Search Results

Search found 55276 results on 2212 pages for 'eicar test string'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 502/2212 | < Previous Page | 498 499 500 501 502 503 504 505 506 507 508 509  | Next Page >

  • new JDK 7 features

    - by xdevel2000
    I wish to test the new features that will came with the next JDK like project coin, project lambda etc. but the last JDK 7 to download will not have any already implemented! From which build can I test them? I think it's incredible that, now in may 2010 at few months to the official final release (november 2010????) for we developers there is no possibility to test any of this features!!

    Read the article

  • Is it bad practice to initialize a variable to a dummy value?

    - by froadie
    This question is a result of the answers to this question that I just asked. It was claimed that this code is "ugly" because it initializes a variable to a value that will never be read: String tempName = null; try{ tempName = buildFileName(); } catch(Exception e){ ... System.exit(1); } FILE_NAME = tempName; Is this indeed bad practice? Should one avoid initializing variables to dummy values that will never actually be used? (EDIT - And what about initializing a String variable to "" before a loop that will concatenate values to the String...? Or is this in a separate category? e.g. String whatever = ""; for(String str : someCollection){ whatever += str; } )

    Read the article

  • get first parent of iframe javascript

    - by baaroz
    I have a iframe inside test.aspx,when the user click on a pay button inside the Iframe,the iframe redirct to check.aspx that has same iframe if payment was success on first time, then window.parent.location.href==test.aspx if payment was failed the iframe redirect again to check.aspx,so now the window.parent.location.href==check.aspx while the payement was failed the the iframe keep redirect to check.aspx and the parent location keep changing ,so for example if the client failed 3 time,inside check.aspx I need to do window.parent.parent.parent.location.href to get test.aspx redirect. when the user payment was success ,then I want to redirect the test.aspx but I can't know how much child iframe window he has! I need something like window.parent[0].location.href=success.aspx,so I will be able to redirect the first father window. Thanks for any Help Baaroz

    Read the article

  • excplicitly casting constness in

    - by jimifiki
    With the following code void TestF(const double ** testv){;} void callTest(){ double** test; TestF(test); } I get this: error C2664: 'TestF' : cannot convert parameter 1 from 'double **' to 'const double **' I cannot understand why. Why test cannot be silently casted to const double**? Why should I do it explicitly? I know that TestF(const_cast<const double**>(test)) makes my code correct, but I feel this should be unnecessary. Are there some key concepts about const that I'm missing?

    Read the article

  • Casting complex class into a dataset?

    - by iTayb
    This is the class I'm trying to turn into a dataset: public class BookStore { private List<Book> booksList; } public class Book { private string name; private string imageurl; private string subject; private string author; private int level; private int year; private int rating; private List<string> booksellers; private List<decimal> bookprices; } There are proprieties, of course. How can I turn it into a dataset? Thank you very much.

    Read the article

  • loop for Cursor1.moveToPosition() in android

    - by Edward Sullen
    I want to get data in the first column of all row from my database and convert to String[] ... List<String> item1 = new ArrayList<String>(); // c is a cursor which pointed from a database for(int i=0;i<=nombre_row;i++) { c.moveToPosition(i); item1.add(c.getString(0)); } String[] strarray = new String[item1.size()]; item1.toArray(strarray ); I've tried to command step by step, and found that the problem is in the Loop for.... Please help... thanks in advance for all answer.

    Read the article

  • Delete an (exact) element from an array in php

    - by Holian
    Hi Masters! For example i have an array like this: $test= array("0" => "412", "1" => "2"); I would like to delete the element if its = 2 $delete=2; for($j=0;$j<$dbj;$j++) { if (in_array($delete, $test)) { unset($test[$j]); } } print_r($test); But with this, unfortunatelly the array will empty... How can i delete an exact element from the array? Thank you

    Read the article

  • Jquery ajax load not working

    - by Slay
    This is my code: test.html <html> <head> <title>test</title> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.8.2/jquery.min.js"></script> <script> $(document).ready(function(){ $(window).bind('hashchange', function(){ $('#result').load('test2.html', function(){ alert('Load was performed.'); }); }); }); </script> </head> <body> <a href="#Test1">Test 1</a> <a href="#Test2">Test 2</a> <div id="result"></div> </body> </html> test2.html <h3>This is content from test2.html</h3> I want to detect the specific page to load using window.hash in change. For instance if user go to http://localhost/test.html#test2 The main container(result) in the page will do an ajax load call to test2.html to get the content. I can't manage to get this simple code working. Appreciate if someone can guide me in the right direction. Thanks.

    Read the article

  • suppose there is a class which contains 4 data fields.i have to read these value from xml file and s

    - by SunilRai86
    suppose there is a class which contains 4 fields.i have to read these value from xml file and set that value to fields the xml file is like that <Root> <Application > <AppName>somevalue</AppName> <IdMark>somevalue</IdMark> <ClassName>ABC</ClassName> <ExecName>XYZ</ExecName> </Application> <Application> <AppName>somevalue</AppName> <IdMark>somevalue</IdMark> <ClassName>abc</ClassName> <ExecName>xyz</ExecName> </Application> </Root> now i have to read all the values from xml file and set each value to particular fields. i hav done reading of the xml file and i saved the retrieved value in arraylist. the code is like that public class CXmlFileHook { string appname; string classname; string idmark; string execname; string ctor; public CXmlFileHook() { this.appname = "Not Set"; this.idmark = "Not Set"; this.classname = "Not Set"; this.execname = "Not Set"; this.ctor = "CXmlFileHook()"; } public void readFromXmlFile(string path) { XmlTextReader oRreader = new XmlTextReader(@"D:\\Documents and Settings\\sunilr\\Desktop\\MLPACK.xml"); //string[] strNodeValues = new string[4] { "?","?","?","?"}; ArrayList oArrayList = new ArrayList(); while (oRreader.Read()) { if (oRreader.NodeType == XmlNodeType.Element) { switch (oRreader.Name) { case "AppName": oRreader.Read(); //strNodeValues[0] =oRreader.Value; oArrayList.Add(oRreader.Value); break; case "IdMark": oRreader.Read(); //strNodeValues[1] = oRreader.Value; oArrayList.Add(oRreader.Value); break; case "ClassName": oRreader.Read(); //strNodeValues[2] = oRreader.Value; oArrayList.Add(oRreader.Value); break; case "ExecName": oRreader.Read(); //strNodeValues[3] = oRreader.Value; oArrayList.Add(oRreader.Value); break; } } } Console.WriteLine("Reading from arraylist"); Console.WriteLine("-------------------------"); for (int i = 0; i < oArrayList.Count; i++) { //Console.WriteLine("Reading from Sting[]"+ strNodeValues[i]); Console.WriteLine(oArrayList[i]); } //this.appname = strNodeValues[0]; //this.idmark = strNodeValues[1]; //this.classname = strNodeValues[2]; //this.execname = strNodeValues[3]; this.appname = oArrayList[0].ToString(); this.idmark = oArrayList[1].ToString(); this.classname = oArrayList[2].ToString(); this.execname = oArrayList[3].ToString(); } static string vInformation; public void showCurrentState(string path) { FileStream oFileStream = new FileStream(path, FileMode.Append, FileAccess.Write); StreamWriter oStreamWriter = new StreamWriter(oFileStream); oStreamWriter.WriteLine("****************************************************************"); oStreamWriter.WriteLine(" Log File "); oStreamWriter.WriteLine("****************************************************************"); CXmlFileHook oFilehook = new CXmlFileHook(); //Type t = Type.GetType(this._classname); //Type t = typeof(CConfigFileHook); DateTime oToday = DateTime.Now; vInformation += "Logfile created on : "; vInformation += oToday + Environment.NewLine; vInformation += "Public " + Environment.NewLine; vInformation += "----------------------------------------------" + Environment.NewLine; vInformation += "Private " + Environment.NewLine; vInformation += "-----------------------------------------------" + Environment.NewLine; vInformation += "ctor = " + this.ctor + Environment.NewLine; vInformation += "appname = " + this.appname + Environment.NewLine; vInformation += "idmark = " + this.idmark + Environment.NewLine; vInformation += "classname = " + this.classname + Environment.NewLine; vInformation += "execname = " + this.execname + Environment.NewLine; vInformation += "------------------------------------------------" + Environment.NewLine; vInformation += "Protected" + Environment.NewLine; vInformation += "------------------------------------------------" + Environment.NewLine; oStreamWriter.WriteLine(vInformation); oStreamWriter.Flush(); oStreamWriter.Close(); oFileStream.Close(); } } here i set set the fields according to arraylist index but i dont want is there any another solution for this....

    Read the article

  • Why does this MSDN example for Func<> delegate have a superfluous Select() call?

    - by Dan
    The MSDN gives this code example in the article on the Func Generic Delegate: Func<String, int, bool> predicate = ( str, index) => str.Length == index; String[] words = { "orange", "apple", "Article", "elephant", "star", "and" }; IEnumerable<String> aWords = words.Where(predicate).Select(str => str); foreach (String word in aWords) Console.WriteLine(word); I understand what all this is doing. What I don't understand is the Select(str => str) bit. Surely that's not needed? If you leave it out and just have IEnumerable<String> aWords = words.Where(predicate); then you still get an IEnumerable back that contains the same results, and the code prints the same thing. Am I missing something, or is the example misleading?

    Read the article

  • replace \n and \r\n with <br /> in java

    - by Bala R
    This has been asked several times for several languages but I can't get it to work. I have a string like this String str = "This is a string.\nThis is a long string."; And I'm trying to replace the \n with <br /> using str = str.replaceAll("(\r\n|\n)", "<br />"); but the \n is not getting replaced. I tried to use this RegEx Tool to verify and I see the same result. The input string does not have a match for "(\r\n|\n)". What am i doing wrong ?

    Read the article

  • Generic Dictionary - Getting Conversion Error

    - by pm_2
    The following code is giving me an error: // GetDirectoryList() returns Dictionary<string, DirectoryInfo> Dictionary<string, DirectoryInfo> myDirectoryList = GetDirectoryList(); // The following line gives a compile error foreach (Dictionary<string, DirectoryInfo> eachItem in myDirectoryList) The error it gives is as follows: Cannot convert type 'System.Collections.Generic.KeyValuePair<string,System.IO.DirectoryInfo>' to 'System.Collections.Generic.Dictionary<string,System.IO.DirectoryInfo>’ My question is: why is it trying to perform this conversion? Can I not use a foreach loop on this type of object?

    Read the article

  • ActionScript Reading Static Const Array

    - by TheDarkIn1978
    how can i evaluate weather my test array is equal to my static constant DEFAULT_ARRAY? shouldn't my output be returning true? public class myClass extends Sprite { private static const DEFAULT_ARRAY:Array = new Array(1, 2, 3); public function myClass() { var test:Array = new Array(1, 2, 3); trace (test == DEFAULT_ARRAY); } //traces false

    Read the article

  • Any way to break if statement in PHP?

    - by Usman
    Is there any command in PHP to stop executing the current or parent if statement, same as break or break(1) for switch/loop. For example $arr=array('a','b'); foreach($arr as $val) { break; echo "test"; } echo "finish"; in the above code PHP will not do echo "test"; and will go to echo "finish"; I need this for if $a="test"; if("test"==$a) { break; echo "yes"; // I don't want this line or lines after to be executed, without using another if } echo "finish"; I want to break the if statement above and stop executing echo "yes"; or such codes which are no longer necessary to be executed, there may be or may not be an additional condition, is there way to do this?

    Read the article

  • Passing parameters among views in a navigation frame INSIDE a custom control

    - by NetWriter
    I created a silverlight 3 application with a navigation frame and 3 views: search, add and edit. I used the app file to pass parameters among the 3 pages, eg: ((App)Application.Current).SNIPSELECTED = currentSnip; Then in the receiving page: currentSnip = ((App)Application.Current).SNIPSELECTED; currentSnip is a SnipItem object: public class SnipItem { public string itemID {get;set;} public string category {get;set;} public string itemDescription {get;set;} public string codeSnip {get;set;} } This worked fine until I decided to make this entire application into a user control and put that inside a second silverlight application with its own navigation frame and app file. The app files are getting confused. The first app file with all my parameter passing is not being read. I know how to pass a simple parameter between views in the first application without the app file (in a query string), but how about these custom types like my currentSnip above?

    Read the article

  • Problem in populating a dictionary object using Enumerable.Range() (C#3.0)

    - by Newbie
    If I do for (int i = 0; i < appSettings.Count; i++) { string key = appSettings.Keys[i]; euFileDictionary.Add(key, appSettings[i]); } It is working fine. When I am trying the same thing using Enumerable.Range(0, appSettings.Count).Select(i => { string Key = appSettings.Keys[i]; string Value = appSettings[i]; euFileDictionary.Add(Key, Value); }).ToDictionary<string,string>(); I am getting a compile time error The type arguments for method 'System.Linq.Enumerable.Select(System.Collections.Generic.IEnumerable, System.Func)' cannot be inferred from the usage. Try specifying the type arguments explicitly. Any idea? Using C#3.0 Thanks

    Read the article

  • @echo off in DOS (cmd)

    - by Rayne
    I'm trying to write a BAT script and I have the following: @echo off REM Comments here SETLOCAL ENABLEDELAYEDEXPANSION set PROG_ROOT=C:\Prog set ONE=1 echo 1>> %PROG_ROOT\test.txt echo %ONE%>> %PROG_ROOT\test.txt for /f "tokens=*" %%f in (folders.txt) do ( echo %%f>> %PROG_ROOT\test.txt ) ENDLOCAL My folders.txt contains the number "5". My test.txt output is ECHO is off ECHO is off 5 I don't understand why the first 2 lines of output has "ECHO is off", while the third line is printed out correctly. How do I print the correct output?

    Read the article

  • NSString inheritance

    - by Stef
    Hi, I'm doing an useless thing for my first step in Obj-C @interface String : NSString { int m_isnull; } - (id) init; - (int) isNull; @end @implementation String - (id) init { self = [super init]; m_isnull=1; return self; } - (int) isNull { return m_isnull; } @end test : String *a; a=@"ok"; Works fine, but just 2 little questions 1) When I'm compiling I have this warning warning: incompatible Objective-C types assigning 'struct NSString *', expected 'struct String *' I don't know how to avoid it !? 2) a=@"ok" is a fastest way to initialize a string, but when I'm debugging, I don't stop by at my init constructor why ?

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • Make Tar + gzip ignore directory paths

    - by norm
    Anybody know if it is possible that when making a tar + gzip through 'tar c ...' command if the relative paths will be ignored upon expanding. e.g. tar cvf test.tgz foo ../../files/bar and then expanding the test.tgz with: tar xvf test.tgz gives a dir containing: foo files/bar i want the dir to contain the files foo bar is this possible?

    Read the article

  • Access attribute values of empty element tag in xml

    - by meenakshik
    Hello, I have a xml where I got some empty complex elements and I need to access the attribute values of this element. <test> <a> <abc-metadata name="testData" value="This is a test"/> </a> </test> I want to get hold of the 'testData' and 'This is a test' values. I do read the document and I tried accessing it document.getElementsByTagName . I am sure there is some way to access attributes of element tags but somehow it throws me nullpointer exception. Thanks in advance

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 498 499 500 501 502 503 504 505 506 507 508 509  | Next Page >