Search Results

Search found 52214 results on 2089 pages for 'partial application'.

Page 504/2089 | < Previous Page | 500 501 502 503 504 505 506 507 508 509 510 511  | Next Page >

  • In .net what are the difference between Eventlog and ManagementObject for retriving logs from remote

    - by Mitesh Patel
    I have found out following two ways for getting Application Event log entries from remote server. 1. Using EventLog object string logType = "Application"; EventLog ev = new EventLog(logType,"rspl200"); EventLogEntryCollection evColl = ev.Entries 2. Using ManagementObjectSearcher object ConnectionOptions co = new ConnectionOptions(); co.Username = "testA"; co.Password = "testA"; ManagementScope scope = new ManagementScope(@"\" + "machineName"+ @"\root\cimv2", co); scope.Connect(); SelectQuery query = new SelectQuery(@"select * from Win32_NtLogEvent"); EnumerationOptions opt = new EnumerationOptions(); opt.BlockSize = 1000; using (ManagementObjectSearcher searcher = new ManagementObjectSearcher(scope, query,opt)) { foreach (ManagementObject mo in searcher.Get()) { // write down log entries Console.Writeline(mo["EventCode"]); } } I can easily get remote eventlog using method #1 (Using EventLog object) without any security access denied exception. But using method #2 (Using ManagementObjectSearcher object) i get access denied exception. Actually I want remote event log (only application and also latest log not all application logs) to be displayed in treeview like below - ServerName - Logs + Error + Information + Warning Can anybody help me in this to find out best way from this or any other? Also the main thing is that user who reads remote logs may be in different domain than server. Thanks Mitesh Patel

    Read the article

  • Weird error running com-exposed assembly

    - by Bernabé Panarello
    I am facing the following issue when deploying a com-exposed assembly to my client's. The COM component should be consummed by a vb6 application. Here's how it's done 1) I have one c# project which has a class with a couple of methods exposed to COM 2) The project has references to multiple assemblies 3) I compile the project, generating a folder (named dllcom) that contains the assembly plus all the referenced dlls 4) I include in the folder a .bat which does the following: regasm /u c:\dllcom\LibInsertador.dll del LibInsertador.tlb regasm c:\dllcom\LibInsertador.dll /tlb:c:\dllcom\LibInsertador.tlb /codebase c:\dllcom\ pause 5) After running the bat locally in many workstations of my laboratory, i'm able to consume the generated tlb from my vb6 application without any problems. I'm even able to update the dll by only means of running this bat, without having to recompile the vb6 application. I mean that im not having issues of vb6 fiding and invoking the exposed com object. The problem 6) I send the SAME FOLDER to my client 7) They execute the .bat locally, without any errors 8) They execute the vb6 application, vb6 finds the main assembly, the .net code seems to run correctly (it's even able to generate a log file) until it has to intantiate it's first referenced assembly. Then, they get the following exception: "Could not load type 'GYF.Common.TypeBuilder' from assembly 'GYF_Common, Version=1.0.0.0, Culture=neutral, PublicKeyToken=null'." Where "GYF.Common" is an assembly referenced by LibInsertador and TypeBuilder is a class contained in GYF.Common. GYF.Common is not a signed assembly and it's not in the GAC, just in the same folder with Libinsertador. According to .net reflector, the version is correct. ¿Any ideas about what could be happening?

    Read the article

  • Ajax.BeginForm driving me crazy

    - by Fabio Milheiro
    ASP.NET MVC3 I have a partial view that is initially rendered inside a div. The following is the partial code: @model Venue.Models.Validation.CustomerRequestModel <script src="@Url.Content("~/Scripts/jquery-1.4.4.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.unobtrusive.min.js")" type="text/javascript"></script> <script type="text/javascript" src="/Scripts/MicrosoftAjax.js"></script> <script type="text/javascript" src="/Scripts/MicrosoftMvcAjax.js"></script> <script type="text/javascript" src="/Scripts/MicrosoftMvcValidation.js"></script> @{ Html.RenderPartial("Message"); } @Html.ValidationSummary() @using (Ajax.BeginForm( "Customer", "Service", null, new AjaxOptions() { HttpMethod = "post", InsertionMode = InsertionMode.Replace, LoadingElementDuration = 100, LoadingElementId = "loading-customer", OnBegin = "hideSubmitButton", OnSuccess = "hideForm", OnComplete = "showSubmitButton", OnFailure = "showErrorMessage", UpdateTargetId = "formclientes", }, new { id = "customer-form" })) { // Fields are all type="text" although some are numbers. <input type="text" name="Address" class="clientes_form" /> } The action: [AcceptVerbs(HttpVerbs.Post)] public ActionResult Customer(CustomerRequestModel customer) { // ... } In the immediate window, this is what I get: this.Request.IsAjaxRequest() false Why?!

    Read the article

  • ASP.NET Chart Control errors in Event Viewer

    - by Richard Reddy
    Hi, I have been using the ASP.NET chart controls for a while on win2k3 (32bit) setups without any issue but have noticed that on our new win2k8 (64bit) box I am getting a warning message showing up in the event viewer from the chart control. In my web.config file I have the following tag telling the Chart Control where I can store the Temp Files: <add key="ChartImageHandler" value="storage=file;timeout=20;dir=c:\TempImageFiles\;" /> Below is the warning message produced by the control: Event code: 3005 Event message: An unhandled exception has occurred. Event time: 10/7/2009 2:40:03 PM Event time (UTC): 10/7/2009 2:40:03 PM Event ID: 237c3b208962429e8bbc5a48ffd177f0 Event sequence: 2860 Event occurrence: 26 Event detail code: 0 Application information: Application domain: /LM/W3SVC/2/ROOT-1-128993655360497729 Trust level: Full Application Virtual Path: / Application Path: C:\data\sites\mydomain.com\ Machine name: 231692-WEB Process information: Process ID: 4068 Process name: w3wp.exe Account name: NT AUTHORITY\NETWORK SERVICE Exception information: Exception type: ArgumentException Exception message: The image is not found. Request information: Request URL: http://www.mydomain.com/ChartImg.axd?i=chart%5F0%5F3.png&g=bccc8aa11abb470980c60e8cf1e71e15 Request path: /ChartImg.axd User host address: my domain ip User: Is authenticated: False Authentication Type: Thread account name: NT AUTHORITY\NETWORK SERVICE Thread information: Thread ID: 7 Thread account name: NT AUTHORITY\NETWORK SERVICE Is impersonating: False Stack trace: at System.Web.UI.DataVisualization.Charting.ChartHttpHandler.ProcessSavedChartImage(HttpContext context) at System.Web.UI.DataVisualization.Charting.ChartHttpHandler.System.Web.IHttpHandler.ProcessRequest(HttpContext context) at System.Web.HttpApplication.CallHandlerExecutionStep.System.Web.HttpApplication.IExecutionStep.Execute() at System.Web.HttpApplication.ExecuteStep(IExecutionStep step, Boolean& completedSynchronously) It's worth pointing out that ALL of the chart images are displayed correctly on the screen so I'm not sure when/where the image not found error is being caused. Is this a 64bit issue? Thanks, Rich

    Read the article

  • General Drools Question

    - by El Guapo
    For the last few months my company has been using a product from a company called Informatica (previously AgentLogic) called RulePoint. This product has proven itself very easy to use with a well-developed and easy-to-use SDK for customization. The way we use the product for CEP is fairly trivial, we have 2 sources which we monitor for our rule data, the first being a JMS Queue, the second being a Jabber IM account. The product runs on any java-based application server (WebLogic, Tomcat, etc) and runs just about flawlessly. Last week my boss says, "Hey, I've heard that we may be able to do the same thing we are doing with RulePoint with an open-source product called Drools. Check it out and let me know what you think." I've heard of people using Drools for flow-based operations (validation, etc), however, I've never heard of anyone using their CEP product (Fusion) in practice. So, being the diligent worker, I have undertaken this task. I've downloaded all the files (version 5.0) and accompanying documentation and have started to read. I've read through just about all the docs and run most of the examples, but I still don't really see HOW drools works for CEP. While there are examples for using Data (or Facts, I guess) from JMS, I don't see how this thing stays "running", continuously monitoring a queue until the application is actually stopped. RulePoint pretty must just sits and listens, however, Drools seems to not. I could probably write a full-blown command-line application for our needs, however, I was hoping to leverage some of the benefits of using a application server provides. I guess I'm looking for some good tutorials or an example of how someone is using Drools and CEP in production. Thanks in advanced for any information, advice you may be able to provide.

    Read the article

  • issue in property file

    - by devuser
    I want to load the property file when tomcat is starting.so I'm using servletContextListener to do that and i can get values of property file to my web application. But i want to keep the same value after changing the property file once log into web application.But when i change the value of property file and log into system again it change the value to new one.I want to keep the same value that loaded when tomcat was starting.how can i implement this? My coding is as below import javax.servlet.*; import java.io.IOException; import java.util.Properties; import java.util.logging.Level; import java.util.logging.Logger; import java.io.*; import java.util.ResourceBundle; public final class sysProperties implements javax.servlet.ServletContextListener { private static Properties props = new Properties(); private static String file_name = "com/util/contact.properties"; public addSystemProperties() { } public void contextInitialized(ServletContextEvent servletContextEvent) { // Get the context ServletContext servletContext = servletContextEvent.getServletContext(); // Set a context attribute try { // props.load(servletContext.getResourceAsStream(file_name)); props.load(getClass().getClassLoader().getResourceAsStream(file_name)); System.out.println(" Application X is starting"); servletContext.setAttribute("h1",props.getProperty("home.h1")); servletContext.setAttribute("h2",props.getProperty("home.h2")); System.out.println("h1"+servletContext.getAttribute("h1")); System.out.println("h2"+ servletContext.getAttribute("h2")); ; } catch (Exception e) { System.out.println(" Error setting context attribute: " + e.getMessage()); } } public void contextDestroyed(ServletContextEvent servletContextEvent) { // Get the context ServletContext servletContext = servletContextEvent.getServletContext(); // Output the context variable we set earlier System.out.println(" Application X is shutting down"); System.out.println(" Value of h1 is: " + servletContext.getAttribute("h1")); System.out.println(" Value of h2 is: " + servletContext.getAttribute("h2")); // Clean up (not really necessary as the context is being destroyed, but let's be neat) servletContext.removeAttribute(props.getProperty("h1")); servletContext.removeAttribute(props.getProperty("h2")); } }

    Read the article

  • How to debug browser crash when running Silverlight app

    - by onedozenbagels
    I am on a team of three people who are developing a Silverlight application. On two of our developers' machines the app seems to randomly crash. It never crashes on the third developer's machine. The nature of the crash is that internet explorer just dies with an "Internet Explorer has stopped working" message. The problem details look like this: Problem Event Name: BEX Application Name: IEXPLORE.EXE Application Version: 8.0.6001.18882 Application Timestamp: 4b3ed243 Fault Module Name: StackHash_2cd8 Fault Module Version: 0.0.0.0 Fault Module Timestamp: 00000000 Exception Offset: 0024df00 Exception Code: c0000005 Exception Data: 00000008 OS Version: 6.0.6002.2.2.0.256.6 Locale ID: 1033 Additional Information 1: 2cd8 Additional Information 2: 0c337fa6c2057a9dbce1860c5e2d8315 Additional Information 3: e13b Additional Information 4: 5da012709e52526a1af19795dc4a33fd Then windows displays this message: "To help protect your computer, Data Execution Prevention has closed Internet Explorer." If I am attached to the app with the Visual Studio debugger the only information I get is this line in the output window: "The program '[2140] iexplore.exe: Silverlight' has exited with code -1073741819 (0xc0000005)." How should I go about debugging this problem? I'm not really sure where to start.

    Read the article

  • How to copy the shipping address to billing address

    - by Jerry
    Hi all I like to know if I can copy the shipping address to billing address. I got most of the parts done but I am not sure how to copy select menu (states) value to billing address. I really appreciate any helps. My code $(document).ready(function(){ Jquery $('#same').click(function(){ if($('#same').attr('checked')){ $('#bfName').val($('#fName').val()); $('#blName').val($('#lName').val()); $('#baddress1').val($('#address1').val()); $('#baddress2').val($('#address2').val()); $('#bcity').val($('#city').val()); alert(($('#state option:selected').val())); //not sure what to do here $('#bzip').val($('#zip').val()); }; }); Html <td><select name="state"> //shipping states......only partial codes. <option value="">None <option value="AL">Alabama <option value="AK">Alaska <option value="AZ">Arizona <option value="AR">Arkansas <option value="CA">California <option value="CO">Colorado <option value="CT">Connecticut </select></td> <td><select name="bstate"> //billing state................only partial codes. <option value="">None <option value="AL">Alabama <option value="AK">Alaska <option value="AZ">Arizona <option value="AR">Arkansas <option value="CA">California <option value="CO">Colorado <option value="CT">Connecticut </select></td> Thanks a lot!

    Read the article

  • Android SMS API

    - by Schildmeijer
    I know that the SMS content provider is not part of the public API (at least not documented), but if I understand correctly it's still possible to use many of the SMS features as long as you know how to use the API(?). E.g it's pretty straightforward to insert an SMS into your inbox: ContentValues values = new ContentValues(); values.put("address", "+457014921911"); contentResolver.insert(Uri.parse("content://sms"), values); Unfortunately this does not trigger the standard "new-SMS-in-your-inbox" notification. Is it possible to trigger this manually? Edit: AFAIK the "standard mail application (Messaging)" in Android is listening for incoming SMSes using the android.permission.RECEIVE_SMS permission. And then, when a new SMS has arrived, a status bar notification is inserted with a "special" notification id. So one solution to my problem (stated above) could be to find, and send the correct broadcast intent; something like "NEW SMS HAS ARRIVED"-intent. Edit: Downloaded a third party messaging application (chompsms) from Android market. This application satisfies my needs better. When i execute the code above the chompsms notice the new sms and shows the "standard status bar notification". So I would say that the standard Android Messaging application is not detecting sms properly? Or am I wrong?

    Read the article

  • WPF binding fails with custom add and remove accessors for INotifyPropertyChanged.PropertyChanged

    - by emddudley
    I have a scenario which is causing strange behavior with WPF data binding and INotifyPropertyChanged. I want a private member of the data binding source to handle the INotifyPropertyChanged.PropertyChanged event. I get some exceptions which haven't helped me debug, even when I have "Enable .NET Framework source stepping" checked in Visual Studio's options: A first chance exception of type 'System.ArgumentException' occurred in mscorlib.dll A first chance exception of type 'System.ArgumentException' occurred in mscorlib.dll A first chance exception of type 'System.InvalidOperationException' occurred in PresentationCore.dll Here's the source code: XAML <Window xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" x:Class="TestApplication.MainWindow" DataContext="{Binding RelativeSource={RelativeSource Self}}" Height="100" Width="100"> <StackPanel> <CheckBox IsChecked="{Binding Path=CheckboxIsChecked}" Content="A" /> <CheckBox IsChecked="{Binding Path=CheckboxIsChecked}" Content="B" /> </StackPanel> </Window> Normal implementation works public partial class MainWindow : Window, INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public bool CheckboxIsChecked { get { return this.mCheckboxIsChecked; } set { this.mCheckboxIsChecked = value; PropertyChangedEventHandler handler = this.PropertyChanged; if (handler != null) handler(this, new PropertyChangedEventArgs("CheckboxIsChecked")); } } private bool mCheckboxIsChecked = false; public MainWindow() { InitializeComponent(); } } Desired implementation doesn't work public partial class MainWindow : Window, INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged { add { lock (this.mHandler) { this.mHandler.PropertyChanged += value; } } remove { lock (this.mHandler) { this.mHandler.PropertyChanged -= value; } } } public bool CheckboxIsChecked { get { return this.mHandler.CheckboxIsChecked; } set { this.mHandler.CheckboxIsChecked = value; } } private HandlesPropertyChangeEvents mHandler = new HandlesPropertyChangeEvents(); public MainWindow() { InitializeComponent(); } public class HandlesPropertyChangeEvents : INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public bool CheckboxIsChecked { get { return this.mCheckboxIsChecked; } set { this.mCheckboxIsChecked = value; PropertyChangedEventHandler handler = this.PropertyChanged; if (handler != null) handler(this, new PropertyChangedEventArgs("CheckboxIsChecked")); } } private bool mCheckboxIsChecked = false; } }

    Read the article

  • How to send HTTP get method with headers using CURL

    - by mithunmo
    Hello , I need to send GET Request method with the below headers . I am getting the following capture from HTTP live headers ***http://172.20.22.26/ GET / HTTP/1.1 Host: 172.20.22.26 User-Agent: Mozilla/5.0 (Windows; U; Windows NT 5.1; en-US; rv:1.9.0.1) Gecko/2008070208 Firefox/3.0.1 Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8 Accept-Language: en-us,en;q=0.5 Accept-Encoding: gzip,deflate Accept-Charset: ISO-8859-1,utf-8;q=0.7,*;q=0.7 Keep-Alive: 300 Connection: keep-alive Authorization: Basic bWl0aHVuOm1pdGh1bg== HTTP/1.x 200 OK Date: Thu, 01 Jan 2009 00:29:20 GMT Server: HTTPsrv Connection: Keep-Alive Keep-Alive: timeout=30, max=100 Transfer-Encoding: chunked Content-Type: text/html ----------------------------**------------------------------* I am using the following program . It is not working . Please let me know where I am going wrong. <?php $credentials = "mithun:mithun"; $url = "http://172.20.22.26"; $headers = array( "GET /HTTP/1.1", "User-Agent: Mozilla/5.0 (Windows; U; Windows NT 5.1; en-US; rv:1.9.0.1) Gecko/2008070208 Firefox/3.0.1", "Content-type: text/xml;charset=\"utf-8\"", "Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8", "Accept-Language: en-us,en;q=0.5", "Accept-Encoding: gzip,deflate", "Accept-Charset: ISO-8859-1,utf-8;q=0.7,*;q=0.7", "Keep-Alive: 300", "Connection: keep-alive", "Authorization: Basic " . base64_encode($credentials)); $ch = curl_init(); curl_setopt($ch, CURLOPT_URL,$url); curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1); curl_setopt($ch, CURLOPT_TIMEOUT, 60); curl_setopt($ch, CURLOPT_HTTPHEADER, $headers); //curl_setopt($ch, CURLOPT_USERAGENT, $defined_vars['HTTP_USER_AGENT']); $data = curl_exec($ch); if (curl_errno($ch)) { print "Error: " . curl_error($ch); } else { // Show me the result var_dump($data); curl_close($ch); }?>

    Read the article

  • Flex - Flash Builder Design View not showing embedded fonts correctly

    - by Crusader
    Tools: Air 2, Flex SDK 4.1, Flash Builder, Halo component set (NO Spark being used at all) Fonts work perfectly when running the appliction, but not in design view. This effectively makes design view WORTHLESS because it's impossible to properly position components or labels without knowing what the true size is (it changes depending on font...) ... CSS included in root component like so: <fx:Style source="style.css"/> CSS file: /* CSS file */ @namespace mx "library://ns.adobe.com/flex/mx"; global { font-family:Segoe; font-size:14; color:#FFFFFF; } mx|Application, mx|VBox, mx|HBox, mx|Canvas { font-family:Segoe; background-color:#660000; border-color:#222277; color:#FFFFFF; } mx|Button { font-family:Segoe; fill-colors:#660000, #660000, #660000, #660000; color:#FFFFFF; } .... Interestingly (or buggily?), when I try pasting the style tag into a subcomponent (lower than the top level container), I get a bunch of warnings in the subcomponent editor view stating that CSS type selectors are not supported in.. (all the components in the style sheet). Yet, they do work when the application is executed. Huh? This is how I'm embedding the fonts in the root level container: [Embed(source="/assets/segoepr.ttf", fontName="Segoe", mimeType="application/x-font-truetype", embedAsCFF='false')] public static const font:Class; [Embed(source="/assets/segoeprb.ttf", fontName="Segoe", mimeType="application/x-font-truetype", fontWeight="bold", embedAsCFF='false')] public static const font2:Class; So, is there a way to get embedded fonts to work in design view or what?

    Read the article

  • ASP.NET Applications Requests/Sec suddenly jumps to a value of about 70 million/sec. on 8 core web

    - by Subhrajit Roy
    We are doing performance testing of an ASP.NET web application with VSTS 2008. We start with 2000 users and slowly ramp up to 5000 users (reaches this user load at around 2.5 hours after the tests start, after this we stay at this user load). The total test duration is of about 6 hours During these runs we have found that the counter Requests/Sec (under category ASP.NET applications) suddenly spikes to a values of 36-72 millions !!!. This keeps on happening intermittently i.e we see this issue once in every 3 performance runs that we give on the same application. In our testing environment we have 4 web servers and interestingly enough we have found that this issue occurs only in the 8 core web servers. Summarizing ... Issue : The counter Requests/Sec (under category ASP.NET Applications) suddenly jumps to a value of about 70 million/sec. on 8 core web servers. This results in an increase in SQL server connections opened by the application. Response time goes for a toss. Error rates also show similar behaviour. However the counter ISAPI Extention Requests/sec does not show any abnormal increase. The graph of this counter almost overlaps with that of counter Requests/Sec till the time of the appearance of the spike.When the spike appears , this counter (ISAPI Extention Requests/sec) actually shows a drop. Test Settings : Performance test run with Visual Studio Team System 2008. Soak test run for 6 hours. Maximum user load 5000 users. This is load is attained at about 2.5 hours into the run and mainted for remaining duration.(i.e for around 3.5 more hrs) This issue is reproducible though happens intermittently. (i.e occurs one in three or four runs) Test Environment : Web site deployed on 4 Web Servers (Windows Server 2003). Of these 2 are 4 core machines and the remaining 2 are 8 core ones. .NET Framework 3.5 SP1 installed on all 4 web servers. Application hosted on IIS 6.0 run in Worker process isolation mode.

    Read the article

  • Graceful termination of NSApplication with Core Data and Grand Central Dispatch (GCD)

    - by Vincent Mac
    I have an Cocoa Application (Mac OS X SDK 10.7) that is performing some processes via Grand Central Dispatch (GCD). These processes are manipulating some Core Data NSManagedObjects (non-document-based) in a manner that I believe is thread safe (creating a new managedObjectContext for use in this thread). The problem I have is when the user tries to quit the application while the dispatch queue is still running. The NSApplication delegate is being called before actually quitting. - (NSApplicationTerminateReply)applicationShouldTerminate:(NSApplication *)sender I get an error "Could not merge changes." Which is somewhat expected since there are still operations being performed through the different managedObjectContext. I am then presented with the NSAlert from the template that is generated with a core data application. In the Threading Programming Guide there is a section called "Be Aware of Thread Behaviors at Quit Time" which alludes to using replyToApplicationShouldTerminate: method. I'm having a little trouble implementing this. What I would like is for my application to complete processing the queued items and then terminate without presenting an error message to the user. It would also be helpful to update the view or use a sheet to let the user know that the app is performing some action and will terminate when the action is complete. Where and how would I implement this behavior?

    Read the article

  • C# Client to Consume Google App Engine RESTful Webservice (rpc XML)

    - by Ngu Soon Hui
    I think I hit a problem when using C# client to consume Google App Engine Webservice. The Google App Engine code I use is here. This is how the python script on server would look like: from google.appengine.ext import webapp from google.appengine.ext.webapp.util import run_wsgi_app import logging from StringIO import StringIO import traceback import xmlrpclib from xmlrpcserver import XmlRpcServer class Application: def __init__(self): pass def getName(self,meta): return 'example' class XMLRpcHandler(webapp.RequestHandler): rpcserver = None def __init__(self): self.rpcserver = XmlRpcServer() app = Application() self.rpcserver.register_class('app',app) def post(self): request = StringIO(self.request.body) request.seek(0) response = StringIO() try: self.rpcserver.execute(request, response, None) except Exception, e: logging.error('Error executing: '+str(e)) for line in traceback.format_exc().split('\n'): logging.error(line) finally: response.seek(0) rstr = response.read() self.response.headers['Content-type'] = 'text/xml' self.response.headers['Content-length'] = "%d"%len(rstr) self.response.out.write(rstr) application = webapp.WSGIApplication( [('/xmlrpc/', XMLRpcHandler)], debug=True) def main(): run_wsgi_app(application) if __name__ == "__main__": main() The client side ( in Python) is this: import xmlrpclib s = xmlrpclib.Server('http://localhost:8080/xmlrpc/') print s.app.getName() I have no problem in using Python client to retrieve values from Google App Engine, but I do have difficulties in using a C# client to retrieve the values. The error I got was 404 method not found when I am trying to GetResponse from the web request. This is my code var request = (HttpWebRequest)WebRequest.Create("http://localhost:8080/xmlrpc/app"); request.Method = "GET"; request.ContentLength = 0; request.ContentType = "text/xml"; using (HttpWebResponse response = request.GetResponse() as HttpWebResponse) //404 method not found error here. { } I think it must be that the url is wrong, but I don't know how to get it right. Any idea?

    Read the article

  • Need advice on using Grails and Ajax to append to a div like in Rails

    - by Nate
    I'm just starting out in Grails and need some advice on using Ajax. I want to append some html to the bottom of a div inside a form. This is basically what I have: -form- -div id="listOfchildren"- childrow 1 input fields childrow 2 input fields childrow 3 input fields -/div- -form- -a-Add Child 4-/a- When I click on the "Add Child" I want to make an ajax call that results in a new childrow getting inserted into the "listOfchildren" div. So the document would look like this: -form- -div id="listOfchildren"- childrow 1 input fields childrow 2 input fields childrow 3 input fields childrow 4 input fields -/div- -form- -a-Add Child 5-/a- In Rails I would do something simple like this: render :update do |page| page.insert_html :bottom, "list_of_children", :partial = child_partial page.replace "add_link", :partial = 'add_link' end The previous code sends an javascript back to the browser with two commands. The first command tells the browser to append some html to the bottom of a div. The second command updates the "add link" counter. In grails I can only see how to replace an entire div (which would wipe out the user's existing input) and I don't see how I can call multiple functions from the ajax response. I can probably do this if I was to write some javascript functions in prototype or whatever, but I'd like to avoid that if there is a simpler way. Thanks! Nate

    Read the article

  • Are there any applications written in the Io programming language? (Or, distributing Io applications

    - by Rayne
    I've recently become interested in prototype-based OOP, and I've been playing with Io and Ioke. Distributing an application with Ioke is simple. It's on the JVM. Need I say more? However, I'm absolutely stumped as to how one would distribute an Io application, especially on Windows. It's not like you can have end-users compile Io to run your application. I was actually shocked the Io has gone for 8 years without forming some sort of standards for things like distribution. Ruby has gems, Java has jars, and so on. The worse thing about it is, I can't find a single application written in Io to maybe steal ideas on distribution from. Maybe I suck at google searching (Io is a horrible search name, by the way ;P). Is there any sort of canonical way to distribute Io applications? Are there even any Io applications in existence, or am I just missing the point? I'm not sure if this should be community wiki or not. If you think it should, comment and let me know.

    Read the article

  • Changing URI suffix in Joomla when adding child php pages

    - by Sleem
    I have added a new directory in my joomla website: http://sitedomain.tld/xxx/ then I have added index.php in that directory here is the code define( '_JEXEC', 1 ); define('JPATH_BASE', '..' ); define( 'DS', DIRECTORY_SEPARATOR ); require_once ( '../includes/defines.php' ); require_once ( '../includes/framework.php' ); //JDEBUG ? $_PROFILER->mark( 'afterLoad' ) : null; /** * CREATE THE APPLICATION * * NOTE : */ $mainframe =& JFactory::getApplication('site'); $template_name = $mainframe->getTemplate();; $mainframe->initialise(); JPluginHelper::importPlugin('system'); /** * ROUTE THE APPLICATION * * NOTE : */ $mainframe->route(); // authorization $Itemid = JRequest::getInt( 'Itemid'); $mainframe->authorize($Itemid); // trigger the onAfterRoute events //JDEBUG ? $_PROFILER->mark('afterRoute') : null; //$mainframe->triggerEvent('onAfterRoute'); /** * DISPATCH THE APPLICATION * * NOTE : */ $option = JRequest::getCmd('option'); //$mainframe->dispatch($option); // trigger the onAfterDispatch events //JDEBUG ? $_PROFILER->mark('afterDispatch') : null; //$mainframe->triggerEvent('onAfterDispatch'); /** * RENDER THE APPLICATION * * NOTE : */ $mainframe->render(); /** * RETURN THE RESPONSE */ var_dump($document->getHeadData()); echo JResponse::toString($mainframe->getCfg('gzip')); sdwdwd wdwd When I view this page in the browser, all the dynamic links like CSS, JS and images were suffixed by the /xxx/ path which make them broken ! How can I drop this suffix or how do I change this suffix from /xxx to / to it points to the original files location? I have tried setting the JDocument::setBase and also tried to play with the JURI object and changed its _path and _uri without any change Thanks

    Read the article

  • How can I render a list of objects using DisplayFor but from the controller in ASP.NET MVC?

    - by Darragh
    Here's the scenaio, I have an Employee object and a Company object which has a list of employees. I have Company.aspx which inherits from ViewPage<Company>. In Company.aspx I call Html.DisplayFor(m => m.Employees). I have an Employee.ascx partial view which inherits from ViewUserControl<Employee in my DisplayTemplates folder. Everything works fine and Company.aspx renders the Employee.ascx partial for each employee. Now I have two additional methods on my controller called GetEmployees and GetEmployee(Id). In the GetEmployee(Id) action I want to return the markup to display this one employee, and in GetEmployees() I want to render the markup to display all the employees (these two action methods will be called via AJAX). In the GetEmployee action I call return PartialView("DisplayTemplates\Employee", employee) This works, although I'd prefer something like return PartialViewFor(employee) which would determine the view name by convention. Anwyay, my question is how should I implement the GetEmployees() action? I don't want to create any more views, because frankly, I don't see why I should have to. I've tried the following which fails miserably :) return Content(New HtmlHelper<IList<Of DebtDto>>(null, null).DisplayFor(m => debts)); However if I could create an instance of an HtmlHelper object in my controller, I suppose I could get it to work, but it feels wrong. Any ideas? Have i missed something obvious?

    Read the article

  • Problem with custom Equality and GetHashCode in a mutable object

    - by Shimmy
    Hello! I am using Entity Framework in my application. I implemented with the partial class of an entity the IEquatable<T> interface: Partial Class Address : Implements IEquatable(Of Address) 'Other part generated Public Overloads Function Equals(ByVal other As Address) As Boolean _ Implements System.IEquatable(Of Address).Equals If ReferenceEquals(Me, other) Then Return True Return AddressId = other.AddressId End Function Public Overrides Function Equals(ByVal obj As Object) As Boolean If obj Is Nothing Then Return MyBase.Equals(obj) If TypeOf obj Is Address Then Return Equals(DirectCast(obj, Address)) Else Return False End Function Public Overrides Function GetHashCode() As Integer Return AddressId.GetHashCode End Function End Class Now in my code I use it this way: Sub Main() Using e As New CompleteKitchenEntities Dim job = e.Job.FirstOrDefault Dim address As New Address() job.Addresses.Add(address) Dim contains1 = job.Addresses.Contains(address) 'True e.SaveChanges() Dim contains2 = job.Addresses.Contains(address) 'False 'The problem is that I can't remove it: Dim removed = job.Addresses.Remoeve(address) 'False End Using End Sub Note (I checked in the debugger visualizer) that the EntityCollection class stores its entities in HashSet so it has to do with the GetHashCode function, I want it to depend on the ID so entities are compared by their IDs. The problem is that when I hit save, the ID changes from 0 to its db value. So the question is how can I have an equatable object, being properly hashed. Please help me find what's wrong in the GetHashCode function (by ID) and what can I change to make it work. Thanks a lot.

    Read the article

  • Force full garbage collection when memory occupation goes beyond a certain threshold

    - by Silvio Donnini
    I have a server application that, in rare occasions, can allocate large chunks of memory. It's not a memory leak, as these chunks can be claimed back by the garbage collector by executing a full garbage collection. Normal garbage collection frees amounts of memory that are too small: it is not adequate in this context. The garbage collector executes these full GCs when it deems appropriate, namely when the memory footprint of the application nears the allotted maximum specified with -Xmx. That would be ok, if it wasn't for the fact that these problematic memory allocations come in bursts, and can cause OutOfMemoryErrors due to the fact that the jvm is not able to perform a GC quickly enough to free the required memory. If I manually call System.gc() beforehand, I can prevent this situation. Anyway, I'd prefer not having to monitor my jvm's memory allocation myself (or insert memory management into my application's logic); it would be nice if there was a way to run the virtual machine with a memory threshold, over which full GCs would be executed automatically, in order to release very early the memory I'm going to need. Long story short: I need a way (a command line option?) to configure the jvm in order to release early a good amount of memory (i.e. perform a full GC) when memory occupation reaches a certain threshold, I don't care if this slows my application down every once in a while. All I've found till now are ways to modify the size of the generations, but that's not what I need (at least not directly). I'd appreciate your suggestions, Silvio P.S. I'm working on a way to avoid large allocations, but it could require a long time and meanwhile my app needs a little stability

    Read the article

  • Why do I get Detached Entity exception when upgrading Spring Boot 1.1.4 to 1.1.5

    - by mmeany
    On updating Spring Boot from 1.1.4 to 1.1.5 a simple web application started generating detached entity exceptions. Specifically, a post authentication inteceptor that bumped number of visits was causing the problem. A quick check of loaded dependencies showed that Spring Data has been updated from 1.6.1 to 1.6.2 and a further check of the change log shows a couple of issues relating to optimistic locking, version fields and JPA issues that have been fixed. Well I am using a version field and it starts out as Null following recommendation to not set in the specification. I have produced a very simple test scenario where I get detached entity exceptions if the version field starts as null or zero. If I create an entity with version 1 however then I do not get these exceptions. Is this expected behaviour or is there still something amiss? Below is the test scenario I have for this condition. In the scenario the service layer that has been annotated @Transactional. Each test case makes multiple calls to the service layer - the tests are working with detached entities as this is the scenario I am working with in the full blown application. The test case comprises four tests: Test 1 - versionNullCausesAnExceptionOnUpdate() In this test the version field in the detached object is Null. This is how I would usually create the object prior to passing to the service. This test fails with a Detached Entity exception. I would have expected this test to pass. If there is a flaw in the test then the rest of the scenario is probably moot. Test 2 - versionZeroCausesExceptionOnUpdate() In this test I have set the version to value Long(0L). This is an edge case test and included because I found reference to Zero values being used for version field in the Spring Data change log. This test fails with a Detached Entity exception. Of interest simply because the following two tests pass leaving this as an anomaly. Test 3 - versionOneDoesNotCausesExceptionOnUpdate() In this test the version field is set to value Long(1L). Not something I would usually do, but considering the notes in the Spring Data change log I decided to give it a go. This test passes. Would not usually set the version field, but this looks like a work-around until I figure out why the first test is failing. Test 4 - versionOneDoesNotCausesExceptionWithMultipleUpdates() Encouraged by the result of test 3 I pushed the scenario a step further and perform multiple updates on the entity that started life with a version of Long(1L). This test passes. Reinforcement that this may be a useable work-around. The entity: package com.mvmlabs.domain; import javax.persistence.Column; import javax.persistence.Entity; import javax.persistence.GeneratedValue; import javax.persistence.GenerationType; import javax.persistence.Id; import javax.persistence.Table; import javax.persistence.Version; @Entity @Table(name="user_details") public class User { @Id @GeneratedValue(strategy=GenerationType.AUTO) private Long id; @Version private Long version; @Column(nullable = false, unique = true) private String username; @Column(nullable = false) private Integer numberOfVisits; public Long getId() { return id; } public void setId(Long id) { this.id = id; } public Long getVersion() { return version; } public void setVersion(Long version) { this.version = version; } public Integer getNumberOfVisits() { return numberOfVisits == null ? 0 : numberOfVisits; } public void setNumberOfVisits(Integer numberOfVisits) { this.numberOfVisits = numberOfVisits; } public String getUsername() { return username; } public void setUsername(String username) { this.username = username; } } The repository: package com.mvmlabs.dao; import org.springframework.data.repository.CrudRepository; import com.mvmlabs.domain.User; public interface UserDao extends CrudRepository<User, Long>{ } The service interface: package com.mvmlabs.service; import com.mvmlabs.domain.User; public interface UserService { User save(User user); User loadUser(Long id); User registerVisit(User user); } The service implementation: package com.mvmlabs.service; import org.springframework.beans.factory.annotation.Autowired; import org.springframework.stereotype.Service; import org.springframework.transaction.annotation.Propagation; import org.springframework.transaction.annotation.Transactional; import org.springframework.transaction.support.TransactionSynchronizationManager; import com.mvmlabs.dao.UserDao; import com.mvmlabs.domain.User; @Service @Transactional(propagation=Propagation.REQUIRED, readOnly=false) public class UserServiceJpaImpl implements UserService { @Autowired private UserDao userDao; @Transactional(readOnly=true) @Override public User loadUser(Long id) { return userDao.findOne(id); } @Override public User registerVisit(User user) { user.setNumberOfVisits(user.getNumberOfVisits() + 1); return userDao.save(user); } @Override public User save(User user) { return userDao.save(user); } } The application class: package com.mvmlabs; import org.springframework.boot.SpringApplication; import org.springframework.boot.autoconfigure.EnableAutoConfiguration; import org.springframework.context.annotation.ComponentScan; import org.springframework.context.annotation.Configuration; @Configuration @ComponentScan @EnableAutoConfiguration public class Application { public static void main(String[] args) { SpringApplication.run(Application.class, args); } } The POM: <?xml version="1.0" encoding="UTF-8"?> <project xmlns="http://maven.apache.org/POM/4.0.0" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://maven.apache.org/POM/4.0.0 http://maven.apache.org/xsd/maven-4.0.0.xsd"> <modelVersion>4.0.0</modelVersion> <groupId>com.mvmlabs</groupId> <artifactId>jpa-issue</artifactId> <version>0.0.1-SNAPSHOT</version> <packaging>jar</packaging> <name>spring-boot-jpa-issue</name> <description>JPA Issue between spring boot 1.1.4 and 1.1.5</description> <parent> <groupId>org.springframework.boot</groupId> <artifactId>spring-boot-starter-parent</artifactId> <version>1.1.5.RELEASE</version> <relativePath /> <!-- lookup parent from repository --> </parent> <dependencies> <dependency> <groupId>org.springframework.boot</groupId> <artifactId>spring-boot-starter-data-jpa</artifactId> </dependency> <dependency> <groupId>org.hsqldb</groupId> <artifactId>hsqldb</artifactId> <scope>runtime</scope> </dependency> <dependency> <groupId>org.springframework.boot</groupId> <artifactId>spring-boot-starter-test</artifactId> <scope>test</scope> </dependency> </dependencies> <properties> <project.build.sourceEncoding>UTF-8</project.build.sourceEncoding> <start-class>com.mvmlabs.Application</start-class> <java.version>1.7</java.version> </properties> <build> <plugins> <plugin> <groupId>org.springframework.boot</groupId> <artifactId>spring-boot-maven-plugin</artifactId> </plugin> </plugins> </build> </project> The application properties: spring.jpa.hibernate.ddl-auto: create spring.jpa.hibernate.naming_strategy: org.hibernate.cfg.ImprovedNamingStrategy spring.jpa.database: HSQL spring.jpa.show-sql: true spring.datasource.url=jdbc:hsqldb:file:./target/testdb spring.datasource.username=sa spring.datasource.password= spring.datasource.driverClassName=org.hsqldb.jdbcDriver The test case: package com.mvmlabs; import org.junit.Assert; import org.junit.Test; import org.junit.runner.RunWith; import org.springframework.beans.factory.annotation.Autowired; import org.springframework.boot.test.SpringApplicationConfiguration; import org.springframework.test.context.junit4.SpringJUnit4ClassRunner; import com.mvmlabs.domain.User; import com.mvmlabs.service.UserService; @RunWith(SpringJUnit4ClassRunner.class) @SpringApplicationConfiguration(classes = Application.class) public class ApplicationTests { @Autowired UserService userService; @Test public void versionNullCausesAnExceptionOnUpdate() throws Exception { User user = new User(); user.setUsername("Version Null"); user.setNumberOfVisits(0); user.setVersion(null); user = userService.save(user); user = userService.registerVisit(user); Assert.assertEquals(new Integer(1), user.getNumberOfVisits()); Assert.assertEquals(new Long(1L), user.getVersion()); } @Test public void versionZeroCausesExceptionOnUpdate() throws Exception { User user = new User(); user.setUsername("Version Zero"); user.setNumberOfVisits(0); user.setVersion(0L); user = userService.save(user); user = userService.registerVisit(user); Assert.assertEquals(new Integer(1), user.getNumberOfVisits()); Assert.assertEquals(new Long(1L), user.getVersion()); } @Test public void versionOneDoesNotCausesExceptionOnUpdate() throws Exception { User user = new User(); user.setUsername("Version One"); user.setNumberOfVisits(0); user.setVersion(1L); user = userService.save(user); user = userService.registerVisit(user); Assert.assertEquals(new Integer(1), user.getNumberOfVisits()); Assert.assertEquals(new Long(2L), user.getVersion()); } @Test public void versionOneDoesNotCausesExceptionWithMultipleUpdates() throws Exception { User user = new User(); user.setUsername("Version One Multiple"); user.setNumberOfVisits(0); user.setVersion(1L); user = userService.save(user); user = userService.registerVisit(user); user = userService.registerVisit(user); user = userService.registerVisit(user); Assert.assertEquals(new Integer(3), user.getNumberOfVisits()); Assert.assertEquals(new Long(4L), user.getVersion()); } } The first two tests fail with detached entity exception. The last two tests pass as expected. Now change Spring Boot version to 1.1.4 and rerun, all tests pass. Are my expectations wrong? Edit: This code saved to GitHub at https://github.com/mmeany/spring-boot-detached-entity-issue

    Read the article

  • Clustering on WebLogic exception on Failover

    - by Markos Fragkakis
    Hi all, I deploy an application on a WebLogic 10.3.2 cluster with two nodes, and a load balancer in front of the cluster. I have set the <core:init distributable="true" debug="true" /> My Session and Conversation classes implement Serializable. I start using the application being served by the first node. The console shows that the session replication is working. <Jun 17, 2010 11:43:50 AM EEST> <Info> <Cluster> <BEA-000128> <Updating 5903057688359791237S:xxx.yyy.gr:[7002,7002,-1,-1,-1,-1,-1]:xxx.yyy.gr:7002,xxx.yyy.gr:7002:prs_domain:PRS_Server_2 in the cluster.> <Jun 17, 2010 11:43:50 AM EEST> <Info> <Cluster> <BEA-000128> <Updating 5903057688359791237S:xxx.yyy.gr:[7002,7002,-1,-1,-1,-1,-1]:xxx.yyy.gr:7002,xxx.yyy.gr:7002:prs_domain:PRS_Server_2 in the cluster.> When I shutdown the first node from the Administration console, I get this in the other node: <Jun 17, 2010 11:23:46 AM EEST> <Error> <Kernel> <BEA-000802> <ExecuteRequest failed java.lang.NullPointerException. java.lang.NullPointerException at org.jboss.seam.intercept.JavaBeanInterceptor.callPostActivate(JavaBeanInterceptor.java:165) at org.jboss.seam.intercept.JavaBeanInterceptor.invoke(JavaBeanInterceptor.java:73) at com.myproj.beans.SortingFilteringBean_$$_javassist_seam_2.sessionDidActivate(SortingFilteringBean_$$_javassist_seam_2.java) at weblogic.servlet.internal.session.SessionData.notifyActivated(SessionData.java:2258) at weblogic.servlet.internal.session.SessionData.notifyActivated(SessionData.java:2222) at weblogic.servlet.internal.session.ReplicatedSessionData.becomePrimary(ReplicatedSessionData.java:231) at weblogic.cluster.replication.WrappedRO.changeStatus(WrappedRO.java:142) at weblogic.cluster.replication.WrappedRO.ensureStatus(WrappedRO.java:129) at weblogic.cluster.replication.LocalSecondarySelector$ChangeSecondaryInfo.run(LocalSecondarySelector.java:542) at weblogic.work.SelfTuningWorkManagerImpl$WorkAdapterImpl.run(SelfTuningWorkManagerImpl.java:516) at weblogic.work.ExecuteThread.execute(ExecuteThread.java:201) at weblogic.work.ExecuteThread.run(ExecuteThread.java:173) > What am I doing wrong? This is the SortingFilteringBean: import java.util.HashMap; import java.util.LinkedHashMap; import org.jboss.seam.ScopeType; import org.jboss.seam.annotations.Name; import org.jboss.seam.annotations.Scope; import com.myproj.model.crud.Filtering; import com.myproj.model.crud.Sorting; import com.myproj.model.crud.SortingOrder; /** * Managed bean aggregating the sorting and filtering values for all the * application's lists. A light-weight bean to always keep in the session with * minimum impact. */ @Name("sortingFilteringBean") @Scope(ScopeType.SESSION) public class SortingFilteringBean extends BaseManagedBean { private static final long serialVersionUID = 1L; private Sorting applicantProductListSorting; private Filtering applicantProductListFiltering; private Sorting homePageSorting; private Filtering homePageFiltering; /** * Creates a new instance of SortingFilteringBean. */ public SortingFilteringBean() { // ********************** // Applicant Product List // ********************** // Sorting LinkedHashMap<String, SortingOrder> applicantProductListSortingValues = new LinkedHashMap<String, SortingOrder>(); applicantProductListSortingValues.put("applicantName", SortingOrder.ASCENDING); applicantProductListSortingValues.put("applicantEmail", SortingOrder.ASCENDING); applicantProductListSortingValues.put("productName", SortingOrder.ASCENDING); applicantProductListSortingValues.put("productEmail", SortingOrder.ASCENDING); applicantProductListSorting = new Sorting( applicantProductListSortingValues); // Filtering HashMap<String, String> applicantProductListFilteringValues = new HashMap<String, String>(); applicantProductListFilteringValues.put("applicantName", ""); applicantProductListFilteringValues.put("applicantEmail", ""); applicantProductListFilteringValues.put("productName", ""); applicantProductListFilteringValues.put("productEmail", ""); applicantProductListFiltering = new Filtering( applicantProductListFilteringValues); // ********* // Home page // ********* // Sorting LinkedHashMap<String, SortingOrder> homePageSortingValues = new LinkedHashMap<String, SortingOrder>(); homePageSortingValues.put("productName", SortingOrder.ASCENDING); homePageSortingValues.put("productId", SortingOrder.ASCENDING); homePageSortingValues.put("productAtcCode", SortingOrder.UNSORTED); homePageSortingValues.put("productEmaNumber", SortingOrder.UNSORTED); homePageSortingValues.put("productOrphan", SortingOrder.UNSORTED); homePageSortingValues.put("productRap", SortingOrder.UNSORTED); homePageSortingValues.put("productCorap", SortingOrder.UNSORTED); homePageSortingValues.put("applicationTypeDescription", SortingOrder.ASCENDING); homePageSortingValues.put("applicationId", SortingOrder.ASCENDING); homePageSortingValues .put("applicationEmaNumber", SortingOrder.UNSORTED); homePageSortingValues .put("piVersionImportDate", SortingOrder.ASCENDING); homePageSortingValues.put("piVersionId", SortingOrder.ASCENDING); homePageSorting = new Sorting(homePageSortingValues); // Filtering HashMap<String, String> homePageFilteringValues = new HashMap<String, String>(); homePageFilteringValues.put("productName", ""); homePageFilteringValues.put("productAtcCode", ""); homePageFilteringValues.put("productEmaNumber", ""); homePageFilteringValues.put("applicationTypeId", ""); homePageFilteringValues.put("applicationEmaNumber", ""); homePageFilteringValues.put("piVersionImportDate", ""); homePageFiltering = new Filtering(homePageFilteringValues); } /** * @return the applicantProductListFiltering */ public Filtering getApplicantProductListFiltering() { return applicantProductListFiltering; } /** * @param applicantProductListFiltering * the applicantProductListFiltering to set */ public void setApplicantProductListFiltering( Filtering applicantProductListFiltering) { this.applicantProductListFiltering = applicantProductListFiltering; } /** * @return the applicantProductListSorting */ public Sorting getApplicantProductListSorting() { return applicantProductListSorting; } /** * @param applicantProductListSorting * the applicantProductListSorting to set */ public void setApplicantProductListSorting( Sorting applicantProductListSorting) { this.applicantProductListSorting = applicantProductListSorting; } /** * @return the homePageSorting */ public Sorting getHomePageSorting() { return homePageSorting; } /** * @param homePageSorting * the homePageSorting to set */ public void setHomePageSorting(Sorting homePageSorting) { this.homePageSorting = homePageSorting; } /** * @return the homePageFiltering */ public Filtering getHomePageFiltering() { return homePageFiltering; } /** * @param homePageFiltering * the homePageFiltering to set */ public void setHomePageFiltering(Filtering homePageFiltering) { this.homePageFiltering = homePageFiltering; } /** * For convenience to view in the Seam Debug page. * * @see java.lang.Object#toString() */ @Override public String toString() { StringBuilder sb = new StringBuilder(""); sb.append("\n\n"); sb.append("applicantProductListSorting"); sb.append(applicantProductListSorting); sb.append("\n\n"); sb.append("applicantProductListFiltering"); sb.append(applicantProductListFiltering); sb.append("\n\n"); sb.append("homePageSorting"); sb.append(homePageSorting); sb.append("\n\n"); sb.append("homePageFiltering"); sb.append(homePageFiltering); return sb.toString(); } } And this is the BaseManagedBean, inheriting the AbstractMutable. import java.io.IOException; import java.io.OutputStream; import java.util.List; import javax.faces.application.FacesMessage; import javax.faces.application.FacesMessage.Severity; import javax.faces.context.FacesContext; import javax.servlet.http.HttpServletResponse; import org.apache.commons.lang.ArrayUtils; import org.jboss.seam.core.AbstractMutable; import org.slf4j.Logger; import org.slf4j.LoggerFactory; import com.myproj.common.exceptions.WebException; import com.myproj.common.util.FileUtils; import com.myproj.common.util.StringUtils; import com.myproj.web.messages.Messages; public abstract class BaseManagedBean extends AbstractMutable { private static final Logger logger = LoggerFactory .getLogger(BaseManagedBean.class); private FacesContext facesContext; /** * Set a message to be displayed for a specific component. * * @param resourceBundle * the resource bundle where the message appears. Either base or * id may be used. * @param summaryResourceId * the id of the resource to be used as summary. For the detail * of the element, the element to be used will be the same with * the suffix {@code _detail}. * @param parameters * the parameters, in case the string is parameterizable * @param severity * the severity of the message * @param componentId * the component id for which the message is destined. Note that * an appropriate JSF {@code <h:message for="myComponentId">} tag * is required for the to appear, or alternatively a {@code * <h:messages>} tag. */ protected void setMessage(String resourceBundle, String summaryResourceId, List<Object> parameters, Severity severity, String componentId, Messages messages) { FacesContext context = getFacesContext(); FacesMessage message = messages.getMessage(resourceBundle, summaryResourceId, parameters); if (severity != null) { message.setSeverity(severity); } context.addMessage(componentId, message); } /** * Copies a byte array to the response output stream with the appropriate * MIME type and content disposition. The response output stream is closed * after this method. * * @param response * the HTTP response * @param bytes * the data * @param filename * the suggested file name for the client * @param mimeType * the MIME type; will be overridden if the filename suggests a * different MIME type * @throws IllegalArgumentException * if the data array is <code>null</code>/empty or both filename * and mimeType are <code>null</code>/empty */ protected void printBytesToResponse(HttpServletResponse response, byte[] bytes, String filename, String mimeType) throws WebException, IllegalArgumentException { if (response.isCommitted()) { throw new WebException("HTTP response is already committed"); } if (ArrayUtils.isEmpty(bytes)) { throw new IllegalArgumentException("Data buffer is empty"); } if (StringUtils.isEmpty(filename) && StringUtils.isEmpty(mimeType)) { throw new IllegalArgumentException( "Filename and MIME type are both null/empty"); } // Set content type (mime type) String calculatedMimeType = FileUtils.getMimeType(filename); // not among the known ones String newMimeType = mimeType; if (calculatedMimeType == null) { // given mime type passed if (mimeType == null) { // none available put default mime-type newMimeType = "application/download"; } else { if ("application/octet-stream".equals(mimeType)) { // small modification newMimeType = "application/download"; } } } else { // calculated mime type has precedence over given mime type newMimeType = calculatedMimeType; } response.setContentType(newMimeType); // Set content disposition and other headers String contentDisposition = "attachment;filename=\"" + filename + "\""; response.setHeader("Content-Disposition", contentDisposition); response.setHeader("Expires", "0"); response.setHeader("Cache-Control", "max-age=30"); response.setHeader("Pragma", "public"); // Set content length response.setContentLength(bytes.length); // Write bytes to response OutputStream out = null; try { out = response.getOutputStream(); out.write(bytes); } catch (IOException e) { throw new WebException("Error writing data to HTTP response", e); } finally { try { out.close(); } catch (Exception e) { logger.error("Error closing HTTP stream", e); } } } /** * Retrieve a session-scoped managed bean. * * @param sessionBeanName * the session-scoped managed bean name * @return the session-scoped managed bean */ protected Object getSessionBean(String sessionBeanName) { Object sessionScopedBean = FacesContext.getCurrentInstance() .getExternalContext().getSessionMap().get(sessionBeanName); if (sessionScopedBean == null) { throw new IllegalArgumentException("No such object in Session"); } else { return sessionScopedBean; } } /** * Set a session-scoped managed bean * * @param sessionBeanName * the session-scoped managed bean name * @return the session-scoped managed bean */ protected boolean setSessionBean(String sessionBeanName, Object sessionBean) { Object sessionScopedBean = FacesContext.getCurrentInstance() .getExternalContext().getSessionMap().get(sessionBeanName); if (sessionScopedBean == null) { FacesContext.getCurrentInstance().getExternalContext() .getSessionMap().put(sessionBeanName, sessionBean); } else { throw new IllegalArgumentException( "This session-scoped bean was already initialized"); } return true; } /** * For testing (enables mock of FacesContext) * * @return the faces context */ public FacesContext getFacesContext() { if (facesContext == null) { return FacesContext.getCurrentInstance(); } return facesContext; } /** * For testing (enables mocking of FacesContext). * * @param aFacesContext * a - possibly mock - faces context. */ public void setFacesContext(FacesContext aFacesContext) { this.facesContext = aFacesContext; } }

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Printing from web pages (reports especially) with greater precision.

    - by Kabeer
    Hello. I am re-engineering a windows application to be ported to web. One area that has been worrying is 'printing'. The application is data intensive and complex reports need to be generated. The erstwhile windows application takes advantage of printer APIs and extends sophisticated control to the users. It supports functions like page break, avoiding printing on printed parts of the sheet (like letterhead), choice of layouts and orientation, etc. Please note that these setting are not done only while printing, they are part of report definition sometimes. From what I know, we cannot have this kind of control while printing web pages. I am in a process of identifying options at my disposal. While I prefer to first look into something that will help me print from raw web pages, following are other thoughts: Since reports can also be exported to .xls & .pdf versions, let user download one and print directly. This however limits my solution to the area of application that have export feature. Use Silverlight (4.0) for report layout definition and print. I think Silverlight 4.0 (in beta right now) provides adequate control over the printer. I have so far been avoiding the need of any RIA plugin. Meticulously generate reports on web with fixed dimensions. I am not sure how far this will go. Please share practices that can be applied easily in my scenario.

    Read the article

< Previous Page | 500 501 502 503 504 505 506 507 508 509 510 511  | Next Page >