Search Results

Search found 55276 results on 2212 pages for 'eicar test string'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 502/2212 | < Previous Page | 498 499 500 501 502 503 504 505 506 507 508 509  | Next Page >

  • How to determine number of function arguments dynamically

    - by Kam
    I have the following code: #include <iostream> #include <functional> class test { public: typedef std::function<bool(int)> Handler; void handler(Handler h){h(5);} }; class test2 { public: template< typename Ret2, typename Ret, typename Class, typename Param> inline Ret2 MemFn(Ret (Class::*f)(Param), int arg_num) { if (arg_num == 1) return std::bind(f, this, std::placeholders::_1); } bool f(int x){ std::cout << x << std::endl; return true;} }; int main() { test t; test2 t2; t.handler(t2.MemFn<test::Handler>(&test2::f, 1)); return 0; } It works as expected. I would like to be able to call this: t.handler(t2.MemFn<test::Handler>(&test2::f)); instead of t.handler(t2.MemFn<test::Handler>(&test2::f, 1)); Basically I need MemFn to determine in runtime what Handler expects as the number of arguments. Is that even possible?

    Read the article

  • replace \n and \r\n with <br /> in java

    - by Bala R
    This has been asked several times for several languages but I can't get it to work. I have a string like this String str = "This is a string.\nThis is a long string."; And I'm trying to replace the \n with <br /> using str = str.replaceAll("(\r\n|\n)", "<br />"); but the \n is not getting replaced. I tried to use this RegEx Tool to verify and I see the same result. The input string does not have a match for "(\r\n|\n)". What am i doing wrong ?

    Read the article

  • JPA Native Query (SQL View)

    - by Uchenna
    I have two Entities Customer and Account. @Entity @Table(name="customer") public class Customer { private Long id; private String name; private String accountType; private String accountName; ... } @Entity @Table(name="account") public class Account { private Long id; private String accountName; private String accountType; ... } i have a an sql query select a.id as account_id, a.account_name, a.account_type, d.id, d.name from account a, customer d Assumption account and customer tables are created during application startup. accountType and accountName fields of Customer entity should not be created. That is, only id and name columns will be created. Question How do i run the above sql query and return a Customer Entity Object with the accountType and accountName properties populated with sql query's account_name and account_type values. Thanks

    Read the article

  • loop for Cursor1.moveToPosition() in android

    - by Edward Sullen
    I want to get data in the first column of all row from my database and convert to String[] ... List<String> item1 = new ArrayList<String>(); // c is a cursor which pointed from a database for(int i=0;i<=nombre_row;i++) { c.moveToPosition(i); item1.add(c.getString(0)); } String[] strarray = new String[item1.size()]; item1.toArray(strarray ); I've tried to command step by step, and found that the problem is in the Loop for.... Please help... thanks in advance for all answer.

    Read the article

  • suppose there is a class which contains 4 data fields.i have to read these value from xml file and s

    - by SunilRai86
    suppose there is a class which contains 4 fields.i have to read these value from xml file and set that value to fields the xml file is like that <Root> <Application > <AppName>somevalue</AppName> <IdMark>somevalue</IdMark> <ClassName>ABC</ClassName> <ExecName>XYZ</ExecName> </Application> <Application> <AppName>somevalue</AppName> <IdMark>somevalue</IdMark> <ClassName>abc</ClassName> <ExecName>xyz</ExecName> </Application> </Root> now i have to read all the values from xml file and set each value to particular fields. i hav done reading of the xml file and i saved the retrieved value in arraylist. the code is like that public class CXmlFileHook { string appname; string classname; string idmark; string execname; string ctor; public CXmlFileHook() { this.appname = "Not Set"; this.idmark = "Not Set"; this.classname = "Not Set"; this.execname = "Not Set"; this.ctor = "CXmlFileHook()"; } public void readFromXmlFile(string path) { XmlTextReader oRreader = new XmlTextReader(@"D:\\Documents and Settings\\sunilr\\Desktop\\MLPACK.xml"); //string[] strNodeValues = new string[4] { "?","?","?","?"}; ArrayList oArrayList = new ArrayList(); while (oRreader.Read()) { if (oRreader.NodeType == XmlNodeType.Element) { switch (oRreader.Name) { case "AppName": oRreader.Read(); //strNodeValues[0] =oRreader.Value; oArrayList.Add(oRreader.Value); break; case "IdMark": oRreader.Read(); //strNodeValues[1] = oRreader.Value; oArrayList.Add(oRreader.Value); break; case "ClassName": oRreader.Read(); //strNodeValues[2] = oRreader.Value; oArrayList.Add(oRreader.Value); break; case "ExecName": oRreader.Read(); //strNodeValues[3] = oRreader.Value; oArrayList.Add(oRreader.Value); break; } } } Console.WriteLine("Reading from arraylist"); Console.WriteLine("-------------------------"); for (int i = 0; i < oArrayList.Count; i++) { //Console.WriteLine("Reading from Sting[]"+ strNodeValues[i]); Console.WriteLine(oArrayList[i]); } //this.appname = strNodeValues[0]; //this.idmark = strNodeValues[1]; //this.classname = strNodeValues[2]; //this.execname = strNodeValues[3]; this.appname = oArrayList[0].ToString(); this.idmark = oArrayList[1].ToString(); this.classname = oArrayList[2].ToString(); this.execname = oArrayList[3].ToString(); } static string vInformation; public void showCurrentState(string path) { FileStream oFileStream = new FileStream(path, FileMode.Append, FileAccess.Write); StreamWriter oStreamWriter = new StreamWriter(oFileStream); oStreamWriter.WriteLine("****************************************************************"); oStreamWriter.WriteLine(" Log File "); oStreamWriter.WriteLine("****************************************************************"); CXmlFileHook oFilehook = new CXmlFileHook(); //Type t = Type.GetType(this._classname); //Type t = typeof(CConfigFileHook); DateTime oToday = DateTime.Now; vInformation += "Logfile created on : "; vInformation += oToday + Environment.NewLine; vInformation += "Public " + Environment.NewLine; vInformation += "----------------------------------------------" + Environment.NewLine; vInformation += "Private " + Environment.NewLine; vInformation += "-----------------------------------------------" + Environment.NewLine; vInformation += "ctor = " + this.ctor + Environment.NewLine; vInformation += "appname = " + this.appname + Environment.NewLine; vInformation += "idmark = " + this.idmark + Environment.NewLine; vInformation += "classname = " + this.classname + Environment.NewLine; vInformation += "execname = " + this.execname + Environment.NewLine; vInformation += "------------------------------------------------" + Environment.NewLine; vInformation += "Protected" + Environment.NewLine; vInformation += "------------------------------------------------" + Environment.NewLine; oStreamWriter.WriteLine(vInformation); oStreamWriter.Flush(); oStreamWriter.Close(); oFileStream.Close(); } } here i set set the fields according to arraylist index but i dont want is there any another solution for this....

    Read the article

  • Jquery ajax load not working

    - by Slay
    This is my code: test.html <html> <head> <title>test</title> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.8.2/jquery.min.js"></script> <script> $(document).ready(function(){ $(window).bind('hashchange', function(){ $('#result').load('test2.html', function(){ alert('Load was performed.'); }); }); }); </script> </head> <body> <a href="#Test1">Test 1</a> <a href="#Test2">Test 2</a> <div id="result"></div> </body> </html> test2.html <h3>This is content from test2.html</h3> I want to detect the specific page to load using window.hash in change. For instance if user go to http://localhost/test.html#test2 The main container(result) in the page will do an ajax load call to test2.html to get the content. I can't manage to get this simple code working. Appreciate if someone can guide me in the right direction. Thanks.

    Read the article

  • get first parent of iframe javascript

    - by baaroz
    I have a iframe inside test.aspx,when the user click on a pay button inside the Iframe,the iframe redirct to check.aspx that has same iframe if payment was success on first time, then window.parent.location.href==test.aspx if payment was failed the iframe redirect again to check.aspx,so now the window.parent.location.href==check.aspx while the payement was failed the the iframe keep redirect to check.aspx and the parent location keep changing ,so for example if the client failed 3 time,inside check.aspx I need to do window.parent.parent.parent.location.href to get test.aspx redirect. when the user payment was success ,then I want to redirect the test.aspx but I can't know how much child iframe window he has! I need something like window.parent[0].location.href=success.aspx,so I will be able to redirect the first father window. Thanks for any Help Baaroz

    Read the article

  • Generic Dictionary - Getting Conversion Error

    - by pm_2
    The following code is giving me an error: // GetDirectoryList() returns Dictionary<string, DirectoryInfo> Dictionary<string, DirectoryInfo> myDirectoryList = GetDirectoryList(); // The following line gives a compile error foreach (Dictionary<string, DirectoryInfo> eachItem in myDirectoryList) The error it gives is as follows: Cannot convert type 'System.Collections.Generic.KeyValuePair<string,System.IO.DirectoryInfo>' to 'System.Collections.Generic.Dictionary<string,System.IO.DirectoryInfo>’ My question is: why is it trying to perform this conversion? Can I not use a foreach loop on this type of object?

    Read the article

  • error message fix

    - by user1722654
    for (int i = 0; i < dataGridView1.Rows.Count; i++) { //bool sleected = false; if (dataGridView1.Rows[i].Cells[3].Value != null) { selected.Add(i); } } //string donew = ""; // line off error textBox1.Text = ((String)dataGridView1.Rows[1].Cells[2].Value); /* for (int i = 0; i < selected.Count; i++) { textAdded.Add((String)dataGridView1.Rows[0].Cells[2].Value); // donew += (String)dataGridView1.Rows[selected[i]].Cells[2].Value; }*/ I keep getting the error Unable to cast object of type 'System.Double' to type 'System.String' What can I do to overcome this?

    Read the article

  • Make Tar + gzip ignore directory paths

    - by norm
    Anybody know if it is possible that when making a tar + gzip through 'tar c ...' command if the relative paths will be ignored upon expanding. e.g. tar cvf test.tgz foo ../../files/bar and then expanding the test.tgz with: tar xvf test.tgz gives a dir containing: foo files/bar i want the dir to contain the files foo bar is this possible?

    Read the article

  • Problem in populating a dictionary object using Enumerable.Range() (C#3.0)

    - by Newbie
    If I do for (int i = 0; i < appSettings.Count; i++) { string key = appSettings.Keys[i]; euFileDictionary.Add(key, appSettings[i]); } It is working fine. When I am trying the same thing using Enumerable.Range(0, appSettings.Count).Select(i => { string Key = appSettings.Keys[i]; string Value = appSettings[i]; euFileDictionary.Add(Key, Value); }).ToDictionary<string,string>(); I am getting a compile time error The type arguments for method 'System.Linq.Enumerable.Select(System.Collections.Generic.IEnumerable, System.Func)' cannot be inferred from the usage. Try specifying the type arguments explicitly. Any idea? Using C#3.0 Thanks

    Read the article

  • Access attribute values of empty element tag in xml

    - by meenakshik
    Hello, I have a xml where I got some empty complex elements and I need to access the attribute values of this element. <test> <a> <abc-metadata name="testData" value="This is a test"/> </a> </test> I want to get hold of the 'testData' and 'This is a test' values. I do read the document and I tried accessing it document.getElementsByTagName . I am sure there is some way to access attributes of element tags but somehow it throws me nullpointer exception. Thanks in advance

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • Jquery form Ajax Submit

    - by user1766080
    I want to submit a form using ajax in the background. I tried: <div class="form-horizontal" id="form"> <label for="name" class="control-label">Username</label> <div class="controls"> <span id="name_input"><input type="text" name="name" id="medium" class='input-medium input-square'></span> <span class="help-inline" id = "ajax_load"></span> </div> <div class="form-actions"> <button class="btn btn-red5" onclick="resolve()">Login</button> <input type="reset" class='btn btn-danger' value="Reset"> </div> </div> And the Javascript: <script type="text/javascript"> var resolve = function () { jAlert('test', 'test'); $('#ajax_load').html('<a href="#" class="btn btn-mini btn-square tip" title="Reloading"><img src="templates/img/ajax-loader.gif" alt=""></a>'); $.ajax( { url : 'plugin.php?plugin=test', type : 'post', data: $("#form").serialize(), success : function( resp ) { if(resp.ajax_success == false) { } else { jAlert('test', 'test'); } } }); }; </script> I get an alert, but there is no form submit. I checked that with Live http headers. Why does it not submit the form?

    Read the article

  • ActionScript Reading Static Const Array

    - by TheDarkIn1978
    how can i evaluate weather my test array is equal to my static constant DEFAULT_ARRAY? shouldn't my output be returning true? public class myClass extends Sprite { private static const DEFAULT_ARRAY:Array = new Array(1, 2, 3); public function myClass() { var test:Array = new Array(1, 2, 3); trace (test == DEFAULT_ARRAY); } //traces false

    Read the article

  • @echo off in DOS (cmd)

    - by Rayne
    I'm trying to write a BAT script and I have the following: @echo off REM Comments here SETLOCAL ENABLEDELAYEDEXPANSION set PROG_ROOT=C:\Prog set ONE=1 echo 1>> %PROG_ROOT\test.txt echo %ONE%>> %PROG_ROOT\test.txt for /f "tokens=*" %%f in (folders.txt) do ( echo %%f>> %PROG_ROOT\test.txt ) ENDLOCAL My folders.txt contains the number "5". My test.txt output is ECHO is off ECHO is off 5 I don't understand why the first 2 lines of output has "ECHO is off", while the third line is printed out correctly. How do I print the correct output?

    Read the article

  • Delete an (exact) element from an array in php

    - by Holian
    Hi Masters! For example i have an array like this: $test= array("0" => "412", "1" => "2"); I would like to delete the element if its = 2 $delete=2; for($j=0;$j<$dbj;$j++) { if (in_array($delete, $test)) { unset($test[$j]); } } print_r($test); But with this, unfortunatelly the array will empty... How can i delete an exact element from the array? Thank you

    Read the article

  • excplicitly casting constness in

    - by jimifiki
    With the following code void TestF(const double ** testv){;} void callTest(){ double** test; TestF(test); } I get this: error C2664: 'TestF' : cannot convert parameter 1 from 'double **' to 'const double **' I cannot understand why. Why test cannot be silently casted to const double**? Why should I do it explicitly? I know that TestF(const_cast<const double**>(test)) makes my code correct, but I feel this should be unnecessary. Are there some key concepts about const that I'm missing?

    Read the article

  • Why does this MSDN example for Func<> delegate have a superfluous Select() call?

    - by Dan
    The MSDN gives this code example in the article on the Func Generic Delegate: Func<String, int, bool> predicate = ( str, index) => str.Length == index; String[] words = { "orange", "apple", "Article", "elephant", "star", "and" }; IEnumerable<String> aWords = words.Where(predicate).Select(str => str); foreach (String word in aWords) Console.WriteLine(word); I understand what all this is doing. What I don't understand is the Select(str => str) bit. Surely that's not needed? If you leave it out and just have IEnumerable<String> aWords = words.Where(predicate); then you still get an IEnumerable back that contains the same results, and the code prints the same thing. Am I missing something, or is the example misleading?

    Read the article

  • NSString inheritance

    - by Stef
    Hi, I'm doing an useless thing for my first step in Obj-C @interface String : NSString { int m_isnull; } - (id) init; - (int) isNull; @end @implementation String - (id) init { self = [super init]; m_isnull=1; return self; } - (int) isNull { return m_isnull; } @end test : String *a; a=@"ok"; Works fine, but just 2 little questions 1) When I'm compiling I have this warning warning: incompatible Objective-C types assigning 'struct NSString *', expected 'struct String *' I don't know how to avoid it !? 2) a=@"ok" is a fastest way to initialize a string, but when I'm debugging, I don't stop by at my init constructor why ?

    Read the article

  • Any way to break if statement in PHP?

    - by Usman
    Is there any command in PHP to stop executing the current or parent if statement, same as break or break(1) for switch/loop. For example $arr=array('a','b'); foreach($arr as $val) { break; echo "test"; } echo "finish"; in the above code PHP will not do echo "test"; and will go to echo "finish"; I need this for if $a="test"; if("test"==$a) { break; echo "yes"; // I don't want this line or lines after to be executed, without using another if } echo "finish"; I want to break the if statement above and stop executing echo "yes"; or such codes which are no longer necessary to be executed, there may be or may not be an additional condition, is there way to do this?

    Read the article

  • Multithreaded ActiveRecord requests in rspec

    - by jeem
    I'm trying to recreate a race condition in a test, so I can try out some solutions. I find that in the threads I create in my test, ActiveRecord always returns 0 for counts and nil for finds. For example, with 3 rows in the table "foos": it "whatever" do puts Foo.count 5.times do Thread.new do puts Foo.count end end end will print 3 0 0 0 0 0 test.log shows the expected query, the expected 6 times: SELECT count(*) AS count_all FROM `active_agents` Any idea what's going on here?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 498 499 500 501 502 503 504 505 506 507 508 509  | Next Page >