Search Results

Search found 13774 results on 551 pages for 'apache modules'.

Page 528/551 | < Previous Page | 524 525 526 527 528 529 530 531 532 533 534 535  | Next Page >

  • Problem connecting to postgres with Kohana 3 database module on OS X Snow Leopard

    - by Bart Gottschalk
    Environment: Mac OS X 10.6 Snow Leopard PHP 5.3 Kohana 3.0.4 When I try to configure and use a connection to a postgresql database on localhost I get the following error: ErrorException [ Warning ]: mysql_connect(): [2002] No such file or directory (trying to connect via unix:///var/mysql/mysql.sock) Here is the configuration of the database in /modules/database/config/database.php (note the third instance named 'pgsqltest') return array ( 'default' => array ( 'type' => 'mysql', 'connection' => array( /** * The following options are available for MySQL: * * string hostname * string username * string password * boolean persistent * string database * * Ports and sockets may be appended to the hostname. */ 'hostname' => 'localhost', 'username' => FALSE, 'password' => FALSE, 'persistent' => FALSE, 'database' => 'kohana', ), 'table_prefix' => '', 'charset' => 'utf8', 'caching' => FALSE, 'profiling' => TRUE, ), 'alternate' => array( 'type' => 'pdo', 'connection' => array( /** * The following options are available for PDO: * * string dsn * string username * string password * boolean persistent * string identifier */ 'dsn' => 'mysql:host=localhost;dbname=kohana', 'username' => 'root', 'password' => 'r00tdb', 'persistent' => FALSE, ), 'table_prefix' => '', 'charset' => 'utf8', 'caching' => FALSE, 'profiling' => TRUE, ), 'pgsqltest' => array( 'type' => 'pdo', 'connection' => array( /** * The following options are available for PDO: * * string dsn * string username * string password * boolean persistent * string identifier */ 'dsn' => 'mysql:host=localhost;dbname=pgsqltest', 'username' => 'postgres', 'password' => 'dev1234', 'persistent' => FALSE, ), 'table_prefix' => '', 'charset' => 'utf8', 'caching' => FALSE, 'profiling' => TRUE, ), ); And here is the code to create the database instance, create a query and execute the query: $pgsqltest_db = Database::instance('pgsqltest'); $query = DB::query(Database::SELECT, 'SELECT * FROM test')->execute(); I'm continuing to research a solution for this error but thought I'd ask to see if someone else has already found a solution. Any ideas are welcome. One other note is that I know my build of PHP can access this postgresql db since I'm able to manage the db using phpPgAdmin. But I have yet to determine what phpPgAdmin is doing differently to connect to the db than what Kohana 3 is attempting. Bart

    Read the article

  • A simple Python deployment problem - a whole world of pain

    - by Evgeny
    We have several Python 2.6 applications running on Linux. Some of them are Pylons web applications, others are simply long-running processes that we run from the command line using nohup. We're also using virtualenv, both in development and in production. What is the best way to deploy these applications to a production server? In development we simply get the source tree into any directory, set up a virtualenv and run - easy enough. We could do the same in production and perhaps that really is the most practical solution, but it just feels a bit wrong to run svn update in production. We've also tried fab, but it just never works first time. For every application something else goes wrong. It strikes me that the whole process is just too hard, given that what we're trying to achieve is fundamentally very simple. Here's what we want from a deployment process. We should be able to run one simple command to deploy an updated version of an application. (If the initial deployment involves a bit of extra complexity that's fine.) When we run this command it should copy certain files, either out of a Subversion repository or out of a local working copy, to a specified "environment" on the server, which probably means a different virtualenv. We have both staging and production version of the applications on the same server, so they need to somehow be kept separate. If it installs into site-packages, that's fine too, as long as it works. We have some configuration files on the server that should be preserved (ie. not overwritten or deleted by the deployment process). Some of these applications import modules from other applications, so they need to be able to reference each other as packages somehow. This is the part we've had the most trouble with! I don't care whether it works via relative imports, site-packages or whatever, as long as it works reliably in both development and production. Ideally the deployment process should automatically install external packages that our applications depend on (eg. psycopg2). That's really it! How hard can it be?

    Read the article

  • A Python Wrapper for Shutterfly. Uploading an Image

    - by iJames
    I'm working on a Django app in which I want to order prints through Shutterfly's Open API: http://www.shutterfly.com/documentation/start.sfly So far I've been able to build the appropriate POSTs and GETs using the modules and suggested code snippets including httplib, httplib2, urllib, urllib2, mimetype, etc. But I'm stuck on the image uploading when placing an order (the ordering process is not the same process as uploading images to albums which I haven't tried.) From what I can tell, I'm supposed to basically create the multipart form data by concatenating the HTTP request body together with the binary data of the image. I take the strings: --myuniqueboundary1273149960.175.1 Content-Disposition: form-data; name="AuthenticationID" auniqueauthenticationid --myuniqueboundary1273149960.175.1 Content-Disposition: file; name="Image.Data"; filename="1_41_orig.jpg" Content-Type: image/jpeg and I put this data into it and end with the final boundary: ...\xb5|\xf88\x1dj\t@\xd9\'\x1f\xc6j\x88{\x8a\xc0\x18\x8eGaJG\x03\xe9J-\xd8\x96[\x91T\xc3\x0eTu\xf4\xaa\xa5Ty\x80\x01\x8c\x9f\xe9Z\xad\x8cg\xba# g\x18\xe2\xaa:\x829\x02\xb4["\x17Q\xe7\x801\xea?\xad7j\xfd\xa2\xdf\x81\xd2\x84D\xb6)\xa8\xcb\xc8O\\\x9a\xaf(\x1cqM\x98\x8d*\xb8\'h\xc8+\x8e:u\xaa\xf3*\x9b\x95\x05F8\xedN%\xcb\xe1B2\xa9~Tw\xedF\xc4\xfe\xe8\xfc\xa9\x983\xff\xd9... That ends up making it look like this (when I use print to debug): ... --myuniqueboundary1273149960.175.1 Content-Disposition: file; name="Image.Data"; filename="1_41_orig.jpg" Content-Type: image/jpeg ????q?ExifMM* ? ??(1?2?<??i?b?NIKON CORPORATIONNIKON D40HHQuickTime 7.62009:02:17 13:05:25Mac OS X 10.5.6%??????"?'??0220?????? ???? ? ?|_???,b???50??5 ... --myuniqueboundary1273149960.175.1-- My code for grabbing the binary data is pretty much this: filedata = open('myjpegfile.jpeg','rb').read() Which I then add to the rest of the body. I've see something like this code everywhere. I'm then using this to post the full request (with the headers too): response = urllib2.urlopen(request).read() This seems to me to be the standard way that form POSTS with files happens. Am I missing something here? At some point I might be able to make this into a library worth posting up on github, but this problem has stopped me cold in my tracks. Thanks for any insight!

    Read the article

  • Logging raw HTTP request/response in ASP.NET MVC & IIS7

    - by Greg Beech
    I'm writing a web service (using ASP.NET MVC) and for support purposes we'd like to be able to log the requests and response in as close as possible to the raw, on-the-wire format (i.e including HTTP method, path, all headers, and the body) into a database. What I'm not sure of is how to get hold of this data in the least 'mangled' way. I can re-constitute what I believe the request looks like by inspecting all the properties of the HttpRequest object and building a string from them (and similarly for the response) but I'd really like to get hold of the actual request/response data that's sent on the wire. I'm happy to use any interception mechanism such as filters, modules, etc. and the solution can be specific to IIS7. However, I'd prefer to keep it in managed code only. Any recommendations? Edit: I note that HttpRequest has a SaveAs method which can save the request to disk but this reconstructs the request from the internal state using a load of internal helper methods that cannot be accessed publicly (quite why this doesn't allow saving to a user-provided stream I don't know). So it's starting to look like I'll have to do my best to reconstruct the request/response text from the objects... groan. Edit 2: Please note that I said the whole request including method, path, headers etc. The current responses only look at the body streams which does not include this information. Edit 3: Does nobody read questions around here? Five answers so far and yet not one even hints at a way to get the whole raw on-the-wire request. Yes, I know I can capture the output streams and the headers and the URL and all that stuff from the request object. I already said that in the question, see: I can re-constitute what I believe the request looks like by inspecting all the properties of the HttpRequest object and building a string from them (and similarly for the response) but I'd really like to get hold of the actual request/response data that's sent on the wire. If you know the complete raw data (including headers, url, http method, etc.) simply cannot be retrieved then that would be useful to know. Similarly if you know how to get it all in the raw format (yes, I still mean including headers, url, http method, etc.) without having to reconstruct it, which is what I asked, then that would be very useful. But telling me that I can reconstruct it from the HttpRequest/HttpResponse objects is not useful. I know that. I already said it. Please note: Before anybody starts saying this is a bad idea, or will limit scalability, etc., we'll also be implementing throttling, sequential delivery, and anti-replay mechanisms in a distributed environment, so database logging is required anyway. I'm not looking for a discussion of whether this is a good idea, I'm looking for how it can be done.

    Read the article

  • Override variables while testing a standalone Perl script

    - by BrianH
    There is a Perl script in our environment that I now need to maintain. It is full of bad practices, including using (and re-using) global variables throughout the script. Before I start making changes to the script, I was going to try to write some test scripts so I can have a good regression base. To do this, I was going to use a method described on this page. I was starting by writing tests for a single subroutine. I put this line somewhat near the top of the script I am testing: return 1 if ( caller() ); That way, in my test script, I can require 'script_to_test.pl'; and it won't execute the whole script. The first subroutine I was going to test makes a lot of use of global variables that are set throughout the script. My thought was to try to override these variables in my test script, something like this: require_ok('script_to_test.pl'); $var_from_other_script = 'Override Value'; ok( sub_from_other_script() ); Unfortunately (for me), the script I am testing has a massive "my" block at the top, where it declares all variables used in the script. This prevents my test script from seeing/changing the variables in the script I'm running tests against. I've played with Exporter, Test::Mock..., and some other modules, but it looks like if I want to be able to change any variables I am going to have to modify the other script in some fashion. My goal is to not change the other script, but to get some good tests running so when I do start changing the other script, I can make sure I didn't break anything. The script is about 10,000 lines (3,000 of them in the main block), so I'm afraid that if I start changing things, I will affect other parts of the code, so having a good test suite would help. Is this possible? Can a calling script modify variables in another script declared with "my"? And please don't jump in with answers like, "Just re-write the script from scratch", etc. That may be the best solution, but it doesn't answer my question, and we don't have the time/resources for a re-write.

    Read the article

  • How can I create specialized builders for semantic layout in rails?

    - by Paul Alexander
    This is how I'd like to write markup in say index.html.erb <%= page_for "Super Cool Page" do |p| %> <%= p.header do %> Ruby is Cool <% end %> <%= p.body do %> Witty discourse on Ruby. <% end %> <% if page.has_sidebar? %> <%= p.sidebar do %> <ul><li>Option 1</li></ul> <% end %> <% end %> <% end %> Which would output <div class="page"> <header><h1>Super Cool Page</h1></header> <section> Witty discourse on Ruby. </section> </div> and when page.has_sidebar? is true <div class="page"> <header><h1>Super Cool Page</h1></header> <asside><ul><li>Option 1</li></ul></asside> <section> Witty discourse on Ruby. </section> </div> I've taken a look at the FormHelper class in rails for guidance, but it seems like I'd have to duplicate a lot of work which I'm trying to avoid. I'm really just trying to figure out where to hang the classes/modules/methods in the framework and whit kind of object |p| should be. My first inclination was to create a PageBuilder class that implements header, body and sidebar methods. But I got stuck on the rendering pipeline to get everything output just right. Is there a gem that already provides this type of semantic generation? If not I'd love any insight on how to set this up.

    Read the article

  • executing a script from maven inside a multi module project

    - by Roman
    Hi everyone. I have this multi-module project. In the beginning of each build I would like to run some bat file. So i did the following: <profile> <id>deploy-db</id> <build> <plugins> <plugin> <groupId>org.codehaus.mojo</groupId> <artifactId>exec-maven-plugin</artifactId> <version>1.1.1</version> </plugin> </plugins> <pluginManagement> <plugins> <plugin> <groupId>org.codehaus.mojo</groupId> <artifactId>exec-maven-plugin</artifactId> <version>1.1.1</version> <executions> <execution> <phase>validate</phase> <goals> <goal>exec</goal> </goals> <inherited>false</inherited> </execution> </executions> <configuration> <executable>../database/schemas/import_databases.bat</executable> </configuration> </plugin> </plugins> </pluginManagement> </build> </profile> when i run the mvn verify -Pdeploy-db from the root I get this script executed over and over again in each of my modules. I want it to be executed only once, in the root module. What is there that I am missing ? Thanks

    Read the article

  • ASP.net Repeater Control Problem (nothing outputted)

    - by Phil
    I have the following db code in my usercontrol (content.ascx.vb): If did = 0 Then s = "select etc (statement works on server)" x = New SqlCommand(s, c) x.Parameters.Add("@contentid", Data.SqlDbType.Int) x.Parameters("@contentid").Value = contentid c.Open() r = x.ExecuteReader If r.HasRows Then Contactinforepeater.DataSource = r End If c.Close() r.Close() Else s = "select etc (statement works on server)" x = New SqlCommand(s, c) x.Parameters.Add("@contentid", SqlDbType.Int) x.Parameters("@contentid").Value = contentid x.Parameters.Add("@did", SqlDbType.Int) x.Parameters("@did").Value = did c.Open() r = x.ExecuteReader If r.HasRows Then Contactinforepeater.DataSource = r c.Close() r.Close() End If End If Then I have the following repeater control markup in my usercontrol (content.ascx): <asp:Repeater ID="Contactinforepeater" runat="server"> <HeaderTemplate> <h1>Contact Information</h1> </HeaderTemplate> <ItemTemplate> <table width="50%"> <tr> <td colspan="2"><%#Container.DataItem("position")%></td> </tr> <tr> <td>Name:</td> <td><%#Container.DataItem("surname")%></td> </tr> <tr> <td>Telephone:</td> <td><%#Container.DataItem("telephone")%></td> </tr> <tr> <td>Fax:</td> <td><%#Container.DataItem("fax")%></td> </tr> <tr> <td>Email:</td> <td><%#Container.DataItem("email")%></td> </tr> </table> </ItemTemplate> <SeparatorTemplate><br /><hr /><br /></SeparatorTemplate> </asp:Repeater> When I insert this usercontrol into default.aspx with this code: <%@ Register src="Modules/Content.ascx" tagname="Content" tagprefix="uc1" %> and <form id="form1" runat="server"> <div> <uc1:Content ID="Content" runat="server" /> </div> </form> I do not get any error messages but the expected content from the database is not displayed. Can someone please show me the syntax to get this working or point out where I am going wrong? Thanks in advance!

    Read the article

  • How to make freelance clients understand the costs of developing and maintaining mature products?

    - by John
    I have a freelance web application project where the client requests new features every two weeks or so. I am unable to anticipate the requirements of upcoming features. So when the client requests a new feature, one of several things may happen: I implement the feature with ease because it is compatible with the existing platform I implement the feature with difficulty because I have to rewrite a significant portion of the platform's foundation Client withdraws request because it costs too much to implement against existing platform At the beginning of the project, for about six months, all feature requests fell under category 1) because the system was small and agile. But for the past six months, most feature implementation fell under category 2). The system is mature, forcing me to refactor and test everytime I want to add new modules. Additionally, I find myself breaking things that use to work, and fixing it (I don't get paid for this). The client is starting to express frustration at the time and cost for me to implement new features. To them, many of the feature requests are of the same scale as the features they requested six months ago. For example, a client would ask, "If it took you 1 week to build a ticketing system last year, why does it take you 1 month to build an event registration system today? An event registration system is much simpler than a ticketing system. It should only take you 1 week!" Because of this scenario, I fear feature requests will soon land in category 3). In fact, I'm already eating a lot of the cost myself because I volunteer many hours to support the project. The client is often shocked when I tell him honestly the time it takes to do something. The client always compares my estimates against the early months of a project. I don't think they're prepared for what it really costs to develop, maintain and support a mature web application. When working on a salary for a full time company, managers were more receptive of my estimates and even encouraged me to pad my numbers to prepare for the unexpected. Is there a way to condition my clients to think the same way? Can anyone offer advice on how I can continue to work on this web project without eating too much of the cost myself? Additional info - I've only been freelancing full time for 1 year. I don't yet have the high end clients, but I'm slowly getting there. I'm getting better quality clients as time goes by.

    Read the article

  • Optimizing tasks to reduce CPU in a trading application

    - by Joel
    Hello, I have designed a trading application that handles customers stocks investment portfolio. I am using two datastore kinds: Stocks - Contains unique stock name and its daily percent change. UserTransactions - Contains information regarding a specific purchase of a stock made by a user : the value of the purchase along with a reference to Stock for the current purchase. db.Model python modules: class Stocks (db.Model): stockname = db.StringProperty(multiline=True) dailyPercentChange=db.FloatProperty(default=1.0) class UserTransactions (db.Model): buyer = db.UserProperty() value=db.FloatProperty() stockref = db.ReferenceProperty(Stocks) Once an hour I need to update the database: update the daily percent change in Stocks and then update the value of all entities in UserTransactions that refer to that stock. The following python module iterates over all the stocks, update the dailyPercentChange property, and invoke a task to go over all UserTransactions entities which refer to the stock and update their value: Stocks.py # Iterate over all stocks in datastore for stock in Stocks.all(): # update daily percent change in datastore db.run_in_transaction(updateStockTxn, stock.key()) # create a task to update all user transactions entities referring to this stock taskqueue.add(url='/task', params={'stock_key': str(stock.key(), 'value' : self.request.get ('some_val_for_stock') }) def updateStockTxn(stock_key): #fetch the stock again - necessary to avoid concurrency updates stock = db.get(stock_key) stock.dailyPercentChange= data.get('some_val_for_stock') # I get this value from outside ... some more calculations here ... stock.put() Task.py (/task) # Amount of transaction per task amountPerCall=10 stock=db.get(self.request.get("stock_key")) # Get all user transactions which point to current stock user_transaction_query=stock.usertransactions_set cursor=self.request.get("cursor") if cursor: user_transaction_query.with_cursor(cursor) # Spawn another task if more than 10 transactions are in datastore transactions = user_transaction_query.fetch(amountPerCall) if len(transactions)==amountPerCall: taskqueue.add(url='/task', params={'stock_key': str(stock.key(), 'value' : self.request.get ('some_val_for_stock'), 'cursor': user_transaction_query.cursor() }) # Iterate over all transaction pointing to stock and update their value for transaction in transactions: db.run_in_transaction(updateUserTransactionTxn, transaction.key()) def updateUserTransactionTxn(transaction_key): #fetch the transaction again - necessary to avoid concurrency updates transaction = db.get(transaction_key) transaction.value= transaction.value* self.request.get ('some_val_for_stock') db.put(transaction) The problem: Currently the system works great, but the problem is that it is not scaling well… I have around 100 Stocks with 300 User Transactions, and I run the update every hour. In the dashboard, I see that the task.py takes around 65% of the CPU (Stock.py takes around 20%-30%) and I am using almost all of the 6.5 free CPU hours given to me by app engine. I have no problem to enable billing and pay for additional CPU, but the problem is the scaling of the system… Using 6.5 CPU hours for 100 stocks is very poor. I was wondering, given the requirements of the system as mentioned above, if there is a better and more efficient implementation (or just a small change that can help with the current implemntation) than the one presented here. Thanks!! Joel

    Read the article

  • How to load a springframework ApplicationContext from Jython

    - by staticman
    I have a class that loads a springframework application context like so: package com.offlinesupport; import org.springframework.context.ApplicationContext; import org.springframework.context.support.ClassPathXmlApplicationContext; public class OfflineScriptSupport { private static ApplicationContext appCtx; public static final void initialize() { appCtx = new ClassPathXmlApplicationContext( new String[] { "mycontext.spring.xml" } ); } public static final ApplicationContext getApplicationContext() { return appCtx; } public static final void main( String[] args ) { System.out.println( "Starting..." ); initialize(); System.out.println( "loaded" ); } } The class OfflineScriptSupport, and the file mycontext.spring.xml are each deployed into separate jars (along with other classes and resources in their respective modules). Lets say the jar files are OfflineScriptSupport.jar and *MyContext.jar". mycontext.spring.xml is put at the root of the jar. In a Jython script (*myscript.jy"), I try to call the initialize method to create the application context: from com.offlinesupport import OfflineScriptSupport OfflineScriptSupport.initialize(); I execute the Jython script with the following command (from Linux): jython -Dpython.path=spring.jar:OfflineScriptSupport.jar:MyContext.jar myscript.jy The Springframework application context cannot find the mycontext.spring.xml file. It displays the following error: java.io.FileNotFoundException: class path resource [mycontext.spring.xml] cannot be opened because it does not exist at org.springframework.core.io.ClassPathResource.getInputStream(ClassPathResource.java:137) at org.springframework.beans.factory.xml.XmlBeanDefinitionReader.loadBeanDefinitions(XmlBeanDefinitionReader.java:167) at org.springframework.beans.factory.xml.XmlBeanDefinitionReader.loadBeanDefinitions(XmlBeanDefinitionReader.java:148) at org.springframework.beans.factory.support.AbstractBeanDefinitionReader.loadBeanDefinitions(AbstractBeanDefinitionReader.java:126) at org.springframework.beans.factory.support.AbstractBeanDefinitionReader.loadBeanDefinitions(AbstractBeanDefinitionReader.java:142) at org.springframework.context.support.AbstractXmlApplicationContext.loadBeanDefinitions(AbstractXmlApplicationContext.java:113) at org.springframework.context.support.AbstractXmlApplicationContext.loadBeanDefinitions(AbstractXmlApplicationContext.java:81) at org.springframework.context.support.AbstractRefreshableApplicationContext.refreshBeanFactory(AbstractRefreshableApplicationContext.java:89) at org.springframework.context.support.AbstractApplicationContext.refresh(AbstractApplicationContext.java:269) at org.springframework.context.support.ClassPathXmlApplicationContext.<init>(ClassPathXmlApplicationContext.java:87) at org.springframework.context.support.ClassPathXmlApplicationContext.<init>(ClassPathXmlApplicationContext.java:72) at com.offlinesupport.OfflineScriptSupport.initialize(OfflineScriptSupport.java:27) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) If I run the jar directly from Java (using the main entry point in OfflineScriptSupport) it works and there is no error thrown. Is there something special about the way Jython handles classpaths making the Springframework's ClassPathXmlApplicationContext not work (i.e. not be able to find resource files in the classpath)?

    Read the article

  • symfony/zend integration - blank screen

    - by user142176
    Hi, I need to use ZendAMF on a symfony project and I'm currently working on integrating the two. I have a frontend app with two modules, one of which is 'gateway' - the AMF gateway. In my frontend app config, I have the following in the configure function: // load symfony autoloading first parent::initialize(); // Integrate Zend Framework require_once('[MY PATH TO ZEND]\Loader.php'); spl_autoload_register(array('Zend_Loader', 'autoload')); The executeIndex function my the gateway actions.class.php looks like this // No Layout $this->setLayout(false); // Set MIME Type $this->getResponse()->setContentType('application/x-amf; charset='.sfConfig::get('sf_charset')); // Disable cause this is a non-html page sfConfig::set('sf_web_debug', false); // Create AMF Server $server = new Zend_Amf_Server(); $server->setClass('MYCLASS'); echo $server->handle(); return sfView::NONE; Now when I try to visit the url for the gateway module, or even the other module which was working perfectly fine until this attempt, I only see a blank screen, with not even the symfony dev bar loaded. Oddly enough, my symfony logs are not being updated as well, which suggests that Synfony is not even being 'reached'. So presumably the error has something to do with Zend, but I have no idea how to figure out what the error could be. One thing I do know for sure is that this is not a file path error, because if I change the path in the following line (a part of frontendConfiguration as shown above), I get a Zend_Amf_Server not found error. So the path must be correct. Also if I comment out this very same line, the second module resumes to normality, and my gateway broadcasts a blank x-amf stream. spl_autoload_register(array('Zend_Loader', 'autoload')); Does anyone have any tips on how I could attach this problem? Thanks P.S. I'm currently running an older version of Zend, which is why I am using Zend_Loader instead of Zend_autoLoader (I think). But I've tried switching to the new lib, but the error still remains. So it's not a version problem as well.

    Read the article

  • [Hibernate Mapping] relationship set between table and mapping table to use joins.

    - by Matthew De'Loughry
    Hi guys, I have two table a "Module" table and a "StaffModule" I'm wanting to display a list of modules by which staff are present on the staffmodule mapping table. I've tried from Module join Staffmodule sm with ID = sm.MID with no luck, I get the following error Path Expected for join! however I thought I had the correct join too allow this but obviously not can any one help StaffModule HBM <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE hibernate-mapping PUBLIC "-//Hibernate/Hibernate Mapping DTD 3.0//EN" "http://hibernate.sourceforge.net/hibernate-mapping-3.0.dtd"> <!-- Generated Apr 26, 2010 9:50:23 AM by Hibernate Tools 3.2.1.GA --> <hibernate-mapping> <class name="Hibernate.Staffmodule" schema="WALK" table="STAFFMODULE"> <composite-id class="Hibernate.StaffmoduleId" name="id"> <key-many-to-one name="mid" class="Hibernate.Module"> <column name="MID"/> </key-many-to-one> <key-property name="staffid" type="int"> <column name="STAFFID"/> </key-property> </composite-id> </class> </hibernate-mapping> and Module.HBM <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE hibernate-mapping PUBLIC "-//Hibernate/Hibernate Mapping DTD 3.0//EN" "http://hibernate.sourceforge.net/hibernate-mapping-3.0.dtd"> <!-- Generated Apr 26, 2010 9:50:23 AM by Hibernate Tools 3.2.1.GA --> <hibernate-mapping> <class name="Hibernate.Module" schema="WALK" table="MODULE"> <id name="id" type="int"> <column name="ID"/> <generator class="assigned"/> </id> <property name="modulename" type="string"> <column length="50" name="MODULENAME"/> </property> <property name="teacherid" type="int"> <column name="TEACHERID" not-null="true"/> </property> </class> hope thats enough information! and thanks in advance.

    Read the article

  • ASP.net Repeater Control Problem (nothing outputted from datasource(sqldatareader))

    - by Phil
    I have the following code to get the repeaters' data in my usercontrol (content.ascx.vb): If did = 0 Then s = "select etc (statement works on server)" x = New SqlCommand(s, c) x.Parameters.Add("@contentid", Data.SqlDbType.Int) x.Parameters("@contentid").Value = contentid c.Open() r = x.ExecuteReader If r.HasRows Then Contactinforepeater.DataSource = r End If c.Close() r.Close() Else s = "select etc (statement works on server)" x = New SqlCommand(s, c) x.Parameters.Add("@contentid", SqlDbType.Int) x.Parameters("@contentid").Value = contentid x.Parameters.Add("@did", SqlDbType.Int) x.Parameters("@did").Value = did c.Open() r = x.ExecuteReader If r.HasRows Then Contactinforepeater.DataSource = r c.Close() r.Close() End If End If Then I have the following repeater control markup in my usercontrol (content.ascx): <asp:Repeater ID="Contactinforepeater" runat="server"> <HeaderTemplate> <h1>Contact Information</h1> </HeaderTemplate> <ItemTemplate> <table width="50%"> <tr> <td colspan="2"><%#Container.DataItem("position")%></td> </tr> <tr> <td>Name:</td> <td><%#Container.DataItem("surname")%></td> </tr> <tr> <td>Telephone:</td> <td><%#Container.DataItem("telephone")%></td> </tr> <tr> <td>Fax:</td> <td><%#Container.DataItem("fax")%></td> </tr> <tr> <td>Email:</td> <td><%#Container.DataItem("email")%></td> </tr> </table> </ItemTemplate> <SeparatorTemplate><br /><hr /><br /></SeparatorTemplate> </asp:Repeater> When I insert this usercontrol into default.aspx with this code: <%@ Register src="Modules/Content.ascx" tagname="Content" tagprefix="uc1" %> and <form id="form1" runat="server"> <div> <uc1:Content ID="Content" runat="server" /> </div> </form> I do not get any error messages but the expected content from the database is not displayed. Can someone please show me the syntax to get this working or point out where I am going wrong? Thanks in advance!

    Read the article

  • Question about DBD::CSB Statement-Functions

    - by sid_com
    From the SQL::Statement::Functions documentation: Function syntax When using SQL::Statement/SQL::Parser directly to parse SQL, functions (either built-in or user-defined) may occur anywhere in a SQL statement that values, column names, table names, or predicates may occur. When using the modules through a DBD or in any other context in which the SQL is both parsed and executed, functions can occur in the same places except that they can not occur in the column selection clause of a SELECT statement that contains a FROM clause. # valid for both parsing and executing SELECT MyFunc(args); SELECT * FROM MyFunc(args); SELECT * FROM x WHERE MyFuncs(args); SELECT * FROM x WHERE y < MyFuncs(args); # valid only for parsing (won't work from a DBD) SELECT MyFunc(args) FROM x WHERE y; Reading this I would expect that the first SELECT-statement of my example shouldn't work and the second should but it is quite the contrary. #!/usr/bin/env perl use warnings; use strict; use 5.010; use DBI; open my $fh, '>', 'test.csv' or die $!; say $fh "id,name"; say $fh "1,Brown"; say $fh "2,Smith"; say $fh "7,Smith"; say $fh "8,Green"; close $fh; my $dbh = DBI->connect ( 'dbi:CSV:', undef, undef, { RaiseError => 1, f_ext => '.csv', }); my $table = 'test'; say "\nSELECT 1"; my $sth = $dbh->prepare ( "SELECT MAX( id ) FROM $table WHERE name LIKE 'Smith'" ); $sth->execute (); $sth->dump_results(); say "\nSELECT 2"; $sth = $dbh->prepare ( "SELECT * FROM $table WHERE id = MAX( id )" ); $sth->execute (); $sth->dump_results(); outputs: SELECT 1 '7' 1 rows SELECT 2 Unknown function 'MAX' at /usr/lib/perl5/site_perl/5.10.0/SQL/Parser.pm line 2893. DBD::CSV::db prepare failed: Unknown function 'MAX' at /usr/lib/perl5/site_perl/5.10.0/SQL/Parser.pm line 2894. [for Statement "SELECT * FROM test WHERE id = MAX( id )"] at ./so_3.pl line 30. DBD::CSV::db prepare failed: Unknown function 'MAX' at /usr/lib/perl5/site_perl/5.10.0/SQL/Parser.pm line 2894. [for Statement "SELECT * FROM test WHERE id = MAX( id )"] at ./so_3.pl line 30. Could someone explaine me this behavior?

    Read the article

  • How do you clear RootLayoutPanel in GWT?

    - by kerrr
    I have Buttons attached to elements on the modules entrypoint html page using RootPanel.get("foo").add(button). If I subsequently create a LayoutPanel and attach it using RootLayoutPanel.get.add(layoutpanal) then the buttons cannot be clicked. This is all fine. If I then try and remove the layoutpanel or clear the RootLayoutPanel the buttons still cannot be clicked. Any ideas how to clear this? Have I missed a step or should you simply never try and get back to using a page's RootPanel if you have used a RootLayoutPanel? Sample code: public void onModuleLoad(){ final LayoutPanel lp1=new LayoutPanel(); ClickPanel ping=new ClickPanel("Ping"); ping.getElement().getStyle().setBackgroundColor( "#fdd" ); ping.addClickHandler( new ClickHandler(){ @Override public void onClick( ClickEvent event ){ Window.alert( "Ping!!!" ); //lp1.removeFromParent(); //RootLayoutPanel.get().remove(lp1); //RootLayoutPanel.get().removeFromParent(); RootLayoutPanel.get().clear(); } } ); ClickPanel bong=new ClickPanel("Bong"); bong.getElement().getStyle().setBackgroundColor( "#ddf" ); bong.addClickHandler( new ClickHandler(){ @Override public void onClick( ClickEvent event ){ Window.alert( "Bong!!!" ); } } ); lp1.add( ping ); lp1.setWidgetLeftWidth( ping, 100, Style.Unit.PX, 500, Style.Unit.PX ); lp1.setWidgetTopHeight( ping, 100, Style.Unit.PX, 500, Style.Unit.PX ); lp1.add( bong ); lp1.setWidgetLeftWidth( bong, 50, Style.Unit.PCT, 600, Style.Unit.PX ); lp1.setWidgetTopHeight( bong, 50, Style.Unit.PCT, 200, Style.Unit.PX ); Button b=new Button("Click Me"); b.addClickHandler( new ClickHandler(){ @Override public void onClick( ClickEvent event ){ RootLayoutPanel.get().add( lp1 ); } } ); RootPanel.get("button1").add( b ); } ClickPanel is simply overrides HTMLPanel implementing HasClickHandelers. Clicking "Click Me" opens the layout panel. Clicking the panel ping gets rid of the layout panel, but the button "Click Me" cannot be clicked. I've tried various options.

    Read the article

  • Using PHP session_id() to Make Sure iframe is Generated by Our Server Dynamically

    - by Michael Robinson
    We use iframes to show ads on our site. Iframes are used to allow us to keep the ad generation code and other site modules separate. As we track ad views on our site, and need to be able to keep an accurate count of which pagetype gets what views, I must ensure that users can't simply copy-paste the iframe in which the ad is loaded onto another site. This would cause ad count to become inflated for this page, and the count would not match the view count of the page the iframe "should" be displayed in. Before anyone says so: no I can't simply compare the page view count with the ad view count, or use the page view count * number of ads per page, as # of ads per page will not necessarily be static. I need to come up with a solution that will allow ads to be shown only for iframes that are generated dynamically and are shown on our pages. I am not familiar with PHP sessions, but from what little reading I have had time to do, the following seems to be to be an acceptable solution: Add "s = session_id()" to the src of the ad's iframe. In the code that receives and processes ad requests, only return (and count) and ad if s == session_id(). Please correct me if I'm wrong, but this would ensure: Ads would only be returned to iframes whose src was generated alongside the rest of the page's content, as is the case during normal use. We can return our logo to ad calls with an invalid session_id. So a simple example would be: One of our pages: <?php session_start(); ?> <div id="someElement"> <!-- EVERYONE LOVES ADS --> <iframe src="http//awesomesite.com/ad/can_has_ad.php?s=<?php echo session_id(); ?>></iframe> </div> ad/can_has_ad.php: <?php session_start(); ?> if($_GET['s'] == session_id()){ echo 'can has ad'; } else{ echo '<img src="http://awesomesite.com/images/canhaslogo.jpg"/>'; } And finally, copied code with static 's' parameter: <!-- HAHA LULZ I WILL SCREW WITH YOUR AD VIEW COUNTS LULZ HAHA --> <iframe src="http//awesomesite.com/ad/can_has_ad.php?s=77f2b5fcdab52f52607888746969b0ad></iframe> Which would give them an iframe showing our awesome site's logo, and not screw with our view counts. I made some basic test cases: two files, one that generates the iframe and echos it, and one that the iframe's src is pointed to, that checks the 's' parameter and shows an appropriate message depending on the result. I copied the iframe into a file and hosted it on a different server, and the correct message was displayed (cannot has ad). So, my question is: Would this work or am I being a PHP session noob, with the above test being a total fluke? Thanks for your time! Edit: I'm trying to solve this without touching the SQL server

    Read the article

  • How do I delete a [sub]hash based off of the keys/values of another hash?

    - by Zack
    Lets assume I have two hashes. One of them contains a set of data that only needs to keep things that show up in the other hash. e.g. my %hash1 = ( test1 => { inner1 => { more => "alpha", evenmore => "beta" } }, test2 => { inner2 => { more => "charlie", somethingelse => "delta" } }, test3 => { inner9999 => { ohlookmore => "golf", somethingelse => "foxtrot" } } ); my %hash2 = ( major=> { test2 => "inner2", test3 => "inner3" } ); What I would like to do, is to delete the whole subhash in hash1 if it does not exist as a key/value in hash2{major}, preferably without modules. The information contained in "innerX" does not matter, it merely must be left alone (unless the subhash is to be deleted then it can go away). In the example above after this operation is preformed hash1 would look like: my %hash1 = ( test2 => { inner2 => { more => "charlie", somethingelse => "delta" } }, ); It deletes hash1{test1} and hash1{test3} because they don't match anything in hash2. Here's what I've currently tried, but it doesn't work. Nor is it probably the safest thing to do since I'm looping over the hash while trying to delete from it. However I'm deleting at the each which should be okay? This was my attempt at doing this, however perl complains about: Can't use string ("inner1") as a HASH ref while "strict refs" in use at while(my ($test, $inner) = each %hash1) { if(exists $hash2{major}{$test}{$inner}) { print "$test($inner) is in exists.\n"; } else { print "Looks like $test($inner) does not exist, REMOVING.\n"; #not to sure if $inner is needed to remove the whole entry delete ($hash1{$test}{$inner}); } }

    Read the article

  • Code golf - hex to (raw) binary conversion

    - by Alnitak
    In response to this question asking about hex to (raw) binary conversion, a comment suggested that it could be solved in "5-10 lines of C, or any other language." I'm sure that for (some) scripting languages that could be achieved, and would like to see how. Can we prove that comment true, for C, too? NB: this doesn't mean hex to ASCII binary - specifically the output should be a raw octet stream corresponding to the input ASCII hex. Also, the input parser should skip/ignore white space. edit (by Brian Campbell) May I propose the following rules, for consistency? Feel free to edit or delete these if you don't think these are helpful, but I think that since there has been some discussion of how certain cases should work, some clarification would be helpful. The program must read from stdin and write to stdout (we could also allow reading from and writing to files passed in on the command line, but I can't imagine that would be shorter in any language than stdin and stdout) The program must use only packages included with your base, standard language distribution. In the case of C/C++, this means their respective standard libraries, and not POSIX. The program must compile or run without any special options passed to the compiler or interpreter (so, 'gcc myprog.c' or 'python myprog.py' or 'ruby myprog.rb' are OK, while 'ruby -rscanf myprog.rb' is not allowed; requiring/importing modules counts against your character count). The program should read integer bytes represented by pairs of adjacent hexadecimal digits (upper, lower, or mixed case), optionally separated by whitespace, and write the corresponding bytes to output. Each pair of hexadecimal digits is written with most significant nibble first. The behavior of the program on invalid input (characters besides [a-fA-F \t\r\n], spaces separating the two characters in an individual byte, an odd number of hex digits in the input) is undefined; any behavior (other than actively damaging the user's computer or something) on bad input is acceptable (throwing an error, stopping output, ignoring bad characters, treating a single character as the value of one byte, are all OK) The program may write no additional bytes to output. Code is scored by fewest total bytes in the source file. (Or, if we wanted to be more true to the original challenge, the score would be based on lowest number of lines of code; I would impose an 80 character limit per line in that case, since otherwise you'd get a bunch of ties for 1 line).

    Read the article

  • ASP.NET Application Level vs. Session Level and Global.asax...confused

    - by contactmatt
    The following text is from the book I'm reading, 'MCTS Self-Paced Training Kit (Exam 70-515) Web Applications Development with ASP.NET 4". It gives the rundown of the Application Life Cycle. A user first makes a request for a page in your site. The request is routed to the processing pipeline, which forwards it to the ASP.NET runtime. The ASP.NET runtime creates an instance of the ApplicationManager class; this class instance represents the .NET framework domain that will be used to execute requests for your application. An application domain isolates global variables from other applications and allows each application to load and unload separately, as required. After the application domain has been created, an instance of the HostingEnvironment class is created. This class provides access to items inside the hosting environment, such as directory folders. ASP.NET creates instances of the core objects that will be used to process the request. This includes HttpContext, HttpRequest, and HttpResponse objects. ASP.NET creates an instance of the HttpApplication class (or an instance is reused). This class is also the base class for a site’s Global.asax file. You can use this class to trap events that happen when your application starts or stops. When ASP.NET creates an instance of HttpApplication, it also creates the modules configured for the application, such as the SessionStateModule. Finally, ASP.NET processes request through the HttpApplication pipleline. This pipeline also includes a set of events for validating requests, mapping URLs, accessing the cache, and more. The book then demonstrated an example of using the Global.asax file: <script runat="server"> void Application_Start(object sender, EventArgs e) { Application["UsersOnline"] = 0; } void Session_Start(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] + 1; Application.UnLock(); } void Session_End(object sender, EventArgs e) { Application.Lock(); Application["UsersOnline"] = (int)Application["UsersOnline"] - 1; Application.UnLock(); } </script> When does an application start? Whats the difference between session and application level? I'm rather confused on how this is managed. I thought that Application level classes "sat on top of" an AppDomain object, and the AppDomain contained information specific to that Session for that user. Could someone please explain how IIS manages Applicaiton level classes, and how an HttpApplication class sits under an AppDomain? Anything is appreciated.

    Read the article

  • Using pointers, references, handles to generic datatypes, as generic and flexible as possible

    - by Patrick
    In my application I have lots of different data types, e.g. Car, Bicycle, Person, ... (they're actually other data types, but this is just for the example). Since I also have quite some 'generic' code in my application, and the application was originally written in C, pointers to Car, Bicycle, Person, ... are often passed as void-pointers to these generic modules, together with an identification of the type, like this: Car myCar; ShowNiceDialog ((void *)&myCar, DATATYPE_CAR); The 'ShowNiceDialog' method now uses meta-information (functions that map DATATYPE_CAR to interfaces to get the actual data out of Car) to get information of the car, based on the given data type. That way, the generic logic only has to be written once, and not every time again for every new data type. Of course, in C++ you could make this much easier by using a common root class, like this class RootClass { public: string getName() const = 0; }; class Car : public RootClass { ... }; void ShowNiceDialog (RootClass *root); The problem is that in some cases, we don't want to store the data type in a class, but in a totally different format to save memory. In some cases we have hundreds of millions of instances that we need to manage in the application, and we don't want to make a full class for every instance. Suppose we have a data type with 2 characteristics: A quantity (double, 8 bytes) A boolean (1 byte) Although we only need 9 bytes to store this information, putting it in a class means that we need at least 16 bytes (because of the padding), and with the v-pointer we possibly even need 24 bytes. For hundreds of millions of instances, every byte counts (I have a 64-bit variant of the application and in some cases it needs 6 GB of memory). The void-pointer approach has the advantage that we can almost encode anything in a void-pointer and decide how to use it if we want information from it (use it as a real pointer, as an index, ...), but at the cost of type-safety. Templated solutions don't help since the generic logic forms quite a big part of the application, and we don't want to templatize all this. Additionally, the data model can be extended at run time, which also means that templates won't help. Are there better (and type-safer) ways to handle this than a void-pointer? Any references to frameworks, whitepapers, research material regarding this?

    Read the article

  • Myself throwing NullReferenceException... needs help

    - by Amit Ranjan
    I know it might be a weird question and its Title too, but i need your help. I am a .net dev , working on platform for the last 1.5 years. I am bit confused on the term usually we say " A Good Programmer ". I dont know ,what are the qualities of a good programmer ? Is the guy who writes a bug free code? or Can develop applications solely? or blah blah blah...lots of points. I dont know... But as far i am concerned , I know I am not a good programmer, still in learning phase an needs a lot to learn in coming days. So you guys are requested to please help me with this two problems of mine My first problem is regarding the proper Error Handling, which is a most debatable aspect of programming. We all know we use ` try { } catch { } finally { } ` in our code to manage exception. But even if I use try { } catch(exception ex) { throw ex } finally { } , different guys have different views. I still dont know the good way to handle errors. I can write code, use try-catch but still i feel I lacks something. When I saw the codes generated by .net fx tools even they uses throw ex or `throw new Exception("this is my exception")`.. I am just wondering what will be the best way to achieve the above. All means the same thing but why we avoid something. If it has some demerits then it must be made obselete.Anyways I still dont have one [how to handle errors efficiently?]. I generally follow the try-catch(execoption ex){throw ex}, and usually got stucked in debates with leads why you follow this why not that... 2.Converting your entire code blocks in modules using Design patterns of some OOPs concepts. How do you guys decide what architeture or pattern will be the best for my upcoming application based on its working, flow etc. I need to know what you guys can see that I can't. Since I know , I dont have that much experience but I can say, with my experience that experience doesnot comes either from degree/certificates or success you made instead it cames from failures you faced or got stucking situations. Pleas help me out.

    Read the article

  • Newbie - what do I need to do with httpd.conf to make CakePHP work correctly?

    - by EmmyS
    (Not sure if this belongs here or on webmasters; please move if necessary.) I'm a total newbie to Cake and not much better with apache; I've done a lot of PHP but always with a server that's already been set up by someone else. So I'm going through the basic blog tutorial, and it says: A Note On mod_rewrite Occasionally a new user will run in to mod_rewrite issues, so I'll mention them marginally here. If the Cake welcome page looks a little funny (no images or css styles), it probably means mod_rewrite isn't functioning on your system. Here are some tips to help get you up and running: Make sure that an .htaccess override is allowed: in your httpd.conf, you should have a section that defines a section for each Directory on your server. Make sure the AllowOverride is set to All for the correct Directory. Make sure you are editing the system httpd.conf rather than a user- or site-specific httpd.conf. For some reason or another, you might have obtained a copy of CakePHP without the needed .htaccess files. This sometimes happens because some operating systems treat files that start with '.' as hidden, and don't copy them. Make sure your copy of CakePHP is from the downloads section of the site or our SVN repository. Make sure you are loading up mod_rewrite correctly! You should see something like LoadModule rewrite_module libexec/httpd/mod_rewrite.so and AddModule mod_rewrite.c in your httpd.conf." I'm using XAMPP on linux. I've found my httpd.conf file in opt/lampp/ etc, but am not sure what I need to do with it. I've searched for "rewrite", and there's only one line: LoadModule rewrite_module modules/mod_rewrite.so There's nothing about AddModule mod_rewrite.c. Do I just create a Directory section for the directory I've installed Cake in and set AlllowOverride to All? (I created a separate subdirectory of my wwwroot and installed in there, since I also have installs of Joomla and CodeIgniter.) Is there anything else I need to do? My download of Cake did come with two htaccess-type files (._.htaccess and .htaccess) - do I need to do anything with them? Thanks for any help you can provide to this non-server-admin. EDIT TO ADD virtual host sample: <VirtualHost *:80> ServerAdmin [email protected] DocumentRoot /www/docs/dummy-host.example.com ServerName dummy-host.example.com ServerAlias www.dummy-host.example.com ErrorLog logs/dummy-host.example.com-error_log CustomLog logs/dummy-host.example.com-access_log common </VirtualHost>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • App losing db connection

    - by DaveKub
    I'm having a weird issue with an old Delphi app losing it's database connection. Actually, I think it's losing something else that then makes the connection either drop or be unusable. The app is written in Delphi 6 and uses the Direct Oracle Access component (v4.0.7.1) to connect to an Oracle 9i database. The app runs as a service and periodically queries the db using a TOracleQuery object (qryAlarmList). The method that is called to do this looks like this: procedure TdmMain.RefreshAlarmList; begin try qryAlarmList.Execute; except on E: Exception do begin FStatus := ssError; EventLog.LogError(-1, 'TdmMain.RefreshAlarmList', 'Message: ' + E.Message); end; end; end; It had been running fine for years, until a couple of Perl scripts were added to this machine. These scripts run every 15 minutes and look for datafiles to import into the db, and then they do a some calculations and a bunch of reads/writes to/from the db. For some reason, when they are processing large amounts of data, and then the Delphi app tries to query the db, the Delphi app throws an exception at the "qryAlarmList.Execute" line in the above code listing. The exception is always: Access violation at address 00000000. read of address 00000000 HOW can something that the Perl scripts are doing cause this?? There are other Perl scripts on this machine that load data using the same modules and method calls and we didn't have problems. To make it even weirder, there are two other apps that will also suddenly lose their ability to talk to the database at the same time as the Perl stuff is running. Neither of those apps run on this machine, but both are Delphi 6 apps that use the same DOA component to connect to the same database. We have other apps that connect to the same db, written in Java or C# and they don't seem to have any problems. I've tried adding code before the '.Execute' method is called to: check the session's connection (session.CheckConnection(true); always comes back as 'ccOK'). see whether I can access a field of the qryAlarmList object to see if maybe it's become null; can access it fine. check the state of the qryAlarmList; always says it's qsIdle. Does anyone have any suggestions of something to try? This is driving me nuts! Dave

    Read the article

< Previous Page | 524 525 526 527 528 529 530 531 532 533 534 535  | Next Page >