Search Results

Search found 26454 results on 1059 pages for 'post parameter'.

Page 505/1059 | < Previous Page | 501 502 503 504 505 506 507 508 509 510 511 512  | Next Page >

  • How to get to apple iphone discussion forums?

    - by wolverine
    I logged into my account and is reaching this page. http://developer.apple.com/devforums/ After that when i click login and give the details, it redirects to the same page. Where can I see the discussions and post questions? I know its a simple question but dont know what I am missing here.

    Read the article

  • Need help helping in converting jquery, ajax, json and asp.net

    - by Haja Mohaideen
    I am tying out this tutorial, http://www.ezzylearning.com/tutorial.aspx?tid=5869127. It works perfectly. What I am now trying to do is to host the aspx contents as html file. This html file is hosted on my wampserver which is on my laptop. The asp.net code hosted on my test server. When I try to access, I get the following error, Resource interpreted as Script but transferred with MIME type text/html: "http://201.x.x.x/testAjax/Default.aspx/AddProductToCart?callback=jQuery17103264484549872577_1346923699990&{%20pID:%20%226765%22,%20qty:%20%22100%22,%20lblType:%20%2220%22%20}&_=1346923704482". jquery.min.js:4 Uncaught SyntaxError: Unexpected token < I am not sure how to solve this problem. index.html code $(function () { $('#btnAddToCart').click(function () { var result = $.ajax({ type: "POST", url: "http://202.161.45.124/testAjax/Default.aspx/AddProductToCart", crossDomain: true, data: '{ pID: "6765", qty: "100", lblType: "20" }', contentType: "application/json; charset=utf-8", dataType: "jsonp", success: succeeded, failure: function (msg) { alert(msg); }, error: function (xhr, err) { alert(err); } }); }); }); function succeeded(msg) { alert(msg.d); } function btnAddToCart_onclick() { } </script> </head> <body> <form name="form1" method="post"> <div> <input type="button" id="btnAddToCart" onclick="return btnAddToCart_onclick()" value="Button" /> </div> </form> aspx.vb Imports System.Web.Services Imports System.Web.Script.Services <ScriptService()> Public Class WebForm1 Inherits Page Protected Sub Page_Load(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.Load Session("test") = "" End Sub <WebMethod()> <ScriptMethod(UseHttpGet:=False, ResponseFormat:=ResponseFormat.Json)> Public Shared Function AddProductToCart(pID As String, qty As String, lblType As String) As String Dim selectedProduct As String = String.Format("+ {0} - {1} - {2}", pID, qty, lblType) HttpContext.Current.Session("test") += selectedProduct Return HttpContext.Current.Session("test").ToString() End Function End Class

    Read the article

  • Variable disappears when I log in

    - by John
    Hello, I have profile page where the profile is retrieved via GET. The index file has this: $profile = $_GET['profile']; When I log in on the profile page, the $profile variable disappears. Here is the form action on the login function: <form name="login-form" id="login-form" method="post" action="./index.php"> (The $profile variable is separate of the login username.) How could I make the page retain the $profile variable? Thanks in advance, John

    Read the article

  • how to write a script that logs into an application and checks a page

    - by josh
    Is it possible to write a script that will login to an application using uname/pwd? the username/password are not passed in through POST (they dont come in the URL) Basic steps I am looking for are: Visit url enter uname/pwd click a button click a link get the raw html to make sure it does not have 500 error Is that possible to do in any language? Please point me to some examples as well

    Read the article

  • symbols in command line argument.. python, bash

    - by Idlecool
    Hi, I am writing a python script on Linux for twitter post using API, Is it possible to pass symbols like "(" ")" etc in clear text without apostrophes.... % ./twitterupdate this is me #works fine % ./twitterupdate this is bad :(( #this leaves a error on bash. Is the only alternative is to enclose the text into -- "" ?? like.. % ./twitterupdate "this is bad :((" #this will reduce the ease of use for the script Is there any workaround?

    Read the article

  • How Does One Differentiate Between Routes POSTed To In Asp.Net MVC?

    - by Laz
    I have two actions, one that accepts a ViewModel and one that accepts two parameters a string and an int, when I try to post to the action, it gives me an error telling me that the current request is ambiguous between the two actions. Is it possible to indicate to the routing system which action is the relevant one, and if it is how is it done?

    Read the article

  • html5 uploader + jquery drag & drop: how to store file data with FormData?

    - by lauthiamkok
    I am making a html5 drag and drop uploader with jquery, below is my code so far, the problem is that I get an empty array without any data. Is this line incorrect to store the file data - fd.append('file', $thisfile);? $('#div').on( 'dragover', function(e) { e.preventDefault(); e.stopPropagation(); } ); $('#div').on( 'dragenter', function(e) { e.preventDefault(); e.stopPropagation(); } ); $('#div').on( 'drop', function(e){ if(e.originalEvent.dataTransfer){ if(e.originalEvent.dataTransfer.files.length) { e.preventDefault(); e.stopPropagation(); // The file list. var fileList = e.originalEvent.dataTransfer.files; //console.log(fileList); // Loop the ajax post. for (var i = 0; i < fileList.length; i++) { var $thisfile = fileList[i]; console.log($thisfile); // HTML5 form data object. var fd = new FormData(); //console.log(fd); fd.append('file', $thisfile); /* var file = {name: fileList[i].name, type: fileList[i].type, size:fileList[i].size}; $.each(file, function(key, value) { fd.append('file['+key+']', value); }) */ $.ajax({ url: "upload.php", type: "POST", data: fd, processData: false, contentType: false, success: function(response) { // .. do something }, error: function(jqXHR, textStatus, errorMessage) { console.log(errorMessage); // Optional } }); } /*UPLOAD FILES HERE*/ upload(e.originalEvent.dataTransfer.files); } } } ); function upload(files){ console.log('Upload '+files.length+' File(s).'); }; then if I use another method is that to make the file data into an array inside the jquery code, var file = {name: fileList[i].name, type: fileList[i].type, size:fileList[i].size}; $.each(file, function(key, value) { fd.append('file['+key+']', value); }); but where is the tmp_name data inside e.originalEvent.dataTransfer.files[i]? php, print_r($_POST); $uploaddir = './uploads/'; $file = $uploaddir . basename($_POST['file']['name']); if (move_uploaded_file($_POST['file']['tmp_name'], $file)) { echo "success"; } else { echo "error"; } as you can see that tmp_name is needed to upload the file via php... html, <div id="div">Drop here</div>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Question about ITextUndoHistory returned from TryGetHistory

    - by nick.ueda
    Everytime the IWpfTextView's TextBuffer changes I am trying to get the history's redostack and undostack and simply checking the count. When doing this I am encountering a "Method not supported exception" when trying to access the two stacks. Am I retrieving the history incorrectly or does VS not want me seeing/editing the contents of the stacks? I can post the code if necessary... Thanks, Nick

    Read the article

  • Using preg_replace to replace all occurrences in php

    - by Greg-J
    Regex is absolutely my weak point and this one has me completely stumped. I am building a fairly basic search functionality and I need to be able to alter my user input based on the following pattern: Subject: %22first set%22 %22second set%22-drupal -wordpress Desired output: +"first set" +"second set" -drupal -wordpress I wish I could be more help as I normally like to at least post the solution I have so far, but on this one I'm at a loss. Any help is appreciated. Thank you.

    Read the article

  • UI template with big controls

    - by Bumble Bee
    Im not sure if this question is appropriate to go in here but after some hard effort in google I had no option but to post this here. I'm in the process of doing some UIs for a touch screen, but not sure how the template should look like. e.g. how big the buttons/text/labels should be. If anyone has experience in doing s similar stuff, pls share some references you have. thanks BB

    Read the article

  • Good computer science lecture series

    - by joemoe
    Since we have a thread on books.. what are your recommendations of publicly accessible video lecture series related to programming, computer science, or mathematics? Please post specific courses, not websites with courses. :) This is the video equivalent of this thread: http://stackoverflow.com/questions/194812/list-of-freely-available-programming-books

    Read the article

  • Codeigniter not returning me to upload form after image upload.

    - by Drew
    I'm still very new to codeigniter. The issue i'm having is that the file uploads fine and it writes to the database without issue but it just doesn't return me to the upload form. Instead it stays in the do_upload and doesn't display anything. Even more bizarrely there is some source code behind the scenes. Can someone tell my what it is i'm doing wrong because I want to be returning to my upload form after submission. Thanks in advance. Below is my code: Controller: function do_upload() { if($this->Upload_model->do_upload()) { $this->load->view('home/upload_form'); }else{ $this->load->view('home/upload_success', $error); } } Model: function do_upload() { $config['upload_path'] = './uploads/'; $config['allowed_types'] = 'gif|jpg|png'; $config['max_size'] = '2000'; $this->load->library('upload', $config); if ( ! $this->upload->do_upload()) { $error = array('error' => $this->upload->display_errors()); return $error; } else { $data = $this->upload->data(); $full_path = 'uploads/' . $data['file_name']; $spam = array( 'image_url' => $full_path, 'url' => $this->input->post('url') ); $id = $this->input->post('id'); $this->db->where('id', $id); $this->db->update('NavItemData', $spam); return true; } } View (called upload_form): <html> <head> <title>Upload Form</title> </head> <body> <?php if(isset($buttons)) : foreach($buttons as $row) : ?> <h2><?php echo $row->image_url; ?></h2> <p><?php echo $row->url; ?></p> <p><?php echo $row->name; ?></p> <p><?php echo anchor("upload/update_nav/$row->id", 'edit'); ?></p> <?php endforeach; ?> <?php endif; ?> </body> </html>

    Read the article

  • jQuery mobile ajax login form authentication

    - by Jakub Zak
    I know i already asked simillar question, but now when I work with jQuery Mobile I can't figure it out. So I have this form: <div data-role="page" data-theme="a" id="login_page"> <div data-role="header" data-position="fixed"> <h1>****</h1> </div> <div data-role="content"> <form id="login_form" method="POST" data-ajax="false"> <label for="basic">Username:</label> <input type="text" name="name" id="username" value=""/> <label for="basic">Password:</label> <input type="password" name="password" id="password" value=""/> <input type="submit" value="Login" id="login" name="login"/> </form> </div> <div data-role="footer" data-position="fixed"> <div data-role="navbar"></div> </div> </div> And I need to submit Username and Password to php script, where php replies and send "success" or "failed". Here is php: <?php session_start(); $username = $_POST["name"]; $password = $_POST["password"]; include('mysql_connection.php'); mysql_select_db("jzperson_imesUsers", $con); $res1 = mysql_query("SELECT * FROM temp_login WHERE username='$username' AND password='$password'"); $count=mysql_num_rows($res1); if($count==1){ echo "success"; }else{ echo "failed"; } ?> And to do all this I want to use this script: $(document).ready(function() { $("form").submit(function(){ $.mobile.showPageLoadingMsg(); $.ajax({ url: "http://imes.jzpersonal.com/login_control.php", type: "POST", dataType: "jsonp", jsonp: "jsoncallback", data: $("form#login_form").serialize(), success: function( response ){ $.mobile.changePage( "http://imes.jzpersonal.com/user_panel.html"); } }); return false; }); }); But I can't make it work, I know I must have mistakes in there, I just can't find them, or better way to do it. Thank you in advance for any help.

    Read the article

  • Tag Cloud JS + Flash. Not clickable?

    - by Alex
    Hello all, I've implemented a tag cloud on a site of mine, and I'm using a JS script to populate it, but for some reason, the actual text in the tag cloud is not clickable. It displays and works correctly, but the actual text of the cloud is not getting treated as a link for some odd reason. My question is: In my script below, do you see anything that I need to fix in order to make my tag cloud's text actually be links? The site I've implemented it on is a stackexhange site that I run, it is supposed to be a cloud of the "recent tags." CloudPopulator.js <script type="text/javascript"> var divRecentTags = document.getElementById("recent-tags"); if (divRecentTags) { var cloud = new SWFObject("https://kynetx-images.s3.amazonaws.com/tagcloud.swf", "tagcloudflash", "200", "200", "9", "#ffffff"); cloud.addParam("allowScriptAccess", "always"); cloud.addVariable("tcolor", "0x0a94d6"); cloud.addVariable("tcolor2", "0xC0C0C0"); cloud.addVariable("hicolor", "0x000000"); cloud.addVariable("tspeed", "150"); cloud.addVariable("distr", "true"); cloud.addVariable("mode", "tags"); var aTags = divRecentTags.getElementsByTagName("a"); var tagHtml = ""; for(var i = 0; i < aTags.length; i++) { var hrefText = aTags[i].getAttribute("href"); var cssText = aTags[i].className; var tagName = $(aTags[i]).text(); var styleText = "style=\'font-size: 8pt;\'"; if (cssText == "post-tag pop1") { var styleText = "style=\'font-size: 15pt;\'"; } else if (cssText == "post-tag pop2") { var styleText = "style=\'font-size: 22pt;\'"; } var newLinkText = "<a href=\'"+hrefText+"\'"+styleText+">"+tagName+"</a>"; tagHtml = tagHtml + newLinkText; } cloud.addVariable("tagcloud", escape("<tags>" + tagHtml + "</tags>")); cloud.write("recent-tags"); }

    Read the article

  • Multiple task in one page?(php - mysql - jquery)

    - by python
    My goal is to build an application in a page that can be use multiple task(crud) for example in this html code.there are multiple submit,multiple action in the same page after (user submit (CURD) it will load result table below.) In juery how Can I do this.? <script type="text/javascript" src="jquery.js"></script> <script> $(document).ready(function(){ $("#button1").click(function(){ $('form#crudform').attr({action: "script_1.php"}); $('form#crudform').submit(); }); $("#button2").click(function(){ $('form#crudform').attr({action: "script_2.php"}); $('form#crudform').submit(); }); $("#button3").click(function(){ $('form#crudform').attr({action: "script_3.php"}); $('form#crudform').submit(); }); }); </script> Form CRUD: <form id="crudform" method="post"> <p>Name: <input type="text" name="name"/></p> <p>Age: <input type="text" name="age"/></p> <input type="button" id="button1" value="Cancel" /> <input type="button" id="button2" value="Save" /> <input type="button" id="button3" value="Update" /> </form> Result: <form id="result" method="post"> <table border="1"> <tr> <tr><td></td><td>Name</td><td>Age</td> </tr> <tr><td><input type="checkbox" name="name1"></td><td>Name1</td><td>10</td><tr> <tr><td><input type="checkbox" name="name1"></td><td>Name2</td><td>15</td></tr> <tr><td><input type="checkbox" name="name3"></td><td>Name3</td><td>16</td></tr> </table> <input type="button" id="button4" value="change" /> <input type="button" id="button5" value="drop" /> </form> Anybody know the tutorials relating ..with my tasks.or tips,guide.....are welconme :)

    Read the article

< Previous Page | 501 502 503 504 505 506 507 508 509 510 511 512  | Next Page >