Search Results

Search found 26454 results on 1059 pages for 'post parameter'.

Page 505/1059 | < Previous Page | 501 502 503 504 505 506 507 508 509 510 511 512  | Next Page >

  • Format form fields for bootstrap using rails+nokogiri

    - by user1116573
    I have the following in an initializer in a rails app that uses Twitter bootstrap so that it removes the div.field_with_errors that rails applies when validation fails on a field but also the initializer adds the help/validation text after the erroneous input field: require 'nokogiri' ActionView::Base.field_error_proc = Proc.new do |html_tag, instance| html = %(<div class="field_with_errors">#{html_tag}</div>).html_safe form_fields = [ 'textarea', 'input', 'select' ] elements = Nokogiri::HTML::DocumentFragment.parse(html_tag).css("label, " + form_fields.join(', ')) elements.each do |e| if e.node_name.eql? 'label' html = %(#{e}).html_safe elsif form_fields.include? e.node_name if instance.error_message.kind_of?(Array) html = %(#{e}<span class="help-inline">&nbsp;#{instance.error_message.join(',')}</span>).html_safe else html = %(#{e}<span class="help-inline">&nbsp;#{instance.error_message}</span>).html_safe end end end html end This works fine but I also need to apply the .error class to the surrounding div.control-group for each error. My initializer currently gives the following output: <div class="control-group"> <label class="control-label" for="post_message">Message</label> <div class="controls"> <input id="post_message" name="post[message]" required="required" size="30" type="text" value="" /><span class="help-inline">&nbsp;can't be blank</span> </div> </div> but I need something adding to my initializer so that it adds the .error class to the div.control-group like so: <div class="control-group error"> <label class="control-label" for="post_message">Message</label> <div class="controls"> <input id="post_message" name="post[message]" required="required" size="30" type="text" value="" /><span class="help-inline">&nbsp;can't be blank</span> </div> </div> The solution will probably need to allow for the fact that each validation error could have more than one label and input that are all within the same div.control-group (eg radio buttons / checkboxes / 2 text fields side by side). I assume it needs some sort of e.at_xpath() to find the div.control-group parent and add the .error class to it but I'm not sure how to do this. Can anyone help? PS This may all be possible using the formtastic or simple_form gems but I'd rather just use my own html if possible. EDIT If I put e['class'] = 'foo' in the if e.node_name.eql? 'label' section then it applies the class to the label so I think I just need to find the parent tag of e and then apply an .error class to it but I can't figure out what the xpath would be to get from label to its div.control-group parent; no combination of dots, slashes or whatever seems to work but xpath isn't my strong point.

    Read the article

  • symbols in command line argument.. python, bash

    - by Idlecool
    Hi, I am writing a python script on Linux for twitter post using API, Is it possible to pass symbols like "(" ")" etc in clear text without apostrophes.... % ./twitterupdate this is me #works fine % ./twitterupdate this is bad :(( #this leaves a error on bash. Is the only alternative is to enclose the text into -- "" ?? like.. % ./twitterupdate "this is bad :((" #this will reduce the ease of use for the script Is there any workaround?

    Read the article

  • Is there away to store info, without a database?

    - by Tanner
    HI, I was wondering is there any way to store data, like say I wanted to make a login form and save the usernames and passwords, without using a database or .txt file? Seems like alot of work to set up stuff like that, for something simple, and I was just wondering if there was another way. :) And if any one has some tutorials on how to use a database Access/Sql/Local Database please post.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How do you load a view on top of another view in the iPad

    - by Magician Software
    How do you load a view on top of another view in the iPad like in the wordpress app when it asks you to setup your blog. Can you show or post me some sample code. I have an NSUSerdefaults setup so it will display this on the first launch. I would like this view to look like this http://uplr.me/files/p45064.png See how it has the shaddows and the view is darkened in the back. Thats what I am trying to do.

    Read the article

  • How to get to apple iphone discussion forums?

    - by wolverine
    I logged into my account and is reaching this page. http://developer.apple.com/devforums/ After that when i click login and give the details, it redirects to the same page. Where can I see the discussions and post questions? I know its a simple question but dont know what I am missing here.

    Read the article

  • form_dropdown in codeigniter

    - by Patrick
    I'm getting a strange behaviour from form_dropdown - basically, when I reload the page after validation, the values are screwed up. this bit generates 3 drop downs with days, months and years: $days = array(0 => 'Day...'); for ($i = 1; $i <= 31; $i++) { $days[] = $i; } $months = array(0 => 'Month...', ); for ($i = 1; $i <= 12; $i++) { $months[] = $i; } $years = array(0 => 'Year...'); for ($i = 2010; $i <= 2012; $i++) { $years[$i] = $i; echo "<pre>"; print_r($years); echo "</pre>";//remove this } $selected_day = (isset($selected_day)) ? $selected_day : 0; $selected_month = (isset($selected_month)) ? $selected_month : 0; $selected_year = (isset($selected_year)) ? $selected_year : 0; echo "<p>"; echo form_label('Select date:', 'day', array('class' => 'left')); echo form_dropdown('day', $days, $selected_day, 'class="combosmall"'); echo form_dropdown('month', $months, $selected_month, 'class="combosmall"'); echo form_dropdown('year', $years, $selected_year, 'class="combosmall"'); echo "</p>"; ...and generates this: <p><label for="day" class="left">Select date:</label><select name="day" class="combosmall"> <option value="0" selected="selected">Day...</option> <option value="1">1</option> <option value="2">2</option> <option value="3">3</option> <option value="4">4</option> <option value="5">5</option> <option value="6">6</option> <option value="7">7</option> <option value="8">8</option> <option value="9">9</option> <option value="10">10</option> <option value="11">11</option> <option value="12">12</option> <option value="13">13</option> <option value="14">14</option> <option value="15">15</option> <option value="16">16</option> <option value="17">17</option> <option value="18">18</option> <option value="19">19</option> <option value="20">20</option> <option value="21">21</option> <option value="22">22</option> <option value="23">23</option> <option value="24">24</option> <option value="25">25</option> <option value="26">26</option> <option value="27">27</option> <option value="28">28</option> <option value="29">29</option> <option value="30">30</option> <option value="31">31</option> </select><select name="month" class="combosmall"> <option value="0" selected="selected">Month...</option> <option value="1">1</option> <option value="2">2</option> <option value="3">3</option> <option value="4">4</option> <option value="5">5</option> <option value="6">6</option> <option value="7">7</option> <option value="8">8</option> <option value="9">9</option> <option value="10">10</option> <option value="11">11</option> <option value="12">12</option> </select><select name="year" class="combosmall"> <option value="0" selected="selected">Year...</option> <option value="2010">2010</option> <option value="2011">2011</option> <option value="2012">2012</option> </select></p> however, when the form is reloaded after validation, the same code above generates this: <!-- days and months... --> <select name="year" class="combosmall"> <option value="0" selected="selected">Year...</option> <option value="1">2010</option> <option value="2">2011</option> <option value="3">2012</option> </select> So basically the value start from 1 instead of 2010. The same happens to days and months but obviously it doesn't make any difference in this particular case as the values would start from 1 anyway. How can I fix this - and why does it happen? edit: validation rules are: $this->load->library('form_validation'); //...rules for other fields.. $this->form_validation->set_rules('day', 'day', 'required|xss_clean'); $this->form_validation->set_rules('month', 'month', 'required|xss_clean'); $this->form_validation->set_rules('year', 'year', 'required|xss_clean'); $this->form_validation->set_error_delimiters('<p class="error">', '</p>'); //define other errors if($this->input->post('day') == 0 || $this->input->post('month') == 0 || $this->input->post('year') == 0) { $data['error'] = "Please check the date of your event."; }

    Read the article

  • Disqus: change captions after success with jQuery

    - by andufo
    Hi, Disqus automatically places defined captions upon request. For example: Add new Comment I've tried to change its value with jquery on ready(): $('#dsq-new-post h3').text('Paticipa con tu cuenta favorita'); No success :( ... how can i know when disqus script is finished parsing the data so i can change the caption value of h3?

    Read the article

  • How to change the request IP in HttpWebRequest?

    - by holiveira
    I'm developing a website that will connect to a credit card processing gateway webservice. For security purposes this webservice accepts requests only from IP addresses that were previously informed to them. Since I'm developing locally, my IP changes almost every day. Is there a way for me to change the IP address of a HttpWebRequest so that I can test the Webservice calls locally? This webservice is accessed through a https address and the methods must be sent via POST.

    Read the article

  • Clearing Page Cache in ASP.NET

    - by GateKiller
    For my blog I am wanting to use the Output Cache to save a cached version of a perticular post for around 10 minutes, and thats fine... <%@OutputCache Duration="600" VaryByParam="*" %> However, if someone posts a comment, I want to clear the cache so that the page is refreshed and the comment can be seen. How do I do this in ASP.Net C#?

    Read the article

  • How do I optimize this query?

    - by InnateDev
    SELECT DISTINCT wposts.* FROM wp_2_posts wposts, wp_2_postmeta wpostmeta, wp_2_postmeta wpostmeta1, wp_2_term_taxonomy, wp_2_terms, wp_2_term_relationships WHERE wposts.ID = wpostmeta.post_id AND wp_2_terms.term_id = '8' AND wp_2_term_taxonomy.term_id = wp_2_terms.term_id AND wp_2_term_taxonomy.term_taxonomy_id = wp_2_term_relationships.term_taxonomy_id AND wp_2_term_relationships.object_id = wposts.ID AND wpostmeta.meta_key = 'validity' AND wpostmeta.meta_value > '".$logic_date."' AND wpostmeta1.meta_key != 'permanent' AND wposts.post_status = 'publish' AND wposts.post_type = 'post' ORDER BY wposts.post_date DESC

    Read the article

  • how to write a script that logs into an application and checks a page

    - by josh
    Is it possible to write a script that will login to an application using uname/pwd? the username/password are not passed in through POST (they dont come in the URL) Basic steps I am looking for are: Visit url enter uname/pwd click a button click a link get the raw html to make sure it does not have 500 error Is that possible to do in any language? Please point me to some examples as well

    Read the article

  • How Does One Differentiate Between Routes POSTed To In Asp.Net MVC?

    - by Laz
    I have two actions, one that accepts a ViewModel and one that accepts two parameters a string and an int, when I try to post to the action, it gives me an error telling me that the current request is ambiguous between the two actions. Is it possible to indicate to the routing system which action is the relevant one, and if it is how is it done?

    Read the article

  • JS text to array

    - by Sonny
    Hi i got this text 2/92/20 3/32/32 4/62/6 5/22/28 6/60/61 7/33/32 8/34/31 9/31/19 10/19/19 11/34/39 12/32/32 14/19/25 15/45/37 16/32/32 17/84/36 18/72/33 and i need it to be like // 2/92/20 chars[0][0]=2; chars[0][1]=92; chars[0][2]=20; How should i make that PS: the split must be in $.ajax({ type: "POST", url: "char_info2.php", dataType: "html", success: function(data) { //here }

    Read the article

  • How to get named excel sheets while exporting from SSRS

    - by rao
    Whenever a single page report is exported to excel, sheet in excel is named by the report name. If a report has multiple pages, the sheets are named as sheet1, sheet2,.... Is there any way to specify sheet names in SSRS 2005 ? solution: Found this after some googleing: Changing the Sheet names in SQL Server RS Excel: QnD XSLT Will try out and post an update if it works.

    Read the article

  • Problems with MYSQL database

    - by shinjuo
    I have a database that worked fine until I decided to add a log onto the page. here is what I have now: <body> <?php if($_SERVER['REQUEST_METHOD'] == 'POST') { require("serverInfo.php"); mysql_query("UPDATE `cardLists` SET `AmountLeft` = `AmountLeft` + ".mysql_real_escape_string($_POST['Add'])." WHERE `cardID` = '".mysql_real_escape_string($_POST['Cards'])."'"); echo "\"" .$_POST['Add'] ."\" has been added to the inventory amount for the card \"". $_POST['Cards']. "\""; mysql_query("INSERT INTO `log` (`changes`, `amount`, `cardID`, `person`, Date)VALUES('ADDED','$_POST['Add']','$_POST['Cards']', '$_POST['Person']', NOW())"); mysql_close($link); } ?> <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> <?php require("serverInfo.php"); ?> <?php $res = mysql_query("SELECT * FROM cardLists order by cardID") or die(mysql_error()); echo "<select name = 'Cards'>"; while($row=mysql_fetch_assoc($res)) { echo "<option value=\"$row[cardID]\">$row[cardID]</option>"; } echo "</select>"; ?> Amount to Add: <input type="text" name="Add" maxlength="8" /> Changes Made By: <select name="Person"> <option value="justin">Justin</option> <option value="chris">Chris</option> <option value="matt">Matt</option> <option value="dan">Dan</option> <option value="tim">Tim</option> <option value="amanda">Amanda</option> </select> <input type="submit" name ="submit" onClick= "return confirm( 'Are you sure you want to add this amount?');"> </form> <br /> <input type="button" name="main" value="Return To Main" onclick="window.location.href='index.php';" /> </body> </html> it works fine until I added the: mysql_query("INSERT INTO `log` (`changes`, `amount`, `cardID`, `person`, Date)VALUES('ADDED','$_POST['Add']','$_POST['Cards']', '$_POST['Person']', NOW())"); mysql_close($link); Can anyone see what is going on?

    Read the article

< Previous Page | 501 502 503 504 505 506 507 508 509 510 511 512  | Next Page >