Search Results

Search found 26454 results on 1059 pages for 'post parameter'.

Page 505/1059 | < Previous Page | 501 502 503 504 505 506 507 508 509 510 511 512  | Next Page >

  • Arbitrary Form Processing with Drupal

    - by Aaron
    I am writing a module for my organization to cache XML feeds to static files to an arbitrary place on our webserver. I am new at Drupal development, and would like to know if I am approaching this the right way. Basically I: Expose a url via the menu hook, where a user can enter in a an output directory on the webserver and press the "dump" button and then have PHP go to drupal and get the feed xml. I don't need help with that functionality, because I actually have a prototype working in Python (outside of Drupal).. Provide a callback for the form where I can do my logic, using the form parameters. Here's the menu hook: function ncbi_cache_files_menu() { $items = array(); $items['admin/content/ncbi_cache_files'] = array( 'title' => 'NCBI Cache File Module', 'description' => 'Cache Guide static content to files', 'page callback' => 'drupal_get_form', 'page arguments' => array( 'ncbi_cache_files_show_submit'), 'access arguments' => array( 'administer site configuration' ), 'type' => MENU_NORMAL_ITEM, ); return $items; } I generate the form in: function ncbi_cache_files_show_submit() { $DEFAULT_OUT = 'http://myorg/foo'; $form[ 'ncbi_cache_files' ] = array( '#type' => 'textfield', '#title' => t('Output Directory'), '#description' => t('Where you want the static files to be dumped. This should be a directory that www has write access to, and should be accessible from the foo server'), '#default_value' => t( $DEFAULT_OUT ), '#size' => strlen( $DEFAULT_OUT ) + 5, ); $form['dump'] = array( '#type' => 'submit', '#value' => 'Dump', '#submit' => array( 'ncbi_cache_files_dump'), ); return system_settings_form( $form ); } Then the functionality is in the callback: function ncbi_cache_files_dump( $p, $q) { //dpm( get_defined_vars() ); $outdir = $p['ncbi_cache_files']['#post']['ncbi_cache_files']; drupal_set_message('outdir: ' . $outdir ); } The question: Is this a decent way of processing an arbitrary form in Drupal? I not really need to listen for any drupal hooks, because I am basically just doing some URL and file processing. What are those arguments that I'm getting in the callback ($q)? That's the form array I guess, with the post values? Is this the best way to get the form parameters to work on? Thanks for any advice.

    Read the article

  • Coolest C# LINQ/Lambdas trick you've ever pulled?

    - by chakrit
    Saw a post about hidden features in C# but not a lot of people have written linq/lambdas example so... I wonder... What's the coolest (as in the most elegant) use of the C# LINQ and/or Lambdas/anonymous delegates you have ever saw/written? Bonus if it has went into production too!

    Read the article

  • How to link to specific anchor in table with jquery

    - by LisaH
    I am using this jquery plugin: http://www.jankoatwarpspeed.com/post/2009/07/20/Expand-table-rows-with-jQuery-jExpand-plugin.aspx I have anchors in the code such as: <a name="art" id="art2"></a> Articles How can I open that particular row then? In other words, when a user clicks a link from another page to this landing page I would like the appropriate row to open up based on the anchor tag. Thanks in advance!

    Read the article

  • Format form fields for bootstrap using rails+nokogiri

    - by user1116573
    I have the following in an initializer in a rails app that uses Twitter bootstrap so that it removes the div.field_with_errors that rails applies when validation fails on a field but also the initializer adds the help/validation text after the erroneous input field: require 'nokogiri' ActionView::Base.field_error_proc = Proc.new do |html_tag, instance| html = %(<div class="field_with_errors">#{html_tag}</div>).html_safe form_fields = [ 'textarea', 'input', 'select' ] elements = Nokogiri::HTML::DocumentFragment.parse(html_tag).css("label, " + form_fields.join(', ')) elements.each do |e| if e.node_name.eql? 'label' html = %(#{e}).html_safe elsif form_fields.include? e.node_name if instance.error_message.kind_of?(Array) html = %(#{e}<span class="help-inline">&nbsp;#{instance.error_message.join(',')}</span>).html_safe else html = %(#{e}<span class="help-inline">&nbsp;#{instance.error_message}</span>).html_safe end end end html end This works fine but I also need to apply the .error class to the surrounding div.control-group for each error. My initializer currently gives the following output: <div class="control-group"> <label class="control-label" for="post_message">Message</label> <div class="controls"> <input id="post_message" name="post[message]" required="required" size="30" type="text" value="" /><span class="help-inline">&nbsp;can't be blank</span> </div> </div> but I need something adding to my initializer so that it adds the .error class to the div.control-group like so: <div class="control-group error"> <label class="control-label" for="post_message">Message</label> <div class="controls"> <input id="post_message" name="post[message]" required="required" size="30" type="text" value="" /><span class="help-inline">&nbsp;can't be blank</span> </div> </div> The solution will probably need to allow for the fact that each validation error could have more than one label and input that are all within the same div.control-group (eg radio buttons / checkboxes / 2 text fields side by side). I assume it needs some sort of e.at_xpath() to find the div.control-group parent and add the .error class to it but I'm not sure how to do this. Can anyone help? PS This may all be possible using the formtastic or simple_form gems but I'd rather just use my own html if possible. EDIT If I put e['class'] = 'foo' in the if e.node_name.eql? 'label' section then it applies the class to the label so I think I just need to find the parent tag of e and then apply an .error class to it but I can't figure out what the xpath would be to get from label to its div.control-group parent; no combination of dots, slashes or whatever seems to work but xpath isn't my strong point.

    Read the article

  • Wordpress display specific sub category of a parent category.

    - by Pennf0lio
    So here's the scenario, I'm building a theme that would display sub category of a parent post for Food: [Food] -Hotdog -Eggs -Fries for Toys: [Toys] -Doll -Car -Drums for People: [People] -Mom -Dad -Uncle now I don't want to display their parent category, just their subcategory (eg Doll, Car, Drums). I've looked list_cats() and wp_list_categories() but I can't figure out how to display it right. Thanks!

    Read the article

  • Hiding Group Column Names

    - by Robert
    You once replied to a post about hiding list group header names. http://edinkapic.blogspot.com/2008/06/hiding-list-view-group-headers.html I do not write code or jQuery at that. But you mentioned that it would be better to write a solution in jQuery. Would you have code that would hide the group header and colon in a 2003 list (SP v.2)? Do you have any good leads? Thanks. Robert S.

    Read the article

  • Live search results as you type... am I going about this the right way? jQuery + PHP

    - by dallen
    This is my first time building a tool like this, so please bare with me. I'm doing this to learn more about jQuery and AJAX. Basically, I have a search input and a hidden div. When you start typing in the search input, the hidden div becomes visible and results are brought in. In this case, I'm searching for client names. It all works fine, however I think my code could be better but I'm not sure exactly where to begin. Each keyup requests a PHP script which accesses a table in a database to find a like string. But in my PHP script, I'm echo'ing some JS/jQuery which I'm not sure is good practice. Below is my code. Am I going about this the right way or am I totally off base? Any suggestions for improvement? Javascript $("#search").keyup(function() { $("#search_results").show("fast"); $.ajax ({ type: "POST", url: "http://localhost:8888/index.php/welcome/search/" + $("#search").val(), success: function(html) { $("#search_results").html(html); } }); }); PHP function search($search_string = false) { if ($search_string) { $this->db->like('name', $search_string); $query = $this->db->get('clients'); if ($query->num_rows() == 0) { echo "No client exists."; } else { foreach ($query->result() as $row) { echo '<script>'; echo ' $("#client_results_'.$row->id.'").hide(); $("#'.$row->id.'").toggle(function() { $.ajax ({ type: "POST", url: "http://localhost:8888/index.php/welcome/search_client_ads/" + '.$row->id.', success: function(html) { $("#client_results_'.$row->id.'").html(html).show("fast"); } }); }, function() { $("#client_results_'.$row->id.'").hide("fast").html(""); });'; echo '</script>'; echo '<p><span id="'.$row->id.'">'.$row->name.'</span></p>'; echo '<div id="client_results_'.$row->id.'"></div>'; } } } else { echo ''; } } function search_client_ads($client_id) { $query = $this->db->get_where('online_ads', array('client' => $client_id)); if ($query->num_rows() == 0) { echo "No ads exist."; } else { foreach ($query->result() as $row) { echo $row->id; } } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • virtualenvwrapper .hook problem

    - by Wraith
    I've used virtualenvwrapper, but I'm having problems running it on a new computer. My .bashrc file is updated per the instructions: export WORKON_HOME=$DEV_HOME/projects source /usr/local/bin/virtualenvwrapper.sh But when source is run, I get the following: bash: /25009.hook: Permission denied bash: /25009.hook: No such file or directory This previous post leads me to believe the filename is being recycled and locked because virtualenvwrapper.sh uses $$. Is there any way to fix this?

    Read the article

  • Describe your workflow of using version control (VCS or DVCS)

    - by edwin.nathaniel
    I'd like to learn other people workflow when using either SVN or GIT. Please describe your strategy to handle the following tasks: Implement a feature Fixing bugs (during development and deployed app) Code Review Refactoring code (post code-review) Incorporate patches Releasing the newer version of your app (desktop, web, mobile, would you treat them differently?) Feel free to organize your answer not grouped by the tasks but grouped by whatever you think is relevant but please organize it by VCS/DVCS (please don't mix them). Thank you.

    Read the article

  • How Does One Differentiate Between Routes POSTed To In Asp.Net MVC?

    - by Laz
    I have two actions, one that accepts a ViewModel and one that accepts two parameters a string and an int, when I try to post to the action, it gives me an error telling me that the current request is ambiguous between the two actions. Is it possible to indicate to the routing system which action is the relevant one, and if it is how is it done?

    Read the article

  • Nesting forms in CakePHP

    - by Erik
    I am wondering if there's a way in CakePHP to nest multiple models in a form? What I'm trying to accomplish is to make a form for creating Posts that will also contain fields for adding Images (separate model) that will automatically be connected to the created post. Something similar to Ruby on Rails ** accept_nested_attributes_for**.

    Read the article

  • Compile multiple C files with make

    - by Mohit Deshpande
    (I am running Linux Ubuntu 9.10, so the extension for an executable is executablefile.out) I am just getting into modular programming (programming with multiple files) in C and I want to know how to compile multiple files in a single makefile. For example, what would be the makefile to compile these files: main.c, dbAdapter.c, dbAdapter.h? (By the way, If you haven't figured it out yet, the main function is in main.c) Also could someone post a link to the documentation of a makefile?

    Read the article

  • Zend Framework decorator subform add a class tag to DD wrapper tag

    - by Samuele
    I have this form: class Request_Form_Prova extends Zend_Form { public function init() { $this->setMethod('post'); $SubForm_Step = new Zend_Form_SubForm(); $SubForm_Step->setAttrib('class','Step'); $this->addSubform($SubForm_Step, 'Chicco'); $PrivacyCheck = $SubForm_Step->createElement('CheckBox', 'PrivacyCheck'); $PrivacyCheck->setLabel('I have read and I agre bla bla...') ->setRequired(true) ->setUncheckedValue(''); $PrivacyCheck->getDecorator('Label')->setOption('class', 'inline'); $SubForm_Step->addElement($PrivacyCheck); $SubForm_Step->addElement('submit', 'submit', array( 'ignore' => true, 'label' => 'OK', )); } } That generate this HTML: <form enctype="application/x-www-form-urlencoded" method="post" action=""> <dl class="zend_form"> <dt id="Chicco-label">&nbsp;</dt> <dd id="Chicco-element"> <fieldset id="fieldset-Chicco" class="Step"> <dl> <dt id="Chicco-PrivacyCheck-label"><label for="Chicco-PrivacyCheck" class="inline required">I have read and I agre bla bla...</label></dt> <dd id="Chicco-PrivacyCheck-element"> <input type="hidden" name="Chicco[PrivacyCheck]" value=""><input type="checkbox" name="Chicco[PrivacyCheck]" id="Chicco-PrivacyCheck" value="1"> </dd> <dt id="submit-label">&nbsp;</dt> <dd id="submit-element"> <input type="submit" name="Chicco[submit]" id="Chicco-submit" value="OK"> </dd> </dl> </fieldset> </dd> </dl> </form> How can I add a class="Test" to the <dd id="Chicco-element"> elemnt? In order to have it like that: <dd id="Chicco-element" class="Test"> I thought something like that but it don't work: $SubForm_Step->getDecorator('DdWrapper')->setOption('class', 'Test'); OR $SubForm_Step->getDecorator('DtDdWrapper')->setOption('class', 'Test'); How can I do it? And last question: How can I wrap that DD and DT element of a SubForm in another DL element? Like that: ( second line ) <dl class="zend_form"> <dl> <dt id="Chicco-label">&nbsp;</dt> <dd id="Chicco-element"> <fieldset id="fieldset-Chicco" class="Step"> <dl> .......

    Read the article

  • Is DevTeach worth the cost?

    - by Mafuba
    Wondering if people who have attended DevTeach could comment on the value of the conference (e.g. well-organized, good sessions, good material, etc.). This post seems to indicate that it is not worth the money.

    Read the article

  • Add Events to Yahoo using curl

    - by Sudhir
    I've tried using curl to add new events to yahoo, succeeded in logging in and getting the calendar add events page, but when i try to post events using curl, it redirects me to login page. Please suggest what can i do...? Thanks in advance

    Read the article

  • Implementing the server side of Webhooks

    - by Howiecamp
    If I want to Webhooks-enable a web application (I'm referring to the server-side of things, ie the server where the event happens and the callback is initiated from), are there libraries for this, or is this functionality typically part of the web server stack? Or, am I looking at this incorrectly, and to implement Webhooks I simply code my application to do an HTTP POST callback based on whatever events I care about?

    Read the article

  • How to change the request IP in HttpWebRequest?

    - by holiveira
    I'm developing a website that will connect to a credit card processing gateway webservice. For security purposes this webservice accepts requests only from IP addresses that were previously informed to them. Since I'm developing locally, my IP changes almost every day. Is there a way for me to change the IP address of a HttpWebRequest so that I can test the Webservice calls locally? This webservice is accessed through a https address and the methods must be sent via POST.

    Read the article

< Previous Page | 501 502 503 504 505 506 507 508 509 510 511 512  | Next Page >