Search Results

Search found 16894 results on 676 pages for 'block device'.

Page 532/676 | < Previous Page | 528 529 530 531 532 533 534 535 536 537 538 539  | Next Page >

  • RTL8192SU Linux Issue Installing Driver

    - by s32ialx
    OK I've read tons of fourms of people getting the onboard RTL8192SE working and the RTL8192SU working dif is U = USB they are both N and i have both Toshiba L500D-00T pre-installed Win Vistax64-HP and i have obtained the free Win7x64-HP upgrade the onboard wificard sucks and can't hold a stable connection for more then 20minutes in windows but the usb is amazing. Now problem is i tried both Ubuntu and Mandriva with no resolve the issue is the onboard drive detects and actually SHOWS that it's there but no wireless networks detect so it's saying no SSID's are broadcasting which i know is a lie since I'm running a 2wire bell dsl modem with built in wifi and a Linksys wrt54g w/ DD-WRT firmware and both are broadcasting fine. Why don't i use the USB? In the hardware device manager in mandriva it shows up as unknown but shows that it's realtek and that it's a 8192 chipset. but no option to for a driver install and when i do a make in terminal i get this error and no clue what it means [root@John-PC rtl8192se_linux_2.6.0010.1020.2009_64bit]# make make: *** /lib/modules/2.6.31.12-desktop-3mnb/build: No such file or directory. Stop. make: *** [all] Error 2 [root@John-PC rtl8192se_linux_2.6.0010.1020.2009_64bit]# any help appreciated. and just encase I'm running currently Mandriva Spring 2010 Free

    Read the article

  • Is On-The-Fly string replacement possible using GreaseMonkey and Firefox

    - by Gary M. Mugford
    I have looked for means to stop Brightcove videos from autostarting in Firefox and have come to the conclusion it isn't possible without external programming via something like Grease Monkey. However, I'm not proficient in javascript let alone GM. So I thought I'd ask here first whether what I want to do is feasible, or whether it's a fool's errand. What I want to accomplish is have a site specific script executed to replace a string value on the run in that site's code. Specifically, what I am looking for is something GM-style that would do this: if site_domain = 'www.SiteWithAutoPlayVideos.com' then replace_all('<param name="autoStart" value="true" />', '<param name="autoStart" value="false" />'); Having looked through Super User for anything GreaseMonkey that might relate, I see notices that the sandbox GM executes scripts in has to remain separate for security reasons. So, I suspect I might be in for disappointment. BUT if it is accomplishable and somebody here can confirm it, then I will do my best to struggle through the learning curve and get this noisome little problem put to rest. Yes, I have tried Flash Block and FlashDisable in order to attack this issue with no avail. Thanks in advance for your time.

    Read the article

  • How to multiseat with HW 3d accel on CentOS 6.3 Final?

    - by user35070
    I would like to setup a multiseat configuration on CentOS 6.3 (two video cards, two keyboards, two mice, two monitors) and have hardware accelerated 3D on both monitors. 3D HW acceleration rules out Xephyr. I saw somewhere that recent versions of GDM (3.3 and newer?) don't support multiseat, so do I have to install KDM to make this work? If I just create a duplicate section with new device identifiers in my xorg.conf file, will this 'just work'? Using different ports on the same video card and separate keyboards, mice, and displays, the result was a desktop which spanned both monitors with both keyboards and mice acting as the same input in the GUI. I will power down and put in the new video card and report on the results soon. Both video cards are nvidia. UPDATE after putting in another NVIDIA video card, default behavior (before changing xorg.conf) is that one screen works normally, and both mice and keyboards are connected to it. Changing xorg.conf and the display manager to KDM and following the directions here https://help.ubuntu.com/community/MultiseatX#Ubuntu_10.04_.28Lucid.29 , I have 2 mirrored screens connected to separate video cards, DRI enabled, and 2 mice both connected to the same pointer. Keyboards don't do anything, however, I probably just need to fix a setting in xorg.conf I would still like to get multiseat functionality, eg. separate screens with separate input devices I have verified that the separate X processes are running (see page above) using 'ps aux | grepX [01]'

    Read the article

  • Unable to boot with Windows 2008 DVD / USB Key

    - by r0ca
    Hi everyone, I am trying to install Windows 2008 server on a HP Proliant DL180 G5. There is no built-in DVD reader so I need to use my LaCie USB one. When I put the CD in and boot from the USB DVD on the server, I get the error message: Boot Failed! Please insert boot media in selected boot device. So I tried with another Windows bootable CD and still no luck. What I've done then, I copied the installation DVD on my 16go USB key. Again, impossible to boot from the USB Key. I have 2 147go SAS 15k HDD on my server. They are not showing in the Bios. I was wondering if this is a reason why nothing will boot on it. I am trying to find a way to deploy Windows 2008 server on my HP server as soon as possible. If you guys have ideas, feel free to let me know :) Best regards, David. System Information: HP Proliant DL180 G5 Quad-Core 2.5 4GO Ram 2x 147GO SAS 15k P.S. This is my first installation ever on SAS/SCSI HDD. Thanks a bunch! Edit: Well, my bad! I purchased a new USB DVD and now I can install Windows 2008 server. Thanks a bunch for your help!

    Read the article

  • Can I attach a VPN firewall to an existing network and have it manage VPN connections?

    - by jules
    I'm quite new to networking and am trying to set up my first VPN connection. The Situation: I have been contracted for some programming at a facility some distance from my location. I would like to be able to set up a simple VPN connection to their network so that I may make adjustments without significant travel. Their Current Network: Six devices (one I need to connect to) plugged into a basic router (Dlink). This router has an internet connection and a static ip address. My Hopeful (questionable) Proposal: I attach a VPN Firewall I happen to own (Netgear FVS318) as device number seven on the client network. I disable routing / DHCP in the Netgear. I forward the appropriate IPSec ports from the Dlink to the Netgear. I then create a VPN connection on my office Windows 7 machine to the remote network. The request is forwarded from the Dlink to the Netgear where the VPN connection is authenticated. I now have a remote-access connection from my office PC to the client's local network. The Question: Will this proposal work? If not, would another possibility be to attach a computer with a VPN server to the client network? Also, as a note: the client has requested I not replace their router or place mine in-between theirs and the internet :( Thanks very much!

    Read the article

  • How can I stream audio signals from various devices/computers to my home server?

    - by Breakthrough
    I currently have a headless home server set up (running Ubuntu 12.04 server edition) running a simple Apache HTTP server. The server is near an audio receiver, which controls a set of indoor and outdoor speakers in my home. Recently, my father purchased a Bluetooth adapter, which our various laptops and cellphones can connect to, outputting the music to the speakers. I was hoping to find a solution that worked over Wi-Fi, namely because it won't cost anything (I already have a server with an audio card), and it doesn't depend on Bluetooth. Is there any cross-platform (preferably free and open-source) solution that I can use which will allow me to stream audio to my home server, over my home network, from a wide variety of devices (laptops running Windows/Linux or cellphones running Android/BB/iOS)? I need something that works at least with Windows and Android. Also, just to clairfy, I want something that simply allows devices to connect to my server and output an audio signal without any action on the server end (since it's a server hidden away near my receiver). Any subsequent connection attempt should be dropped, so only one device can be in control of the stereo at once.

    Read the article

  • Backing up VMs to a tape drive

    - by Aljoscha Vollmerhaus
    I've got myself one of these fancy tape drives, HP LTO2 with 200/400 GB cartridges. The st driver reports it like this: scsi 1:0:0:0: Sequential-Access HP Ultrium 2-SCSI T65D I can store and retrieve files like a charm using tar, both tar cf /dev/st0 somedirectory and tar xf /dev/st0 work flawless. However, what I really would like to backup are LVM LVs. They contain entire virtual machines with varying partition layouts, so using mount and tar is not an option. I've tried using something like dd if=/dev/VG/LV bs=64k of=/dev/st0 to achieve this, but there seem to be various problems associated with this approach. Firstly, I would like to be able to store more than 1 LV on a single tape. Now I guess I could seek to concatenate the data on the tape, but I think this would not work very well in an automated scenario with many different LVs of various sizes. Secondly, I would like to store a small XML file along with the raw data that contains some information about the VM contained in the LV. I could dump everything to a directory and tar it up - not very desirable, I would have to set aside huge amounts of scratch space. Is there an easier way to achieve this? Thirdly, from googling around it seems like it would be wise to use something like mbuffer when writing to the tape, to prevent what wikipedia calls "shoe-shining" the tape. However, I can't get anything useful done with mbuffer. The mbuffer man page suggests this for writing to a tape device: mbuffer -t -m 10M -p 80 -f -o $TAPE So I've tried this: dd if=/dev/VG/LV | mbuffer -t -m 10M -p 80 -f -d 64k -o /dev/st0 Note the added "-d 64k" to account for the 64k block size of the tape. However, reading data back from a tape written in this way never seems to yield any useful results - dd has been running for ages now, and managed to transfer only 361M of data from the tape. What's wrong here?

    Read the article

  • Fedora-13 not detecting USB HDD enclosure (with HDD)

    - by Ramy
    I recently purchased this enclosure: http://www.amazon.com/Inland-2-5-Inc.../dp/B003SZ2Y12 and this HDD: http://www.amazon.com/Seagate-Barrac...3811667&sr=8-1 Now, I let my brother in law use the enclosure with his 160GB disk to back some stuff up. He then gave me that disk in my enclosure and I backed up my computer and my fiances computer. So...obviously, i had no problem mounting that disk. I plan on keeping this disk as my "natural disaster backup" (in case my apartment building burns down, i still have that disk with my stuff backed up). I want to use the 1.5T disk as my regular/more frequent backup device, but it doesn't seem to be mounting to my F-13 machine. I searched through this forum and found someone advising to run the following: # mount -t vfat /dev/sda1 /mnt this is the output i get when I run that: mount: /dev/sda1 already mounted or /mnt busy mount: according to mtab, /dev/sda1 is mounted on /boot Thing is, shouldn't this disk automatically mount just like the LAST disk in the same enclosure with the same USB cable and power supply? Any help would be greatly appreciated. THANKS!

    Read the article

  • iOS 6 in-app email does not send from within any app that supports it

    - by Joe Termine
    A strange problem -- Last night I upgraded to the final release of iOS 6 on my iPhone 4S and my iPad 2. When I open an app that allows you to send emails from within the app (e.g. adobe Reader, TurboScan, etc.) -- doesn't matter which one -- I am prompted with the email dialog from within the app, I can compose the message, but when I go to send one of two things will happen: either the email sending sound will "swoosh" and the dialog will close (leading me to think it worked) or some apps with good error handling will say there is an "error sending email." The error logs on my device are not reporting errors. It's just that the email doesn't really send. I have two Exchange mail boxes on these devices. One connects to a corporate network hosting on-premise exchange 2007 and the other connects to Gmail over the exchange interface. Have attempted to delete and re-pair these accounts (one at a time) without any change. I'm wondering if others are experiencing this problem, or whether I should just wipe the devices and chalk it up to (another) failed upgrade. Thoughts much appreciated. Joe

    Read the article

  • MS SQL Server slows down over time?

    - by Dave Holland
    Have any of you experienced the following, and have you found a solution: A large part of our website's back-end is MS SQL Server 2005. Every week or two weeks the site begins running slower - and I see queries taking longer and longer to complete in SQL. I have a query that I like to use: USE master select text,wait_time,blocking_session_id AS "Block", percent_complete, * from sys.dm_exec_requests CROSS APPLY sys.dm_exec_sql_text(sql_handle) AS s2 order by start_time asc Which is fairly useful... it gives a snapshot of everything that's running right at that moment against your SQL server. What's nice is that even if your CPU is pegged at 100% for some reason and Activity Monitor is refusing to load (I'm sure some of you have been there) this query still returns and you can see what query is killing your DB. When I run this, or Activity Monitor during the times that SQL has begun to slow down I don't see any specific queries causing the issue - they are ALL running slower across the board. If I restart the MS SQL Service then everything is fine, it speeds right up - for a week or two until it happens again. Nothing that I can think of has changed, but this just started a few months ago... Ideas? --Added Please note that when this database slowdown happens it doesn't matter if we are getting 100K page views an hour (busier time of day) or 10K page views an hour (slow time) the queries all take a longer time to complete than normal. The server isn't really under stress - the CPU isn't high, the disk usage doesn't seem to be out of control... it feels like index fragmentation or something of the sort but that doesn't seem to be the case. As far as pasting results of the query I pasted above I really can't do that. The Query above lists the login of the user performing the task, the entire query, etc etc.. and I'd really not like to hand out the names of my databases, tables, columns and the logins online :)... I can tell you that the queries running at that time are normal, standard queries for our site that run all the time, nothing out of the norm.

    Read the article

  • Drobo FS vs. MacBook Pro: Finder works, Drobo Dashboard doesn't

    - by dash-tom-bang
    Does anyone have any experience with the new Drobo FS, specifically using it from a MacBook Pro? My experience thus far is this: Set up the Drobo Dashboard software (hereinafter called simply 'Dashboard') on my WinXP machine, which is hard-wired to the network to do the data migration from my NAS-that's-being-replaced (a 250G SimpleShare which works well enough but I was always afraid of losing the one disk). The Dashboard seems to work ok, except that the DroboCopy function doesn't work at all. This is the backup solution, which I can configure, and if I launch it (e.g. to back up from the old NAS to the Drobo) it spins the NAS, seeking the drive all over hell and creation, until finally giving up an hour+ later with zero files copied. Selecting only a subset of the data yields the same effect albeit more quickly. On my Mac I installed the Dashboard software too, since most of my fiddling with the device will be from my couch in the living room. Finder connects to the box just fine, fwiw, but Dashboard just sits there, "waiting for connection." This is considerably more bothersome than the above paragraph, but I figured I'd give whatever information I have. Drobo is insisting that I send them this "Debug Log" file that their software generates. Does anyone know what's in it? It's encrypted and they won't tell me, which spooks me just a bit; not like I'm terribly concerned about privacy but I don't want to be sending personal information out to every clown who says they "need" it in order to help me. thanks a ton, -tom!

    Read the article

  • Problems with OpenVPN setup

    - by user70617
    Hi, I'm trying to set up a VPN server using OpenVPN and I'm getting some errors while trying to connect the client to the server. I'm getting the following error: Sun Feb 13 14:54:16 2011 OpenVPN 2.1.4 i686-pc-linux-gnu [SSL] [LZO2] [EPOLL] built on Feb 5 2011 Sun Feb 13 14:54:16 2011 IMPORTANT: OpenVPN's default port number is now 1194, based on an official port number assignment by IANA. OpenVPN 2.0-beta16 and earlier used 5000 as the default port. Sun Feb 13 14:54:16 2011 NOTE: OpenVPN 2.1 requires '--script-security 2' or higher to call user-defined scripts or executables Sun Feb 13 14:54:16 2011 ******* WARNING *******: all encryption and authentication features disabled -- all data will be tunnelled as cleartext Sun Feb 13 14:54:16 2011 RESOLVE: NOTE: localhost resolves to 2 addresses Sun Feb 13 14:54:16 2011 Note: Cannot ioctl TUNSETIFF tap0: Device or resource busy (errno=16) Sun Feb 13 14:54:16 2011 Note: Attempting fallback to kernel 2.2 TUN/TAP interface Sun Feb 13 14:54:16 2011 Cannot open TUN/TAP dev /dev/tap0: No such file or directory (errno=2) Sun Feb 13 14:54:16 2011 Exiting I have bridge-utils installed and tap0 shows up in ifconfig. Can anybody give me a hand? Thanks in advance.

    Read the article

  • How can I do an SELINUX filesystem relabel without rebooting first?

    - by Skaperen
    I can touch the file /.autorelabel and reboot and during the initialization coming back up it will do the SELINUX relabel for me. But I want to do this in a different situation where the system has just been copied to a hard drive image. I can chroot to the originating file tree, or chroot to the just populated device image and run it. I just can't find anything that says what to be run. This image is being made into an AMI on AWS EC2, and contains CentOS 6.3. But the time it takes to relabel is too long (6 minutes or more). I want to move the relabel to the image build where the extra time is not an issue (because it happens once instead of every time an AMI is launched). I can make this relabel be the very last thing just before the filesystem is unmounted for the last time until it becomes an AMI and will launch. I just need to know what to call to do it. I have searched man pages with no luck. I have searched system init scripts but where /.autorelabel is detected, it is unclear what is happening. Documents like http://www.centos.org/docs/5/html/5.2/Deployment_Guide/sec-sel-fsrelabel.html only tell how to do things that still really do the work after a reboot. I need to have the work doing BEFORE the "reboot" (unmount, build AMI, and launch ready to go). The big point is ... yes there will be a reboot ... but I want the relabel work to be done before that so it won't be done every time an AMI is launched (because it takes so long).

    Read the article

  • WHS - Windows Update Failure

    - by Kyle B.
    Clicking "Update Now..." inside my EX470 control panel for Windows Update produces the following error message: "Windows Home Server updates installation can not complete. Please try again later. If the problem persists, please restart the server." I have rebooted the server numerous times, and I have also used remote desktop to connect to the machine to perform the update this way, however the browser is unable to pull up http://windowsupdate.microsoft.com. This is very strange behavior because I am able to access all other sites (gmail.com, serverfault.com, etc). Would it be possible for someone to explain to me how I can check to see what is blocking the connection of this device, which apparently has a valid internet connection, to the Microsoft Windows Update site? note #1 Using the shortcut: %SystemRoot%\system32\wupdmgr.exe does not work either. It says "Connecting to 65.55.200.155..." but nothing ever happens. This is strange because all other sites seem fine. Also, I can connect to windowsupdate.microsoft.com on my local desktop so I know this is running as well

    Read the article

  • How to find cause of main file system going to read only mode

    - by user606521
    Ubuntu 12.04 File system goes to readonly mode frequently. First of all I have read this question file system is going into read only mode frequently already. But I have to know if it's not caused by something else than dying hard drive. This is server provided by my client and I am just runing there some node.js workers + one node.js server and I am using mongodb. From time to time (every 20-50h) system suddenly makes filesystem read only, mongodb process fails (due read-only fs) and my node workers/server (which are started by forever) are just killed. Here is the log from dmesg - I can see there some errors and messages that FS is going to read-only, and there is also some JOURNAL error but I would like to find cause of those errors.. http://speedy.sh/Ux2VV/dmesg.log.txt edit smartctl -t long /dev/sda smartctl 5.41 2011-06-09 r3365 [x86_64-linux-3.5.0-23-generic] (local build) Copyright (C) 2002-11 by Bruce Allen, http://smartmontools.sourceforge.net SMART support is: Unavailable - device lacks SMART capability. A mandatory SMART command failed: exiting. To continue, add one or more '-T permissive' options. What I am doing wrong? Same is for sda2. Morover now when I type any command that not exists in shell I get this: Sorry, command-not-found has crashed! Please file a bug report at: https://bugs.launchpad.net/command-not-found/+filebug Please include the following information with the report:

    Read the article

  • How to remove the hint in the terminal?

    - by jiangchengwu
    As a normal user , when I run some command like ps\netstat, the terminal hint me: (Not all processes could be identified, non-owned process info will not be shown, you would have to be root to see it all.) I know could redirect STDERR to /dev/null can remove this hint. But I want to know is there any way to remove it , such as edit some configuration files ? [deploy@storage2 ~]$ ps -V (Not all processes could be identified, non-owned process info will not be shown, you would have to be root to see it all.) procps version 3.2.7 [deploy@storage2 ~]$ ps -V 2>/dev/null procps version 3.2.7 My OS info: [deploy@storage2 ~]$ uname -a Linux storage2 2.6.18-243.el5 #1 SMP Mon Feb 7 18:47:27 EST 2011 x86_64 x86_64 x86_64 GNU/Linux [deploy@storage2 ~]$ lsb_release LSB Version: :core-3.1-amd64:core-3.1-ia32:core-3.1-noarch:graphics-3.1-amd64:graphics-3.1-ia32:graphics-3.1-noarch [deploy@storage2 ~]$ netstat -V (Not all processes could be identified, non-owned process info will not be shown, you would have to be root to see it all.) net-tools 1.60 netstat 1.42 (2001-04-15) Fred Baumgarten, Alan Cox, Bernd Eckenfels, Phil Blundell, Tuan Hoang and others +NEW_ADDRT +RTF_IRTT +RTF_REJECT +FW_MASQUERADE +I18N AF: (inet) +UNIX +INET +INET6 +IPX +AX25 +NETROM +X25 +ATALK +ECONET +ROSE HW: +ETHER +ARC +SLIP +PPP +TUNNEL +TR +AX25 +NETROM +X25 +FR +ROSE +ASH +SIT +FDDI +HIPPI +HDLC/LAPB There are more info from strace: [deploy@storage2 ~]$ strace ps -V execve("/bin/ps", ["ps", "-V"], [/* 27 vars */]) = 0 brk(0) = 0x929a000 access("/etc/ld.so.preload", R_OK) = -1 ENOENT (No such file or directory) open("/etc/ld.so.cache", O_RDONLY) = 3 fstat64(3, {st_mode=S_IFREG|0644, st_size=99752, ...}) = 0 mmap2(NULL, 99752, PROT_READ, MAP_PRIVATE, 3, 0) = 0xfffffffff7fde000 close(3) = 0 open("/lib/libnsl.so.1", O_RDONLY) = 3 read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0 \241\210\0004\0\0\0"..., 512) = 512 fstat64(3, {st_mode=S_IFREG|0755, st_size=101404, ...}) = 0 mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7fdd000 mmap2(0x887000, 92104, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x887000 mmap2(0x89a000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x12) = 0x89a000 mmap2(0x89c000, 6088, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0x89c000 close(3) = 0 open("/lib/libdl.so.2", O_RDONLY) = 3 read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0Pzt\0004\0\0\0"..., 512) = 512 fstat64(3, {st_mode=S_IFREG|0755, st_size=16428, ...}) = 0 mmap2(0x747000, 12408, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x747000 mmap2(0x749000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x1) = 0x749000 close(3) = 0 open("/lib/libm.so.6", O_RDONLY) = 3 read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\20\204p\0004\0\0\0"..., 512) = 512 fstat64(3, {st_mode=S_IFREG|0755, st_size=208352, ...}) = 0 mmap2(0x705000, 155760, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x705000 mmap2(0x72a000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x24) = 0x72a000 close(3) = 0 open("/lib/libcrypt.so.1", O_RDONLY) = 3 read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\340\246q\0004\0\0\0"..., 512) = 512 fstat64(3, {st_mode=S_IFREG|0755, st_size=45288, ...}) = 0 mmap2(0x71a000, 201020, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7fab000 mmap2(0xf7fb4000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x8) = 0xfffffffff7fb4000 mmap2(0xf7fb6000, 155964, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7fb6000 close(3) = 0 open("/lib/libutil.so.1", O_RDONLY) = 3 read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0 \n\0\0004\0\0\0"..., 512) = 512 fstat64(3, {st_mode=S_IFREG|0755, st_size=13420, ...}) = 0 mmap2(NULL, 12428, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7fa7000 mmap2(0xf7fa9000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x1) = 0xfffffffff7fa9000 close(3) = 0 open("/lib/libpthread.so.0", O_RDONLY) = 3 read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0@(s\0004\0\0\0"..., 512) = 512 fstat64(3, {st_mode=S_IFREG|0755, st_size=129716, ...}) = 0 mmap2(0x72e000, 90596, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x72e000 mmap2(0x741000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x13) = 0x741000 mmap2(0x743000, 4580, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0x743000 close(3) = 0 open("/lib/libc.so.6", O_RDONLY) = 3 read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\340?]\0004\0\0\0"..., 512) = 512 fstat64(3, {st_mode=S_IFREG|0755, st_size=1611564, ...}) = 0 mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7fa6000 mmap2(0x5be000, 1328580, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x5be000 mmap2(0x6fd000, 12288, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x13f) = 0x6fd000 mmap2(0x700000, 9668, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0x700000 close(3) = 0 mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7fa5000 set_thread_area(0xffd61bb4) = 0 mprotect(0x6fd000, 8192, PROT_READ) = 0 mprotect(0x741000, 4096, PROT_READ) = 0 mprotect(0xf7fa9000, 4096, PROT_READ) = 0 mprotect(0xf7fb4000, 4096, PROT_READ) = 0 mprotect(0x72a000, 4096, PROT_READ) = 0 mprotect(0x749000, 4096, PROT_READ) = 0 mprotect(0x89a000, 4096, PROT_READ) = 0 mprotect(0x5ba000, 4096, PROT_READ) = 0 munmap(0xf7fde000, 99752) = 0 set_tid_address(0xf7fa5708) = 20214 set_robust_list(0xf7fa5710, 0xc) = 0 futex(0xffd61f74, FUTEX_WAKE_PRIVATE, 1) = 0 rt_sigaction(SIGRTMIN, {0x4007323d0, [], 0}, NULL, 8) = 0 rt_sigaction(SIGRT_1, {0x10000004007322e0, [], 0}, NULL, 8) = 0 rt_sigprocmask(SIG_UNBLOCK, [RTMIN RT_1], NULL, 8) = 0 getrlimit(RLIMIT_STACK, {rlim_cur=-4284481536, rlim_max=67108864*1024}) = 0 uname({sys="Linux", node="storage2", ...}) = 0 readlink("/proc/self/exe", "/bin/ps"..., 260) = 7 brk(0) = 0x929a000 brk(0x92bb000) = 0x92bb000 open("/bin/ps", O_RDONLY|O_LARGEFILE) = 3 _llseek(3, -12, [711660], SEEK_END) = 0 read(3, "\274U!\253\2\0\0\0\224\237\t\0", 12) = 12 mmap2(NULL, 634880, PROT_READ, MAP_SHARED, 3, 0x13) = 0xfffffffff7f0a000 mmap2(NULL, 630784, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7e70000 close(3) = 0 futex(0x74a06c, FUTEX_WAKE_PRIVATE, 2147483647) = 0 geteuid32() = 501 socket(PF_FILE, SOCK_STREAM, 0) = 3 fcntl64(3, F_SETFL, O_RDWR|O_NONBLOCK) = 0 connect(3, {sa_family=AF_FILE, path="/var/run/nscd/socket"...}, 110) = -1 ENOENT (No such file or directory) close(3) = 0 socket(PF_FILE, SOCK_STREAM, 0) = 3 fcntl64(3, F_SETFL, O_RDWR|O_NONBLOCK) = 0 connect(3, {sa_family=AF_FILE, path="/var/run/nscd/socket"...}, 110) = -1 ENOENT (No such file or directory) close(3) = 0 open("/etc/nsswitch.conf", O_RDONLY) = 3 fstat64(3, {st_mode=S_IFREG|0644, st_size=1696, ...}) = 0 mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7ff6000 read(3, "#\n# /etc/nsswitch.conf\n#\n# An ex"..., 4096) = 1696 read(3, "", 4096) = 0 close(3) = 0 munmap(0xf7ff6000, 4096) = 0 open("/etc/ld.so.cache", O_RDONLY) = 3 fstat64(3, {st_mode=S_IFREG|0644, st_size=99752, ...}) = 0 mmap2(NULL, 99752, PROT_READ, MAP_PRIVATE, 3, 0) = 0xfffffffff7fde000 close(3) = 0 open("/lib/libnss_files.so.2", O_RDONLY) = 3 read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\300\30\0\0004\0\0\0"..., 512) = 512 fstat64(3, {st_mode=S_IFREG|0755, st_size=46680, ...}) = 0 mmap2(NULL, 41616, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7e65000 mmap2(0xf7e6e000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x8) = 0xfffffffff7e6e000 close(3) = 0 mprotect(0xf7e6e000, 4096, PROT_READ) = 0 munmap(0xf7fde000, 99752) = 0 open("/etc/passwd", O_RDONLY) = 3 fcntl64(3, F_GETFD) = 0 fcntl64(3, F_SETFD, FD_CLOEXEC) = 0 fstat64(3, {st_mode=S_IFREG|0644, st_size=2166, ...}) = 0 mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7ff6000 read(3, "root:x:0:0:root:/root:/bin/bash\n"..., 4096) = 2166 close(3) = 0 munmap(0xf7ff6000, 4096) = 0 mkdir("/tmp/pdk-deploy/", 0755) = -1 EEXIST (File exists) mkdir("/tmp/pdk-deploy/fcb734befe617ec3ae1edc38da810a5a", 0755) = -1 EEXIST (File exists) open("/tmp/pdk-deploy/fcb734befe617ec3ae1edc38da810a5a/libperl.so", O_RDONLY|O_LARGEFILE) = 3 close(3) = 0 open("/tmp/pdk-deploy/fcb734befe617ec3ae1edc38da810a5a/libperl.so", O_RDONLY) = 3 read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\300!\2\0004\0\0\0"..., 512) = 512 fstat64(3, {st_mode=S_IFREG|0664, st_size=1264090, ...}) = 0 mmap2(NULL, 1140104, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7d4e000 mmap2(0xf7e5a000, 45056, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x10b) = 0xfffffffff7e5a000 close(3) = 0 rt_sigaction(SIGFPE, {0x1000000000000001, [], SA_RESTORER|SA_STACK|SA_RESTART|SA_INTERRUPT|SA_NODEFER|SA_RESETHAND|SA_SIGINFO|0x3d61cb8, (nil)}, {SIG_DFL, ~[HUP INT ILL ABRT BUS SEGV USR2 PIPE ALRM TERM STOP TSTP TTIN TTOU XCPU WINCH IO PWR SYS RTMIN RT_1 RT_2 RT_4 RT_5 RT_8 RT_9 RT_11 RT_12 RT_13 RT_16 RT_17 RT_18 RT_22 RT_24 RT_25 RT_26 RT_27 RT_28 RT_29 RT_30 RT_31], SA_RESTART|SA_RESETHAND|0x22302d0}, 8) = 0 getuid32() = 501 geteuid32() = 501 getgid32() = 502 getegid32() = 502 open("/usr/lib/locale/locale-archive", O_RDONLY|O_LARGEFILE) = 3 fstat64(3, {st_mode=S_IFREG|0644, st_size=56454896, ...}) = 0 mmap2(NULL, 2097152, PROT_READ, MAP_PRIVATE, 3, 0) = 0xfffffffff7b4e000 mmap2(NULL, 241664, PROT_READ, MAP_PRIVATE, 3, 0x13ec) = 0xfffffffff7b13000 mmap2(NULL, 4096, PROT_READ, MAP_PRIVATE, 3, 0x1466) = 0xfffffffff7b12000 close(3) = 0 mmap2(NULL, 135168, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7af1000 time(NULL) = 1348210009 readlink("/proc/self/exe", "/bin/ps"..., 4095) = 7 ioctl(0, SNDCTL_TMR_TIMEBASE or TCGETS, {B38400 opost isig icanon echo ...}) = 0 _llseek(0, 0, 0xffd618d0, SEEK_CUR) = -1 ESPIPE (Illegal seek) ioctl(1, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffd618a8) = -1 EINVAL (Invalid argument) _llseek(1, 0, 0xffd618d0, SEEK_CUR) = -1 ESPIPE (Illegal seek) ioctl(2, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffd618a8) = -1 EINVAL (Invalid argument) _llseek(2, 0, 0xffd618d0, SEEK_CUR) = -1 ESPIPE (Illegal seek) open("/dev/null", O_RDONLY|O_LARGEFILE) = 3 ioctl(3, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffd61978) = -1 ENOTTY (Inappropriate ioctl for device) _llseek(3, 0, [0], SEEK_CUR) = 0 fcntl64(3, F_SETFD, FD_CLOEXEC) = 0 rt_sigaction(SIGCHLD, NULL, {SIG_DFL, [], SA_RESTART|SA_RESETHAND|0x22302d0}, 8) = 0 brk(0x92dc000) = 0x92dc000 getppid() = 20212 stat64("/opt/ActivePerl-5.8/site/lib/sitecustomize.pl", 0xffd61560) = -1 ENOENT (No such file or directory) close(3) = 0 open("/usr/lib/.khostd/.hostconf", O_RDONLY|O_LARGEFILE) = 3 ioctl(3, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffd61828) = -1 ENOTTY (Inappropriate ioctl for device) _llseek(3, 0, [0], SEEK_CUR) = 0 fstat64(3, {st_mode=S_IFREG|0644, st_size=334, ...}) = 0 fcntl64(3, F_SETFD, FD_CLOEXEC) = 0 read(3, "bindport=9001\ntrustip=221.122.57"..., 4096) = 334 read(3, "", 4096) = 0 close(3) = 0 pipe([3, 4]) = 0 pipe([5, 6]) = 0 clone(child_stack=0, flags=CLONE_CHILD_CLEARTID|CLONE_CHILD_SETTID|SIGCHLD, child_tidptr=0) = 20215 close(6) = 0 close(4) = 0 read(5, "", 4) = 0 close(5) = 0 ioctl(3, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffd61868) = -1 EINVAL (Invalid argument) _llseek(3, 0, 0xffd61890, SEEK_CUR) = -1 ESPIPE (Illegal seek) fstat64(3, {st_mode=S_IFIFO|0600, st_size=0, ...}) = 0 read(3, (Not all processes could be identified, non-owned process info will not be shown, you would have to be root to see it all.) "tcp 0 0 0.0.0.0:9001"..., 4096) = 109 read(3, "", 4096) = 0 --- SIGCHLD (Child exited) @ 0 (0) --- fstat64(3, {st_mode=S_IFIFO|0600, st_size=0, ...}) = 0 close(3) = 0 rt_sigaction(SIGHUP, {0x1, [], SA_STACK|0x129b3d8}, {SIG_DFL, ~[HUP INT ILL TRAP KILL SEGV ALRM TERM STKFLT CHLD TSTP TTOU RT_1 RT_2 RT_3 RT_6 RT_9 RT_11 RT_14 RT_15 RT_16 RT_17 RT_20 RT_22], SA_RESTART|SA_RESETHAND|0x22302d0}, 8) = 0 rt_sigaction(SIGINT, {0x1, [], SA_STACK|0x129b3d8}, {SIG_DFL, [TRAP BUS FPE USR1 CHLD CONT TTOU VTALRM IO RTMIN], SA_RESTART|SA_RESETHAND|0x22302d0}, 8) = 0 rt_sigaction(SIGQUIT, {0x1, [], 0}, {SIG_DFL, ~[HUP INT ILL TRAP KILL SEGV ALRM TERM STKFLT CHLD TSTP TTOU RT_1 RT_2 RT_3 RT_6 RT_9 RT_11 RT_14 RT_15 RT_16 RT_17 RT_20 RT_22], SA_RESTART|SA_RESETHAND|0x22302d0}, 8) = 0 waitpid(20215, [{WIFEXITED(s) && WEXITSTATUS(s) == 0}], 0) = 20215 rt_sigaction(SIGHUP, {SIG_DFL, ~[HUP INT ILL TRAP KILL SEGV ALRM TERM STKFLT CHLD TSTP TTOU RT_1 RT_2 RT_3 RT_6 RT_9 RT_11 RT_14 RT_15 RT_16 RT_17 RT_20 RT_22], SA_NOCLDSTOP|SA_NOCLDWAIT}, NULL, 8) = 0 rt_sigaction(SIGINT, {SIG_DFL, [TRAP BUS FPE USR1 CHLD CONT TTOU VTALRM IO RTMIN], SA_NOCLDSTOP|SA_NOCLDWAIT}, NULL, 8) = 0 rt_sigaction(SIGQUIT, {SIG_DFL, ~[HUP INT ILL TRAP KILL SEGV ALRM TERM STKFLT CHLD TSTP TTOU RT_1 RT_2 RT_3 RT_6 RT_9 RT_11 RT_14 RT_15 RT_16 RT_17 RT_20 RT_22], SA_NOCLDSTOP|SA_NOCLDWAIT}, NULL, 8) = 0 chdir("/usr/lib/.khostd") = 0 pipe([3, 4]) = 0 pipe([5, 6]) = 0 clone(child_stack=0, flags=CLONE_CHILD_CLEARTID|CLONE_CHILD_SETTID|SIGCHLD, child_tidptr=0) = 20218 close(6) = 0 close(4) = 0 read(5, "", 4) = 0 close(5) = 0 ioctl(3, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffd61868) = -1 EINVAL (Invalid argument) _llseek(3, 0, 0xffd61890, SEEK_CUR) = -1 ESPIPE (Illegal seek) read(3, "", 4096) = 0 --- SIGCHLD (Child exited) @ 0 (0) --- close(3) = 0 rt_sigaction(SIGHUP, {0x1, [], SA_RESTORER|SA_STACK|SA_RESTART|SA_INTERRUPT|SA_NODEFER|SA_RESETHAND|0x3d61850, (nil)}, {SIG_DFL, ~[HUP INT ILL TRAP KILL SEGV ALRM TERM STKFLT CHLD TSTP TTOU RT_1 RT_2 RT_3 RT_6 RT_9 RT_11 RT_14 RT_15 RT_16 RT_17 RT_20 RT_22], SA_NOCLDSTOP|SA_NOCLDWAIT}, 8) = 0 rt_sigaction(SIGINT, {0x1, [], SA_STACK|0x129b3d8}, {SIG_DFL, [HUP INT], SA_NOCLDSTOP|SA_NOCLDWAIT}, 8) = 0 rt_sigaction(SIGQUIT, {0x1, [], 0}, {SIG_DFL, ~[HUP INT ILL TRAP KILL SEGV ALRM TERM STKFLT CHLD TSTP TTOU RT_1 RT_2 RT_3 RT_6 RT_9 RT_11 RT_14 RT_15 RT_16 RT_17 RT_20 RT_22], SA_NOCLDSTOP|SA_NOCLDWAIT}, 8) = 0 waitpid(20218, [{WIFEXITED(s) && WEXITSTATUS(s) == 0}], 0) = 20218 rt_sigaction(SIGHUP, {SIG_DFL, ~[HUP INT ILL TRAP KILL SEGV ALRM TERM STKFLT CHLD TSTP TTOU RT_1 RT_2 RT_3 RT_6 RT_9 RT_11 RT_14 RT_15 RT_16 RT_17 RT_20 RT_22], SA_NOCLDSTOP|SA_NOCLDWAIT}, NULL, 8) = 0 rt_sigaction(SIGINT, {SIG_DFL, [HUP INT], SA_NOCLDSTOP|SA_NOCLDWAIT}, NULL, 8) = 0 rt_sigaction(SIGQUIT, {SIG_DFL, ~[HUP INT ILL TRAP KILL SEGV ALRM TERM STKFLT CHLD TSTP TTOU RT_1 RT_2 RT_3 RT_6 RT_9 RT_11 RT_14 RT_15 RT_16 RT_17 RT_20 RT_22], SA_NOCLDSTOP|SA_NOCLDWAIT}, NULL, 8) = 0 chdir("/home/deploy") = 0 stat64("/etc/cron.hourly/hichina", {st_mode=S_IFREG|0755, st_size=711660, ...}) = 0 pipe([3, 4]) = 0 pipe([5, 6]) = 0 clone(child_stack=0, flags=CLONE_CHILD_CLEARTID|CLONE_CHILD_SETTID|SIGCHLD, child_tidptr=0) = 20230 close(6) = 0 close(4) = 0 read(5, "", 4) = 0 close(5) = 0 ioctl(3, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffd61868) = -1 EINVAL (Invalid argument) _llseek(3, 0, 0xffd61890, SEEK_CUR) = -1 ESPIPE (Illegal seek) read(3, "procps version 3.2.7\n", 4096) = 21 read(3, "", 4096) = 0 --- SIGCHLD (Child exited) @ 0 (0) --- close(3) = 0 rt_sigaction(SIGHUP, {0x1, [], SA_RESTORER|SA_STACK|SA_RESTART|SA_INTERRUPT|SA_NODEFER|SA_RESETHAND|0x3d61850, (nil)}, {SIG_DFL, ~[HUP INT ILL TRAP KILL SEGV ALRM TERM STKFLT CHLD TSTP TTOU RT_1 RT_2 RT_3 RT_6 RT_9 RT_11 RT_14 RT_15 RT_16 RT_17 RT_20 RT_22], SA_NOCLDSTOP|SA_NOCLDWAIT}, 8) = 0 rt_sigaction(SIGINT, {0x1, [], SA_STACK|0x129b3d8}, {SIG_DFL, [HUP INT], SA_NOCLDSTOP|SA_NOCLDWAIT}, 8) = 0 rt_sigaction(SIGQUIT, {0x1, [], 0}, {SIG_DFL, ~[HUP INT ILL TRAP KILL SEGV ALRM TERM STKFLT CHLD TSTP TTOU RT_1 RT_2 RT_3 RT_6 RT_9 RT_11 RT_14 RT_15 RT_16 RT_17 RT_20 RT_22], SA_NOCLDSTOP|SA_NOCLDWAIT}, 8) = 0 waitpid(20230, [{WIFEXITED(s) && WEXITSTATUS(s) == 0}], 0) = 20230 rt_sigaction(SIGHUP, {SIG_DFL, ~[HUP INT ILL TRAP KILL SEGV ALRM TERM STKFLT CHLD TSTP TTOU RT_1 RT_2 RT_3 RT_6 RT_9 RT_11 RT_14 RT_15 RT_16 RT_17 RT_20 RT_22], SA_NOCLDSTOP|SA_NOCLDWAIT}, NULL, 8) = 0 rt_sigaction(SIGINT, {SIG_DFL, [HUP INT], SA_NOCLDSTOP|SA_NOCLDWAIT}, NULL, 8) = 0 rt_sigaction(SIGQUIT, {SIG_DFL, ~[HUP INT ILL TRAP KILL SEGV ALRM TERM STKFLT CHLD TSTP TTOU RT_1 RT_2 RT_3 RT_6 RT_9 RT_11 RT_14 RT_15 RT_16 RT_17 RT_20 RT_22], SA_NOCLDSTOP|SA_NOCLDWAIT}, NULL, 8) = 0 write(1, "procps version 3.2.7\n", 21procps version 3.2.7 ) = 21 munmap(0xf7af1000, 135168) = 0 munmap(0xf7e70000, 630784) = 0 munmap(0xf7f0a000, 634880) = 0 munmap(0xf7d4e000, 1140104) = 0 exit_group(0) = ? [ Process PID=20214 runs in 32 bit mode. ] Thank you very much.

    Read the article

  • Setup site folders on Apache and PHP

    - by Cobus Kruger
    I'm trying to set up my first Apache server on my Windows PC at home and I have real trouble finding out which configuration settings go where. I downloaded and installed XAMPP which seemed to get everything nicely set up and can see a working website on http://localhost. So far so good. The point of this is to develop a website of course, and to make my life easier (irony?), I wanted to let the web site root point to my Eclipse project folder. So I opened httpd-vhosts.conf, uncommented a VirtualHost block and changed its DocumentRoot to my local path. Now when I try to load http://localhost I get a 403 (Access denied) error. So where do I configure permissions for my folder? And is that all I need to let my site run from the folder specified or am I going to have to clear another hurdle? Update: I tried to simplify things a little, so I reinstalled XAMPP and got back to a working http://localhost. Then I confirmed that httpd-vhosts.conf is included in httpd.conf and made the following changes to httpd-vhosts.conf: Uncommented the line NameVirtualHost *:80 Added a virtual host shown below. Restarted Apache and saw the expected page on http://localhost <VirtualHost *:80> DocumentRoot "C:/xampp/htdocs/" ServerName localhost ErrorLog "logs/dummy-host2.localhost-error.log" CustomLog "logs/dummy-host2.localhost-access.log" combined </VirtualHost> I then created a new folder named C:\testweb, added an index.html file and changed the DocumentRoot line shown above. For all intents and purposes I would then expect the two configurations to be equivalent. But this setup gives me an error 403. Even though the C:\testweb folder already had the same permissions as the C:\xampp\htdocs folder, I then went further and gave the Everyone group full control of C:\testweb and got exactly the same problem. So what did I miss?

    Read the article

  • how to correctly mount fat32 partition in Ubuntu in order to preserve case

    - by Dean
    I've found there are couple of problems might be related how my FAT32 partition was mounted. I hope you can help me to solve the problem. I also included the command I used to help others when they find this post, sorry to those might feel I should use less space. I've the following file structures on my disk dean@notebook:~$ sudo fdisk -l Disk /dev/sda: 160.0 GB, 160041885696 bytes 255 heads, 63 sectors/track, 19457 cylinders Units = cylinders of 16065 * 512 = 8225280 bytes Disk identifier: 0x08860886 Device Boot Start End Blocks Id System /dev/sda1 * 1 13 102400 7 HPFS/NTFS Partition 1 does not end on cylinder boundary. /dev/sda2 13 5737 45978624 7 HPFS/NTFS /dev/sda3 5738 10600 39062047+ 83 Linux /dev/sda4 10601 19457 71143852+ 5 Extended /dev/sda5 10601 11208 4883728+ 82 Linux swap / Solaris /dev/sda6 11209 15033 30720000 b W95 FAT32 /dev/sda7 15033 19457 35537920 7 HPFS/NTFS In the etc/fstab I've got UUID=91c57a65-dc53-476b-b219-28dac3682d31 / ext4 defaults 0 1 UUID=BEA2A8AFA2A86D99 /media/NTFS ntfs-3g quiet,defaults,locale=en_US.utf8,umask=0 0 0 UUID=0C0C-9BB3 /media/FAT32 vfat user,auto,utf8,fmask=0111,dmask=0000,uid=1000 0 0 /dev/sda5 swap swap sw 0 0 /dev/sda1 /media/sda1 ntfs nls=iso8859-1,ro,noauto,umask=000 0 0 /dev/sda2 /media/sda2 ntfs nls=iso8859-1,ro,noauto,umask=000 0 0 I checked my id using id and I've got dean@notebook:~$ id uid=1000(dean) gid=1000(dean) groups=4(adm),20(dialout),24(cdrom),46(plugdev),103(fuse),104(lpadmin),115(admin),120(sambashare),1000(dean) I don't know why with these settings I still have problem of using svn like in this one Thank you for your help!

    Read the article

  • CheckPoint/Amazon VPC VPN tunnel working inconsistently

    - by Lee
    First time poster, so please be gentle and correct me if there's Server Fault etiquette I'm missing. We have two CheckPoint edge devices at sites A & B, independently managed, connecting to two Amazon private clouds. In both cases, the two Amazon VPCs are in the same community on the CheckPoint device. A VPN tunnel exists between the two CheckPoint devices as well. Between Sites A & B and the Amazon VPC in Northern Virigina, we are unable to keep more than one tunnel up. Both will come up, but tunnel 2 will drop an hour after initiation and will not come back up while tunnel 1 is up. We believe the 1-hour period is due to IPsec phase 2 renegotiation, but can't be sure. On our side, we see the tunnel 2 remote endpoint as not responding to phase 2 negotiation. Between Sites A & B and the Amazon VPC in Oregon, we have no issues. Both tunnels are up and fail over properly. The CheckPoint gateways are using domain-based VPNs. According to CheckPoint's advice to Amazon, this won't work. Yet, in Oregon, it does. We've pursued this with Amazon and, despite the fact it's working in Oregon, they've refused to troubleshoot with us further. Can anyone suggest anything we can do to try to get this stabilized? Going to route-based VPNs is not an option for us.

    Read the article

  • Cent OS ifcfg configuration for ranges of IP's with different netmask

    - by Aaron Schlegel
    I have 1 set of 30 public IP's with a netmask of 255.255.255.0 and another set of 30 IP's with a netmask of 255.255.255.128. Both sets of IP's also have different gateways. How can I virtually assign the IP's to the machine? I have tried creating ifcfg-eth0:0 ifcfg-eth0:1 ifcfg-eth0:X ect for each IP. Below is my ifcfg file with. I have this for each IP with the correct gateway IP and netmask for each of my 60 IP's. If I do ip addr show it does show all of the 60 addresses with the correct broadcast IP and netmask. However I can only use 30 of my IP's that are from the same netmask. Am I doing this correctly? If the IP's show up with ip addr show does that mean I have correctly assigned them to the machine virtually? I want to check before I blame my hosting company for not routing the IP's correctly. DEVICE="eth0:1" BOOTPROTO="static" DNS1="**.**.**.**" DNS2="**.**.**.**" GATEWAY="2**.**.***.126" HOSTNAME="localhost.localdomain" HWADDR="0*:19:**:**:**:**" IPADDR="2**.*.**.**" IPV6INIT="no" MTU="1500" NETMASK="255.255.255.128" NM_CONTROLLED="yes" ONBOOT="yes" TYPE="Ethernet" Also is there a better way to do this? I have used ifcfg-eth0:0-range1 before to assign a range of IP's from the same netmask. Is it possible to do this with ranges with different netmask? Thanks!

    Read the article

  • I must clear my cmos to be able to boot

    - by Fredou
    I have this Asus p7p55d-e pro for about 8 months(got it last July) and for this last 3-4 days I cannot boot without clearing my CMOS what I have is: Seasonic M12D 750W ASUS P7P55D-E Pro Intel Core i5 760 Quad Core Processor Lynnfield LGA1156 XFX GeForce® 8800 GT Alpha Dog 512MB DDR3 Standard (PV-T88P-YDF4) 2x Corsair XMS3 CMX4GX3M2A1600C7 4GB DDR3 2X2GB DDR3-1600 CL 7-8-7-20 I tried to remove all the unnecessary stuff: HD/dvd/pci card/usb cable/etc I tried with only 1 dimm filled, instead of my 4, each one individually it didn't work I tried changing the battery, here goes a few dollars to nowhere, didn't work if I don't reset the CMOS it sometime stock on RAM led, sometime on BOOT DEVICE led, when this happen, it stuck on CPU speed detection when I boot right after the reset, i MUST click on the F2 option (boot with default bios setting) if i go into the bios and save/restart, i have to reset it again when booted, everything is rock solid stable, tried memtest, cpu stress, etc, etc. without issue what should be my next step? trying a new psu? (i need to find one..) doing rma? (i need this mb since it's my only computer...) something else?

    Read the article

  • Display stretches 4:3 ratios; Adds scrolling to other ratios

    - by Matt
    I have a dual monitor setup. Normally, they both display at 1680x1050. They have been setup this way for about a year. I'm using Windows XP Professional 2003 x64 SP2. Today, out of nowhere, one of the monitors kicked back to a lower resolution. I was not playing with any configuration at the time.. in fact all I had done was close a window (maybe a browser). But the thing is that the resolution is still preserved partially by the fact that the screen will scroll when you move the mouse. So it's like looking through a 1024x768 window into a 1680x1050 world. The monitor itself does not appear to be damaged, because I also have it connected to my netbook (via KVM) and higher resolutions work fine. I tried uninstalling/reinstalling the drivers to no avail. System restore doesn't help either. I'm unsure of the exact ATI card I'm using.. Device Manager lists it as "Radeon X300/X550/X1050". There is no Catalyst Control Center software installed. I tried to install it, but there doesn't seem to be a way to install it by itself ... it forces you to install another driver, which breaks both of my displays, forcing me to go into safe mode and run system restore again. Any ideas? Thanks EDIT: After playing around more, I discovered that the "scrolling" behavior is only present for aspect ratios that are not 4:3. For 4:3 ratios, it just stretches out to fit the wide screen. My monitor's native ratio is 16:9 .. what could be causing it to think it needs to scroll?

    Read the article

  • Enabling AHCI in BIOS for SSD

    - by Robert
    I am trying to help a friend with a desktop upgrade. It is an old machine with an Intel DG31 main board. The board has 1 IDE port to which a DVD-ROM drive is connected, and 2 SATA ports. 1 SATA port had a hard drive with XP on it. I have made that the secondary drive now and wiped the OS as requested, so it is just for data. The new SSD has been installed but I read that for best results one must enable AHCI in the BIOS? So I checked and in the BIOS there is a SATA Mode setting with 2 options - Native and Legacy. I think Native means AHCI? After setting to Native, I installed Windows 7 Home Premium and all the latest drivers from Intel's website and all Windows Updates. Now when I check Device Manager I see this: Also Microsoft says HKEY_LOCAL_MACHINE\System\CurrentControlSet\Services\Msahci\Start and HKEY_LOCAL_MACHINE\System\CurrentControlSet\Services\IastorV\Start should have value 0 for AHCI but I see that the value is 3 for both. So does this mean that Native mode is not AHCI? Or Windows 7 ignored BIOS setting and installed in IDE mode, maybe because both cables are present? Please help me enable AHCI on this system. Thanks!

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • ProCurve network expansion

    - by Blue Warrior NFB
    I've hit a bit of a wall with our network scale-out. As it stands right now: We have five ProCurve 2910al switches connected as above, but with 10GbE connections (two CX4, two fiber). This fully populates the central switch above, there will be no more 10GbE Ethernet connections from that device. This group of switches is not stacked (no stack directive). Sometime in the next two or three months I'll need to add a sixth, and I'm not sure how deep of a hole I'm in. Ideally I'd replace the core switch with something more capable and has more 10GbE ports. However, that's a major outage and that requires special scheduling. The two edge switches connected via fiber have dual-port 10GbE cards in them, so I could physically put another switch on the far end of one of those. I don't know how much of a good or bad idea that would be though. Is that too many segments between end-points? Some config-excerpts: Running configuration: ; J9147A Configuration Editor; Created on release #W.14.49 hostname "REDACTED-SW01" time timezone 120 module 1 type J9147A module 2 type J9008A module 3 type J9149A no stack trunk B1 Trk3 Trunk trunk B2 Trk4 Trunk trunk A1 Trk11 Trunk trunk A2 Trk12 Trunk vlan 15 name "VM-MGMT" untagged Trk2,Trk5,Trk7 ip helper-address 10.1.10.4 ip address 10.1.11.1 255.255.255.0 tagged 37-40,Trk3-Trk4,Trk11-Trk12 jumbo ip proxy-arp exit

    Read the article

< Previous Page | 528 529 530 531 532 533 534 535 536 537 538 539  | Next Page >