular expressions and perl. I can match what I need with two empty lines (I use regexp), because there is a pattern that allows recognize blocks of text after two empty lines. But the problem is that the whole text has Introduction part and some text in the end I do not need. Here is a code which matches text when it finds two empty lines #!/usr/bin/perl use strict; use warnings; my $file = 'first'; open(my $fh, '<', $file); my $empty = 0; my $block_num = 1; open(OUT, '>', $block_num . '.txt'); while (my $line = <$fh>) { chomp ($line); if ($line =~ /^\s*$/) { $empty++; } elsif ($empty == 2) { close(OUT); open(OUT, '>', ++$block_num . '.txt'); $empty = 0; } else { $empty = 0;} print OUT "$line\n"; } close(OUT); This is example of the text I need (it's really small :)) this is file example I think that I need to iterate over the text till the moment it will find the word LOREM IPSUM with regexps this kind "/^LOREM IPSUM/", because it is the point from which needed text starts(and save the text in one file when i reach the word). And I need to finish iterating over the text when INDEX word is fount or save the text in separate file. How could I implement it. Should I use next function to proceed with lines or what? BR, Yuliya

    Read the article

  • Strange pattern matching with functions instancing Show

    - by Sean D
    So I'm writing a program which returns a procedure for some given arithmetic problem, so I wanted to instance a couple of functions to Show so that I can print the same expression I evaluate when I test. The trouble is that the given code matches (-) to the first line when it should fall to the second. {-# OPTIONS_GHC -XFlexibleInstances #-} instance Show (t -> t-> t) where show (+) = "plus" show (-) = "minus" main = print [(+),(-)] returns [plus,plus] Am I just committing a motal sin printing functions in the first place or is there some way I can get it to match properly? edit:I realise I am getting the following warning: Warning: Pattern match(es) are overlapped In the definition of `show': show - = ... I still don't know why it overlaps, or how to stop it.

    Read the article

  • Pattern Matching of Units of Measure in F#

    - by Oldrich Svec
    This function: let convert (v: float<_>) = match v with | :? float<m> -> v / 0.1<m> | :? float<m/s> -> v / 0.2<m/s> | _ -> failwith "unknown" produces an error The type 'float<'u>' does not have any proper subtypes and cannot be used as the source of a type test or runtime coercion. Is there any way how to pattern match units of measure?

    Read the article

  • How to set up an SSL Cert with Subject Alternative Name

    - by Darren Oster
    To test a specific embedded client, I need to set up a web server serving a couple of SSL (HTTPS) sites, say "main.mysite.com" and "alternate.mysite.com". These should be handled by the same certificate, with a Subject Name of "main.mysite.com" and a Subject Alternative Name of "alternate.mysite.com". This certificate needs to be in an authority chain back to a 'proper' CA (such as GoDaddy, to keep the cost down). My question is, are there any good tutorials on how to do this, or can someone explain the process? What sort of parent certificate do I need to purchase from the CA provider? My understanding of SSL certificates is limited, but as Manuel said in Fawlty Towers, "I learn...". I'm happy to work in Windows (IIS) or Linux (Apache) (or even OSX, for that matter). Thanks in advance.

    Read the article

  • Why does Excel now give me already existing name range error on Copy Sheet?

    - by WilliamKF
    I've been working on a Microsoft Excel 2007 spreadsheet for several days. I'm working from a master template like sheet and copying it to a new sheet repeatedly. Up until today, this was happening with no issues. However, in the middle of today this suddenly changed and I do not know why. Now, whenever I try to copy a worksheet I get about ten dialogs, each one with a different name range object (shown below as 'XXXX') and I click yes for each one: A formula or sheet you want to move or copy contains the name 'XXXX', which already exists on the destination worksheet. Do you want to use this version of the name? To use the name as defined in destination sheet, click Yes. To rename the range referred to in the formula or worksheet, click No, and enter a new name in the Name Conflict dialog box. The name range objects refer to cells in the sheet. For example, E6 is called name range PRE on multiple sheets (and has been all along) and some of the formulas refer to PRE instead of $E$6. One of the 'XXXX' above is this PRE. These name ranges should only be resolved within the sheet within which they appear. This was not an issue before despite the same name range existing on multiple sheets before. I want to keep my name ranges. What could have changed in my spreadsheet to cause this change in behavior? I've gone back to prior sheets created this way and now they give the message too when copied. I tried a different computer and a different user and the same behavior is seen everywhere. I can only conclude something in the spreadsheet has changed. What could this be and how can I get back the old behavior whereby I can copy sheets with name ranges and not get any errors? Looking in the Name Manager I see that the name ranges being complained about show twice, once as scope Template and again as scope Workbook. If I delete the scope Template ones the error goes away on copy however, I get a bunch of #REF errors. If I delete the scope Workbook ones, all seems okay and the errors on copy go away too, so perhaps this is the answer, but I'm nervous about what effect this deletion will have and wonder how the Workbook ones came into existence in the first place. Will it be safe to just delete the Workbook name manager scoped entries and how might these have come into existence without my knowing it to begin with?

    Read the article

  • Why is my display name in Ubuntu Software Center some weird set of letters?

    - by Ike
    In USC, after I submit a review, my display name is "Bnxdcty"... a swell name, but where did it come from? I have checked the ubuntu single sign on page, verified my nickname on there, changed it to something else and back again for good measure, but still my reviewer name is somehow still "Bnxdcty". I even unauthorized ubuntu software center and then re-opened it/authorized it to my account. Does this just appear as this to me and others see my correct user nickname? It doesn't bother as much as it confuses me. I just know it will be something stupid that everyone knows but me.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

< Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >