Search Results

Search found 16838 results on 674 pages for 'writing patterns dita cms'.

Page 501/674 | < Previous Page | 497 498 499 500 501 502 503 504 505 506 507 508  | Next Page >

• In web project can we write core services layer without knowledge of UI ?

  - by Silent Warrior

  I am working on web project. We are using flex as UI layer. My question is often we are writing core service layer separately from web/UI layer so we can reuse same services for different UI layer/technology. So practically is it possible to reuse same core layer services without any changes/addition in API with different kind of UI technologies/layers. For e.g. same core service layer with UI technology which supports synchronized request response (e.g. jsp etc.) and non synchronize or event driven UI technology (e.g Ajax, Flex, GWT etc.) or with multiple devices like (computers, mobiles, pdas etc.). Personally I feel its very tough to write core service layer without any knowledge of UI. Looking for thoughts from other people.

  Read the article

• networkstream always empty!

  - by ALEX

  hey I'm writing on an Server-Client program but when my client sends something, it never reaches my server! I'm sending like this: public void Send(string s) { char[] chars = s.ToCharArray(); byte[] bytes = chars.CharToByte(); nstream.Write(bytes, 0, bytes.Length); nstream.Flush(); } and Receiving in a background thread like this void CheckIncoming(object dd) { RecievedDelegate d = (RecievedDelegate)dd; try { while (true) { List<byte> bytelist = new List<byte>(); System.Threading.Thread.Sleep(1000); int ssss; ssss = nstream.ReadByte(); if (ssss > 1) { System.Diagnostics.Debugger.Break(); } if (bytelist.Count != 0) { d.Invoke(bytelist.ToArray()); } } } catch (Exception exp) { MSGBOX("ERROR:\n" + exp.Message); } } the ssss int is never 1 whats happening here???

  Read the article

• JQuery: After adding some AJAX, some of the jquery code no longer works

  - by fwaokda

  Here's a pastebin link to my entire jQuery code. [ http://pastebin.com/w57ma5Gx ] The "Thumbnails" section was working fine before I added the ajax sections. Anyone can help me with why it quit working? And if I need to I can post another question but figured I'd try it here first. Whats a better way of writing the ajax code where it executes once upon loading the page and then every time I click the $("a#next") link afterwards? Right now I just repasted the code outside of the next link and that works, but seems silly to have the same code in two different places like that. Thanks!

  Read the article

• How to trigger Mouse-Over on iPhone?

  - by Andrew

  This might seem like a really dumb question, but I am writing an application and I have come across where my mouse-over, mouse-click and mouse-hover need different events bound to them. Now on Internet Explorer, Firefox, and Safari. It all works as expected. However, on my iPhone the actions will not trigger. Now my question is are their any specific ways I can have the Mouse-Over essentially be fired when I hold my finger down and trigger an event? An example where this doesn't work is right on this website when you hover over a comment it is supposed to display the +1 or flag icon. I am using jquery.

  Read the article

• create logging so that the messages will be displayed on screen and logged to a file

  - by robUK

  Hello, gcc 4.4.4 c89 I am writing a client/server application. I have finished and now I want to implement some logging feature that will display log messages on the screen as well as log to a file. However, I don't want to display all log messages (warning, error, critical, unrecoverable, debug, etc). Maybe I can set so that it will display, just errors and debug messages and nothing else. For example, the user might not be interested in the debug messages. Is there any design-pattern that I can follow? What do you normally for for logging? Any tutorials out there that address logging? many thanks for any suggestions,

  Read the article

• .NET Regular Expressions - Shorter match

  - by Xavier

  Hi Guys, I have a question regarding .NET regular expressions and how it defines matches. I am writing: var regex = new Regex("<tr><td>1</td><td>(.+)</td><td>(.+)</td>"); if (regex.IsMatch(str)) { var groups = regex.Match(str).Groups; var matches = new List<string>(); for (int i = 1; i < groups.Count; i++) matches.Add(groups[i].Value); return matches; } What I want is get the content of the two following tags. Instead it returns: [0]: Cell 1</td><td>Cell 2</td>... [1]: Last row of the table Why is the first match taking </td> and the rest of the string instead of stopping at </td>?

  Read the article

• PHP preg_match Math Function

  - by Matt

  I'm writing a script that will allow a user to input a string that is a math statement, to then be evaluated. I however have hit a roadblock. I cannot figure out how, using preg_match, to dissallow statements that have variables in them. Using this, $calc = create_function("", "return (" . $string . ");" ); $calc();, allows users to input a string that will be evaluated, but it crashes whenever something like echo 'foo'; is put in place of the variable $string.

  Read the article

• finding the numbers in a given range?

  - by Jamis

  Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

  Read the article

• How do I compare vectors in C++?

  - by Sam Phelps

  I am trying to compare two vector objects, and return a single vector containing all the chars which appear in both vectors. How would I go about this without writing some horribly complex manual method which compares every char in the first vector to every char in the second vector and using an if to add it to a third vector (which would be returned) if they match. Maybe my lack of real experience with vectors is making me imagine this will be harder than it really is, but I suspect there is some simplier way which I have been unable to find through searching.

  Read the article

• Language restrictions on iPhone lifted?

  - by John Smith

  Apparently Apple has changed some term in the agreement again. From http://www.appleoutsider.com/2010/06/10/hello-lua/ section 3.3.2 is now Unless otherwise approved by Apple in writing, no interpreted code may be downloaded or used in an Application except for code that is interpreted and run by Apple’s Documented APIs and built-in interpreter(s). Notwithstanding the foregoing, with Apple’s prior written consent, an Application may use embedded interpreted code in a limited way if such use is solely for providing minor features or functionality that are consistent with the intended and advertised purpose of the Application. instead of the original No interpreted code may be downloaded or used in an Application except for code that is interpreted and run by Apple’s Documented APIs and built-in interpreter(s). I am more interested in embedding Lua, but other people have other embeddings they want to make. I am wondering how you ask for permission, and what they mean by the terms "minor features" and "consistent" and how will Apple interpret this section? It seems to have enough loopholes to drive a real firetruck through.

  Read the article

• how to remove error text from the email format checker code?

  - by rdesai

  I have been writing a code for validating forms using javascript/jquery. Following is a code snippet for checking email format. The problem is when I enter invalid email, it recognizes it, but when I go back to this field and enter correct email, the error text still stays even though I have used the 'else' part. How do I remove the error text in this case? if(e1.value!=''){ var emailRegEx = /^[A-Z0-9._%+-]+@[A-Z0-9.-]+\.[A-Z]{2,4}$/i; if (document.signupForm.email1.value.search(emailRegEx) == -1) { $("#err_email1").html("Please enter valid email address."); } status=0; } else{ $("#err_email1").html(""); status=1; }

  Read the article

• Performance when accessing class members

  - by Dr. Acula

  I'm writing something performance-critical and wanted to know if it could make a difference if I use: int test( int a, int b, int c ) { // Do millions of calculations with a, b, c } or class myStorage { public: int a, b, c; }; int test( myStorage values ) { // Do millions of calculations with values.a, values.b, values.c } Does this basically result in similar code? Is there an extra overhead of accessing the class members? I'm sure that this is clear to an expert in C++ so I won't try and write an unrealistic benchmark for it right now

  Read the article

• Facebook action and object submission

  - by tijanja

  Am new to Facebook sdk and i want to use it in my project (blackberry app) has the developer i tried writing to my timeline with the code blow through a web service and i was able to write to my timeline, my question is this must i create an action and object that must be submitted for approval before other users can use my app to write to their timeline? because permission are not granted when users try to write to their timeline. $ret_obj = $facebook->api('/me/feed', 'POST',array('link' => 'www.****.com','message' => $user_profile["name"].' just downloaded W1')); echo '<pre>Post ID: ' . $ret_obj['id'] . '</pre>';

  Read the article

• Which one is better to have auto-implemented property with private setter or private field and property just getter?

  - by PLB

  My question may be a part of an old topic - "properties vs fields". I have situation where variable is read-only for outside class but needs to modified inside a class. I can approach it in 2 ways: First: private Type m_Field; public Type MyProperty { get { return m_Field; } } Second: public Type MyProperty { get; private set; } After reading several articles (that mostly covered benefits of using public properties instead of public fields) I did not get idea if the second method has some advantage over the first one but writing less code. I am interested which one will be better practice to use in projects (and why) or it's just a personal choice. Maybe this question does not belong to SO so I apologize in advance.

  Read the article

• How to track conversion rate (clicks to sales) from an internal advertising system?

  - by Ed Woodcock

  I am currently writing an interal advertising system for a company client's website, where the adverts will only be seen by internal users, and all transactions take place internally to the site (i.e. the adverts are for member-only content available on the site). Does anyone have any recommendations as to the best way to track the conversion rate of these adverts (i.e. views:clicks:sales)? EDIT I'm not looking for a 'Why don't you use google analystics'-type answer, I'm looking into possible architecture outlines, i.e. a 'why don't use store a guid in a cache temporarily and see if it ties to the advert' kind of answer. /EDIT In a previous job I did something based on an internal cache, which simply did view:click tracking, however the addition of the sales rate makes this task more complex, especially if we take into account the idea that someone may click through to an advert and not purchase immediately. Cheers, Ed (N.B. I'm leaving this purposely vague in order to (hopefully) get some answers that provide ideas I've yet to have thought of by coming at the problem from a different angle)

  Read the article

• How to test that invalid arguments raise an ArgumentError exception using RSpec?

  - by John Topley

  I'm writing a RubyGem that can raise an ArgumentError if the arguments supplied to its single method are invalid. How can I write a test for this using RSpec? The example below shows the sort of implementation I have in mind. The bar method expects a single boolean argument (:baz), the type of which is checked to make sure that it actually is a boolean: module Foo def self.bar(options = {}) baz = options.fetch(:baz, true) validate_arguments(baz) end def self.validate_arguments(baz) raise(ArgumentError, ":baz must be a boolean") unless valid_baz?(baz) end def self.valid_baz?(baz) baz.is_a?(TrueClass) || baz.is_a?(FalseClass) end end

  Read the article

• How can I show my activity(screen) on top of in-calling screen?

  - by upright

  Hi, all! I'm writing an android application which listens the phone calling events. What I want to do is, if there is a call incomes or outgoes, an activity shows with my customized info. I want to this screen keeps showing during the calling period. However, if a call is coming, the system UI which shows the contact always appears on top of my activity. I've found some apps already realized this function, but mine can't. :( Is there any way that I can achieve my goal? Any help will be appreciated.

  Read the article

• SWIG interface file questions

  - by morpheous

  I am writing a C/C++ extension module for other languages and I am using SWIG to generate the bindings. I have two questions Can I include more than 1 header file in the declaration part of the interface file e.g.: /* Declarations exposed to wrapper: */ > %{ > #define SWIG_FILE_WITH_INIT > #include "a.h" > #include "b.h" > #include "c.h" %} In all of the examples I have seen so far, after the header include declaration (as shown above), the functions declared in the header are then declared again in the interface file. Is this really necessary, as it means there are two copies of the function declarations that need to be maintained. Note: I can appreciate that some functions/methods declaration may need to be 'decorated' with the 'newobject' declaration so these obviously need to be in the interface file, to avoid memory leaks - however, I would have though that it would be sufficient to include the headers and then ONLY the declarations of the functions/methods that need to be declared with 'newobject' - is this recommended way of doing things?

  Read the article

• Tabs.url is undefined

  - by Notionwork

  I have no clue what I'm doing wrong here! This should be working I believe. I'm writing a chrome extension and this should get the current tab's url and set the html of #current-tab to the url (for testing purposes). The code successfully gets to the callback, but it says that tab.url is undefined when I put it in an alert box, and it does not put it's value in #current-tab. Here's the code I have: $('#get-tab').click(function(){ chrome.tabs.query({"active" : true}, function(tab){ for (var i = 0; i < tab.length; i++) { alert(tab.url); $('#current-tab').append(tab.url); }; }); });

  Read the article

• What happens when I MPI_Send to a process that has finished?

  - by nieldw

  What happens when I MPI_Send to a process that has finished? I am learning MPI, and writing a small sugar distribution-simulation in C. When the factories stop producing, those processes end. When warehouses run empty, they end. Can I somehow tell if the shop's order to a warehouse did not succeed(because the warehouse process has ended) by looking at the return value of MPI_Send? The documentation doesn't mention a specific error code for this situation, but that no error is returned for success. Can I do: if (MPI_Send(...)) { ... /* destination has ended */ ... } And disregard the error code? Thanks

  Read the article

• How to create a MySQL query for time based elements with a 'safe window'?

  - by pj4533

  I am no SQL expert, far from it. I am writing a Rails application, and I am new at that as well. I come from a desktop programming background. My application has a table of data, one of the columns is the time at which the data was logged. I want to create a query with a 'safe window' around EACH row. By that I mean, it returns the first row, then for X minutes (based on the timelogged column) it won't return any data, once X minutes is up, it will return the next row. For example: ID | TimeLogged 1 | 3/5/2010 12:01:01 2 | 3/5/2010 12:01:50 3 | 3/5/2010 12:02:03 4 | 3/5/2010 12:10:30 5 | 3/5/2010 01:30:03 6 | 3/5/2010 01:31:05 With a 'safe window' of 5 minutes I want to create a query to return: 1 | 3/5/2010 12:01:01 4 | 3/5/2010 12:10:30 5 | 3/5/2010 01:30:03 (It skipped the 12:01:50 and 12:02:03 items because they occurred within 5 minutes of the first item.) Another example, with a 'safe window' of 15 minutes I want to return: 1 | 3/5/2010 12:01:01 5 | 3/5/2010 01:30:03 Perhaps I have to just return all data and parse it myself?

  Read the article

• Ruby Hash.merge with specified keys only

  - by ba

  I'm pretty sure I saw on a Rails related site something along the lines of: def my_function(*opts) opts.require_keys(:first, :second, :third) end And if one of the keys in require_keys weren't specified, or if there were keys that weren't specified, an exception was raised. I've been looking through ActiveSupport and I guess I might be looking for something like the inverse of except. I like to try and use as much of the framework as possible compared to writing my own code, that's the reason I'm asking when I know how to make the same functionality on my own. :) At the moment I'm doing it through the normal merge routine and making sure that I have what I need with some IFs.

  Read the article

• Is there a way in C# 4.0 to have a method take a delegate with the parameters baked in?

  - by Rob Packwood

  I have this code for reporting on a simple demo app I am writing: private static void ReportOnTimedProcess(Action process) { var stopwatch = new Stopwatch(); stopwatch.Start(); process(); stopwatch.Stop(); Console.WriteLine("Process took {0} seconds", stopwatch.ElapsedMilliseconds*1000); } I basically want to track the time of any process. I am trying to have this method take a delegate as a parameter that can have any number of varying parameters. Is there some way an Expression can do this?

  Read the article

• How to properly design a simple favorites and blocked table?

  - by Nils Riedemann

  Hey, i am currently writing a webapp in rails where users can mark items as favorites and also block them. I came up two ways and wondered which one is more common/better way. 1. Separate join tables Would it be wise to have 2 tables for this? Like: users_favorites - user_id - item_id users_blocked - user_id - item_id 2. single table users_marks (or so) - users_id - item_id - type (["fav", "blk"]) Both ways seem to have advantages. Which one would you use and why?

  Read the article

• Strings - Filling In Leading Zeros Wtih A Zero

  - by headscratch

  I'm reading an array of hard-coded strings of numeric characters - all positions are filled with a character, even for the leading zeros. Thus, can confidently parse it using substring(start, end) to convert to numeric. Example: "0123 0456 0789" However, a string coming from a database does not fill in the leading zero with a 'zero character', it simply fetches the '123 456 789', which is correct for an arithmetic number but not for my needs and makes for parsing trouble. Before writing conditionals to check for leading zeros and adding them to the string if needed, is there a simple way of specifying they be filled with a character ? I'm not finding this in my Java book... I could have done the three conditionals in the time it took to post this but, this is more about 'education'... Thanks

  Read the article

< Previous Page | 497 498 499 500 501 502 503 504 505 506 507 508  | Next Page >