Search Results

Search found 36132 results on 1446 pages for 'line height'.

Page 531/1446 | < Previous Page | 527 528 529 530 531 532 533 534 535 536 537 538  | Next Page >

  • .NET 2d library for circuit diagrams

    - by Dinah
    I want to draw and manipulate logic flow (as opposed to analog) circuit diagrams and I'm trying not to reinvent the wheel. Problems like positioning, line drawing, line crossing and connecting, path finding, rubberband lines, and drag & drop are also identical in flow charts, UML diagrams, or class diagrams so I started by viewing related topics via Google and Stack Overflow. However, the following requirements seemed to keep me from finding anything that quite fit: assuming a chip has an image with input and output stubs, the connecting lines would connect to the chip only in the exact spots of the I/O stubs the color of connecting lines are able to be set as per a chip's output Is there an existing .NET 2d graphics library that would be suitable for drawing circuit diagrams?

    Read the article

  • Modules in Flex

    - by theband
    <?xml version="1.0"?> <!-- This module loads an image. --> <mx:Module width="100%" height="100%" xmlns:mx="http://www.adobe.com/2006/mxml"> <mx:Image source="trinity.gif"/> </mx:Module> I have such 10 modules. Is there any Method in Module Class where i can hide and show based on user login.

    Read the article

  • WPF ControlTemplate and Binding

    - by Vinjamuri
    In the below code, MousePressImage is a dependency property of class ButtonControl. The following Binding doesn't work.. Appreciate your help in solving this issue.. Value="{Binding RelativeSource={x:Static RelativeSource.Self}, Path=MousePressImage}"/> -- I create the ButtonControl like this. <local:ButtonControl Height="48" Width="160" MouseOverImage="pack://application:,,,/Recipe_06_13;component/Resources/Over.bmp" MousePressImage="pack://application:,,,/Recipe_06_13;component/Resources/Press.bmp" DisableImage=" "> </local:ButtonControl>

    Read the article

  • i want to show a panel just like facebook or for captcha validation

    - by Lokesh
    i have a simple form and when user enters all the information and hits the submit botton than a panel should open just a width of 200px and height of 100px inside the same window. which should have two fields one is captcha image and a text box and a check botton and if captcha code is right than panel should automatically close and redirect to another page just like facebook . all the details of the panel is saved on another php file.

    Read the article

  • Running OpenMPI on Windows XP

    - by iamweird
    Hi there. I'm trying to build a simple cluster based on Windows XP. I compiled OpenMPI-1.4.2 successfully, and tools like mpicc and ompi_info work too, but I can't get my mpirun working properly. The only output I can see is Z:\orterun --hostfile z:\hosts.txt -np 2 hostname [host0:04728] Failed to initialize COM library. Error code = -2147417850 [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\mca\ess\hnp\ess_hnp_module.c at line 218 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_plm_init failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\runtime\orte_init.c at line 132 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_ess_set_name failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\..\..\openmpi -1.4.2\orte\tools\orterun\orterun.c at line 543 Where z:\hosts.txt appears as follows: host0 host1 Z: is a shared network drive available to both host0 and host1. What my problem is and how do I fix it? Upd: Ok, this problem seems to be fixed. It seems to me that WideCap driver and/or software components causes this error to appear. A "clean" machine runs local task successfully. Anyway, I still cannot run a task within at least 2 machines, I'm getting following message: Z:\mpirun --hostfile z:\hosts.txt -np 2 hostname connecting to host1 username:cluster password:******** Save Credential?(Y/N) y [host0:04728] This feature hasn't been implemented yet. [host0:04728] Could not connect to namespace cimv2 on node host1. Error code =-2147024891 -------------------------------------------------------------------------- mpirun was unable to start the specified application as it encountered an error. More information may be available above. -------------------------------------------------------------------------- I googled a little and did all the things as described here: http://www.open-mpi.org/community/lists/users/2010/03/12355.php but I'm still getting the same error. Can anyone help me? Upd2: Error code -2147024891 might be WMI error WBEM_E_INVALID_PARAMETER (0x80041008) which occures when one of the parameters passed to the WMI call is not correct. Does this mean that the problem is in OpenMPI source code itself? Or maybe it's because of wrong/outdated wincred.h and credui.lib I used while building OpenMPI from the source code?

    Read the article

  • Problem with img path in Linux

    - by simple
    I am facing an issue while uploading a formatted text/html to the db, things work fine under the WAMP but when doing in LAMP I an having the backslash added to the quotes string(114) "<p> <img alt=\"\" src=\"/ckfinder/userfiles/images/aboutkg.jpg\" style=\"width: 607px; height: 221px;\" /></p> " I am using a Zend_Form and ckeditor. And I am pretty sure I am missing something simple m what is it?

    Read the article

  • javascript problem in IE8

    - by Pankaj
    This code is not working on IE8 window.open(url, "find_users", "resizable=yes,scrollbars=yes,menubar=no,toolbar=no,location=no,status=yes,height=300,width=500"); I am getting Object Expected error in only IE8, its working fine in all other brouser.

    Read the article

  • update a column in input file by taking value from Database in perl.

    - by Rahul Singh
    input file: 1,a,USA,, 2,b,UK,, 3,c,USA,, i want to update the 4th column in the input file from taking values from one of the table. my code looks like this: my $customer_dbh = DBI-connect("DBI:Oracle:$INST", $USER, $PASS ) or die "Couldn't connect to datbase $INST"; my $cust_smh; print "connected \n "; open FILE , "+$input_file" or die "can't open the input file"; print "echo \n"; while(my $line=) { my @line_a=split(/\,/,$line); my $customer_id=$line_a[3]; print "$customer_id\n"; $cust_smh = $customer_dbh-prepare("SELECT phone_no from book where number = $line_a[0]"); $cust_smh-execute() or die "Couldn't execute stmt, error : $DBI::errstr"; my $number = $cust_smh-fetchrow_array(); $line_a[3]=$number; }

    Read the article

  • zeromq installtion on mac os snow leopard

    - by Ashish
    I have installed zeromq 2.1.11 on mac os x using the steps given on http://www.zeromq.org/area:download Then i installed pyzmq (python bindings ) But i get the following error : import zmq Traceback (most recent call last): File "<pyshell#1>", line 1, in <module> import zmq File "/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/zmq/__init__.py", line 35, in <module> from zmq.utils import initthreads # initialize threads ImportError: dlopen(/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/zmq/utils/initthreads.so, 2): no suitable image found. Did find: /Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/zmq/utils/initthreads.so: no matching architecture in universal wrapper

    Read the article

  • How do you draw a string centered vertically in Java?

    - by Paul Alexander
    I know it's a simple concept but I'm struggling with the font metrics. Centering horizontally isn't too hard but vertically seems a bit difficult. I've tried using the FontMetrics getAscent, getLeading, getXXXX methods in various combinations but no matter what I've tried the text is always off by a few pixels. Is there a way to measure the exact height of the text so that it is exactly centered.

    Read the article

  • Win32 C/C++ Load Image from memory buffer

    - by Bruno
    I want to load a image (.bmp) file on a Win32 application, but I do not want to use the standard LoadBitmap/LoadImage from Windows API: I want it to load from a buffer that is already in memory. I can easily load a bitmap directly from file and print it on the screen, but this issue is making me stuck :( What I'm looking for is a function that works like this: HBITMAP LoadBitmapFromBuffer(char* buffer, int width, int height); Thanks.

    Read the article

  • Rails 3 beta 1 - Nested layouts - LocalJumpError

    - by Art Shayderov
    Hi Nested layouts do not work in Rails 3. After I hit this I tried Rails Guides Example on a blank project (both ruby 1.9.1 and 1.8.7). LocalJumpError no block given on line <%= yield :stylesheets %. If you remove this line you will get the same error on the next yield statement. Could someone fix(patch) this? It's probably just a matter of calling block_given? in the right place. That would be great. Thanks Added on 4/3: Rails 3 beta 2 released. Problem fixed.

    Read the article

  • Can I test for the end of the content of a text/plain file with Selenium or javascript?

    - by fool4jesus
    I have a page that results in a text/plain file being displayed in the browser that looks like this: ... Admin Site Administration 2010-04-21 22:26:34 [email protected] Test Site Bob Smith 2010-04-21 22:27:09 [email protected] Admin Site Administration 2010-04-21 22:29:26 [email protected] I am trying to write a Selenium test against this that verifies the last line of the file has "[email protected]" at the end. How would you do this? I can't depend on the date/time as this is a login report that is constantly getting updated - all I want is to ensure that the last line ends with that email address. And I can't figure out how to do it using Selenium expressions, DOM, or XPath.

    Read the article

  • Python Importing object that originates in one module from a different module into a third module

    - by adewinter
    I was reading the sourcode for a python project and came across the following line: from couchexport.export import Format (source: https://github.com/wbnigeria/couchexport/blob/master/couchexport/views.py#L1 ) I went over to couchexport/export.py to see what Format was (Class? Dict? something else?). Unfortunately Format isn't in that file. export.py does however import a Format from couchexport.models where there is a Format class (source: https://github.com/wbnigeria/couchexport/blob/master/couchexport/models.py#L11). When I open up the original file in my IDE and have it look up the declaration, in line I mentioned at the start of this question, it leads directly to models.py. What's going on? How can an import from one file (export.py) actually be an import from another file (models.py) without being explicitly stated?

    Read the article

  • Which is more efficient regular expression?

    - by Vagnerr
    I'm parsing some big log files and have some very simple string matches for example if(m/Some String Pattern/o){ #Do something } It seems simple enough but in fact most of the matches I have could be against the start of the line, but the match would be "longer" for example if(m/^Initial static string that matches Some String Pattern/o){ #Do something } Obviously this is a longer regular expression and so more work to match. However I can use the start of line anchor which would allow an expression to be discarded as a failed match sooner. It is my hunch that the latter would be more efficient. Can any one back me up/shoot me down :-)

    Read the article

  • how to dynamic swf Edit in flex.

    - by mahendra
    hi frd i have make one test.mxml.i have add or load one "demo.swf",my proble is that how to change "swf.swf" mean change color,height,width,alpha or etc. to this main swf. pls help if posible then send code how to work.

    Read the article

  • Setting background text colour of radio button

    - by Night Walker
    Hello all I want to set up the Background color of the text in my radio button . I have tried Background="Chocolate" , but it sets the color of the circle dot there . Any idea how i do that ? This is my current code <RadioButton Content=" MSSQL" TextBlock.Foreground="Black" HorizontalAlignment="Left" Height="Auto" Padding="0" Margin="15,15,0,0" Name="radioButton_MSSQL" VerticalAlignment="Top" Width="66" GroupName="DataBases" BorderBrush="DarkOrchid" IsChecked="True" />

    Read the article

  • What is the wrong of this converted code?

    - by Gum Slashy
    I'm developing shape identification project using javacv and I have found some opencv code to identify U shapes in particular image and I have try to convert it in to javacv but it doesn't provide same out put. Can you please help me to convert this opencv code into javacv? This is Opencv code import cv2 import numpy as np img = cv2.imread('sofud.jpg') gray = cv2.cvtColor(img,cv2.COLOR_BGR2GRAY) ret,thresh = cv2.threshold(gray,127,255,1) contours,hierarchy = cv2.findContours(thresh,cv2.RETR_LIST,cv2.CHAIN_APPROX_SIMPLE) for cnt in contours: x,y,w,h = cv2.boundingRect(cnt) if 10 < w/float(h) or w/float(h) < 0.1: cv2.rectangle(img,(x,y),(x+w,y+h),(0,0,255),2) cv2.imshow('res',img) cv2.waitKey(0) cv2.destroyAllWindows() This is the expected output This is the code that I have converted import com.googlecode.javacpp.Loader; import com.googlecode.javacv.CanvasFrame; import static com.googlecode.javacpp.Loader.*; import static com.googlecode.javacv.cpp.opencv_core.*; import static com.googlecode.javacv.cpp.opencv_imgproc.*; import static com.googlecode.javacv.cpp.opencv_highgui.*; import java.io.File; import javax.swing.JFileChooser; public class TestBeam { public static void main(String[] args) { CvMemStorage storage=CvMemStorage.create(); CvSeq squares = new CvContour(); squares = cvCreateSeq(0, sizeof(CvContour.class), sizeof(CvSeq.class), storage); JFileChooser f=new JFileChooser(); int result=f.showOpenDialog(f);//show dialog box to choose files File myfile=null; String path=""; if(result==0){ myfile=f.getSelectedFile();//selected file taken to myfile path=myfile.getAbsolutePath();//get the path of the file } IplImage src = cvLoadImage(path);//hear path is actual path to image IplImage grayImage = IplImage.create(src.width(), src.height(), IPL_DEPTH_8U, 1); cvCvtColor(src, grayImage, CV_RGB2GRAY); cvThreshold(grayImage, grayImage, 127, 255, CV_THRESH_BINARY); CvSeq cvSeq=new CvSeq(); CvMemStorage memory=CvMemStorage.create(); cvFindContours(grayImage, memory, cvSeq, Loader.sizeof(CvContour.class), CV_RETR_CCOMP, CV_CHAIN_APPROX_SIMPLE); System.out.println(cvSeq.total()); for (int i = 0; i < cvSeq.total(); i++) { CvRect rect=cvBoundingRect(cvSeq, i); int x=rect.x(),y=rect.y(),h=rect.height(),w=rect.width(); if (10 < (w/h) || (w/h) < 0.1){ cvRectangle(src, cvPoint(x, y), cvPoint(x+w, y+h), CvScalar.RED, 1, CV_AA, 0); //cvSeqPush(squares, rect); } } CanvasFrame cnvs=new CanvasFrame("Beam"); cnvs.setDefaultCloseOperation(javax.swing.JFrame.EXIT_ON_CLOSE); cnvs.showImage(src); //cvShowImage("Final ", src); } } This is the out put that I got please can some one help me to solve this problem ?

    Read the article

  • Use matching value of a RegExp to name the output file.

    - by fx42
    I have this file "file.txt" which I want to split into many smaller ones. Each line of the file has an id field which looks like "id:1" for a line belonging to id 1. For each id in the file, I like to create a file named idid.txt and put all lines that belong to this id in that file. My brute force bash script solution reads as follows. count=1 while [ $count -lt 19945 ] do cat file.txt | grep "id:$count " >> ./sets/id$count.txt count='expr $count + 1' done Now this is very inefficient as I have do read through the file about 20.000 times. Is there a way to do the same operation with only one pass through the file? - What I'm probably asking for is a way to use the value that matches for a regular expression to name the associated output file.

    Read the article

  • CSS Z-Index with Gradient Background

    - by Jona
    I'm making a small webpage where the I would like the top banner with some text to remain on top, as such: HTML: <div id = "topBanner"> <h1>Some Text</h1> </div> CSS: #topBanner{ position:fixed; background-color: #CCCCCC; width: 100%; height:200px; top:0; left:0; z-index:900; background: -moz-linear-gradient(top, rgba(204,204,204,0.65) 0%, rgba(204,204,204,0.44) 32%, rgba(204,204,204,0.12) 82%, rgba(204,204,204,0) 100%); /* FF3.6+ */ background: -webkit-gradient(linear, left top, left bottom, color-stop(0%,rgba(204,204,204,0.65)), color-stop(32%,rgba(204,204,204,0.44)), color-stop(82%,rgba(204,204,204,0.12)), color-stop(100%,rgba(204,204,204,0))); /* Chrome,Safari4+ */ background: -webkit-linear-gradient(top, rgba(204,204,204,0.65) 0%,rgba(204,204,204,0.44) 32%,rgba(204,204,204,0.12) 82%,rgba(204,204,204,0) 100%); /* Chrome10+,Safari5.1+ */ background: -o-linear-gradient(top, rgba(204,204,204,0.65) 0%,rgba(204,204,204,0.44) 32%,rgba(204,204,204,0.12) 82%,rgba(204,204,204,0) 100%); /* Opera 11.10+ */ background: -ms-linear-gradient(top, rgba(204,204,204,0.65) 0%,rgba(204,204,204,0.44) 32%,rgba(204,204,204,0.12) 82%,rgba(204,204,204,0) 100%); /* IE10+ */ background: linear-gradient(to bottom, rgba(204,204,204,0.65) 0%,rgba(204,204,204,0.44) 32%,rgba(204,204,204,0.12) 82%,rgba(204,204,204,0) 100%); /* W3C */ filter: progid:DXImageTransform.Microsoft.gradient( startColorstr='#a6cccccc', endColorstr='#00cccccc',GradientType=0 ); /* IE6-9 */ } /*WebPage Header*/ h1{ font-size:3em; color:blue; text-shadow:#CCCCCC 2px 2px 2px, #000 0 -1px 2px; position: absolute; width: 570px; left:50%; right:50%; line-height:20px; margin-left: -285px; z-index:999; } The z-index works fine, except that because I'm using a gradient any time I scroll down the elements behind the banner are still visible, albeit somewhat transparent. Is there any way to make them total invisible? i.e., what I'm trying to do is make it as though the banner is a solid color, even though it's a gradient. Thanks in advance for any help!

    Read the article

  • ASP.NET Treeview Control not expanding on click

    - by Scott Vercuski
    I having an issue with the ASP.NET Treeview control. I create the treeview just fine but the nodes will not expand or collapse. I see there is a javascript error but it is for line 1 character 0 of the webpage, there is nothing at line 1 character 0. I am using the ASP:Treeview control in conjunction with the Telerik controls, but I'm not sure if that is an issue. I saw there was a similar question here but the answer is not pertinent to my site. Has anyone run into this issue before? I've tried searching Google and tried a number of proposed solutions but so far none have worked. Thank you,

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • div popup inside td

    - by sims
    I have a table with a bunch of cells. (No way! Amazing! :P) Some of the cells have a small div that when you put your mouse over, it gets bigger so you can read all the text. This works well and all. However, since html elements that come later in the document have a higher z-index, when the div gets bigger it is underneath the other divs in the other cells. Some html code: <table> <tr> <td> limited info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> informative long text is here </div> </div> </td> <td> some short info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> longer explanation about what is really going on that covers the div up there ^^^. darn! </div> </div> </td> </tr> </table> Some js code: function tooltipshow(obj) { obj.style.width = '30em'; obj.style.zIndex = '100'; } function tooltiphide(obj) { obj.style.width = '1em'; obj.style.zIndex = '20'; } It doesn't matter if I set z-index dynamically to something higher onmouseover. It's like z-index has no affect. I think it has something to do with the table. I've tested this in FF3. When I'm feeling particularly macho, I'll test it in IE.

    Read the article

  • Extract new image dimensions from timthumb

    - by jonthoughtit
    I'm using timthumb to resize my images because it scales them nicely if I only enter one of the dimensions. However I want to know if it's possible to extract the new resized image's dimensions so that I can add that dynamically to the img tag attributes. I tried this with no luck: $fullpath = '/lib/timthumb.php?src='.$image.'&w=100'; $my_image = array_values(getimagesize($fullpath)); list($width, $height, $type, $attr) = $my_image; Any ideas?

    Read the article

< Previous Page | 527 528 529 530 531 532 533 534 535 536 537 538  | Next Page >