Search Results

Search found 14548 results on 582 pages for 'const reference'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 540/582 | < Previous Page | 536 537 538 539 540 541 542 543 544 545 546 547  | Next Page >

  • Deserialization error in a new environment

    - by cerhart
    I have a web application that calls a third-party web service. When I run it locally, I have no problems, but when I move it to my production environment, I get the following error: There is an error in XML document (2, 428). Stack: at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle, XmlDeserializationEvents events) at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle) at System.Web.Services.Protocols.SoapHttpClientProtocol.ReadResponse(SoapClientMessage message, WebResponse response, Stream responseStream, Boolean asyncCall) at System.Web.Services.Protocols.SoapHttpClientProtocol.Invoke(String methodName, Object[] parameters) at RMXClasses.RMXContactService.ContactService.getActiveSessions(String user, String pass) in C:\Users\hp\Documents\Visual Studio 2008\Projects\ReklamStore\RMXClasses\Web References\RMXContactService\Reference.cs:line 257 at I have used the same web config file from the production environment but it still works locally. My local machine is a running vista home edition and the production environment is windows server 2003. The application is written in asp.net 3.5, wierdly under the asp.net config tab in iis, 3.5 doesn't show up in the drop down list, although that version of the framework is installed. The error is not being thrown in my code, it happens during serialization. I called the method on the proxy, I have checked the arguments and they are OK. I have also logged the SOAP request and response, and they both look OK as well. I am really at a loss here. Any ideas? SOAP log: This is the soap response that the program seems to have trouble parsing only on server 2003. On my machine the soap is identical, and yet it parses with no problems. SoapResponse BeforeDeserialize; <?xml version="1.0" encoding="UTF-8"?> <SOAP-ENV:Envelope xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/" xmlns:ns1="urn:ContactService" xmlns:ns2="http://api.yieldmanager.com/types" xmlns:SOAP-ENC="http://schemas.xmlsoap.org/soap/encoding/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" SOAP-ENV:encodingStyle="http://schemas.xmlsoap.org/soap/encoding/"><SOAP-ENV:Body><ns1:getActiveSessionsResponse> <sessions SOAP-ENC:arrayType="ns2:session[1]" xsi:type="ns2:array_of_session"> <item xsi:type="ns2:session"> <token xsi:type="xsd:string">xxxxxxxxxxxxxxxxxxxx1ae12517584b</token> <creation_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</creation_time> <modification_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</modification_time> <ip_address xsi:type="xsd:string">xxxxxxxxxx</ip_address> <contact_id xsi:type="xsd:long">xxxxxx</contact_id></item></sessions> </ns1:getActiveSessionsResponse></SOAP-ENV:Body></SOAP-ENV:Envelope>

    Read the article

  • Ajax problem after deleting a div, then creating a new one

    - by Matt Nathanson
    I'm building a custom CMS where you can add and delete clients using ajax and jquery 1.4.2. My problem lies after I delete a div. The ajax is used to complete this and refresh automatically.. But when I go to create a new div (without a hard refresh) it puts it back in the slot of the div I just deleted. How can I get this to completely forget about the div i just deleted and place the new div in the next database table? link for reference: http://staging.sneakattackmedia.com/cms/ //Add New client // function AddNewClient() { dataToLoad = 'addClient=yes'; $.ajax({ type: 'post', url: '/clients/controller.php', datatype: 'html', data: dataToLoad, target: ('#clientssidebar'), async: false, success: function(html){ $(this).click(function() {reInitialize()}); //$('#clientssidebar').html(html); $('div#' + clientID).slideDown(800); $(this).click(function() { ExpandSidebar()});}, error: function() { alert('An error occured! 222');} });}; //Delete Client // function DeleteClient(){ var yes = confirm("Whoa there chief! Do you really want to DELETE this client?"); if (yes == 1) { dataToLoad = 'clientID=' + clientID + '&deleteClient=yes', $.ajax({ type: 'post', url: '/clients/controller.php', datatype: 'html', data: dataToLoad, success: function(html) { alert('Client' + clientID + ' should have been deleted from the database.'); $(this).click(function() {reInitialize()}); $('div#' +clientID).slideUp(800); }, error: function() { alert('error'); }});};}; //Re Initialize // function reInitialize() { $('#addnew').click(function() {AddNewClient()}); $('.deletebutton').click(function() {clientID = $(this).parent().attr('id'); DeleteClient()}) $('.clientblock').click(function() {clientID = $(this).attr('id'); ExpandSidebar()});}; //Document Ready // $(document).ready(function(){ if ($('isCMS')){ editCMS = 1; $('.deletebutton').click(function() {clientID = $(this).parent().attr('id'); DeleteClient()}); $('#addnew').click(function() {AddNewClient()}); $('.clientblock').click(function() {clientID = $(this).attr('id'); ExpandSidebar()}); $('.clientblock').click(function() {if (clickClient ==true) { $(this).css('background-image', 'url(/images/highlightclient.png)'); $(this).css('margin-left' , '30px'); }; $(this).click(function(){ $(this).css('background-image', ''); }); $('.uploadbutton').click(function(){UploadThings()}); }); } else ($('#clientscontainer')) { $('#editbutton').css('display', 'none'); }; }); Please help!!!

    Read the article

  • Why is my namespace not recognized in Visual Studio / xaml

    - by msfanboy
    Hello, these are my 2 classes a Attachable Property SelectedItems: code is from here: http://stackoverflow.com/questions/1297643/sync-selecteditems-in-a-muliselect-listbox-with-a-collection-in-viewmodel The namespace TBM.Helper is for sure proper as it works for other classes too. The namespace reference is also in the xaml file: xmlns:Helper="clr_namespace:TBM.Helper" But <ListBox Helper:SelectedItems.Items="{Binding SelectedItems}" ... does not work because = The property 'SelectedItems.Items' does not exist in XML namespace 'clr_namespace:TBM.Helper'. The attachable property 'Items' was not found in type 'SelectedItems What do I have to change ? using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Windows.Controls; using System.Collections; using System.Windows; namespace TBM.Helper { public static class SelectedItems : DependencyObject { private static readonly DependencyProperty SelectedItemsBehaviorProperty = DependencyProperty.RegisterAttached( "SelectedItemsBehavior", typeof(SelectedItemsBehavior), typeof(ListBox), null); public static readonly DependencyProperty ItemsProperty = DependencyProperty.RegisterAttached( "Items", typeof(IList), typeof(SelectedItems), new PropertyMetadata(null, ItemsPropertyChanged)); public static void SetItems(ListBox listBox, IList list) { listBox.SetValue(ItemsProperty, list); } public static IList GetItems(ListBox listBox) { return listBox.GetValue(ItemsProperty) as IList; } private static void ItemsPropertyChanged(DependencyObject d, DependencyPropertyChangedEventArgs e) { var target = d as ListBox; if (target != null) { GetOrCreateBehavior(target, e.NewValue as IList); } } private static SelectedItemsBehavior GetOrCreateBehavior(ListBox target, IList list) { var behavior = target.GetValue(SelectedItemsBehaviorProperty) as SelectedItemsBehavior; if (behavior == null) { behavior = new SelectedItemsBehavior(target, list); target.SetValue(SelectedItemsBehaviorProperty, behavior); } return behavior; } } } using System.Windows; using System.Windows.Controls; using System.Collections; namespace TBM.Helper { public class SelectedItemsBehavior { private readonly ListBox _listBox; private readonly IList _boundList; public SelectedItemsBehavior(ListBox listBox, IList boundList) { _boundList = boundList; _listBox = listBox; SetSelectedItems(); _listBox.SelectionChanged += OnSelectionChanged; _listBox.DataContextChanged += OnDataContextChanged; } private void SetSelectedItems() { _listBox.SelectedItems.Clear(); foreach (object item in _boundList) { // References in _boundList might not be the same as in _listBox.Items int i = _listBox.Items.IndexOf(item); if (i >= 0) _listBox.SelectedItems.Add(_listBox.Items[i]); } } private void OnDataContextChanged(object sender, DependencyPropertyChangedEventArgs e) { SetSelectedItems(); } private void OnSelectionChanged(object sender, SelectionChangedEventArgs e) { _boundList.Clear(); foreach (var item in _listBox.SelectedItems) _boundList.Add(item); } } }

    Read the article

  • A better UPDATE method in LINQ to SQL

    - by Refracted Paladin
    The below is a typical, for me, Update method in L2S. I am still fairly new to a lot of this(L2S & business app development) but this just FEELs wrong. Like there MUST be a smarter way of doing this. Unfortunately, I am having trouble visualizing it and am hoping someone can provide an example or point me in the right direction. To take a stab in the dark, would I have a Person Object that has all these fields as Properties? Then what, though? Is that redundant since L2S already mapped my Person Table to a Class? Is this just 'how it goes', that you eventually end up passing 30 parameters(or MORE) to an UPDATE statement at some point? For reference, this is a business app using C#, WinForms, .Net 3.5, and L2S over SQL 2005 Standard. Here is a typical Update Call for me. This is in a file(BLLConnect.cs) with other CRUD methods. Connect is the name of the DB that holds tblPerson When a user clicks save() this is what is eventually called with all of these fields having, potentially, been updated-- public static void UpdatePerson(int personID, string userID, string titleID, string firstName, string middleName, string lastName, string suffixID, string ssn, char gender, DateTime? birthDate, DateTime? deathDate, string driversLicenseNumber, string driversLicenseStateID, string primaryRaceID, string secondaryRaceID, bool hispanicOrigin, bool citizenFlag, bool veteranFlag, short ? residencyCountyID, short? responsibilityCountyID, string emailAddress, string maritalStatusID) { using (var context = ConnectDataContext.Create()) { var personToUpdate = (from person in context.tblPersons where person.PersonID == personID select person).Single(); personToUpdate.TitleID = titleID; personToUpdate.FirstName = firstName; personToUpdate.MiddleName = middleName; personToUpdate.LastName = lastName; personToUpdate.SuffixID = suffixID; personToUpdate.SSN = ssn; personToUpdate.Gender = gender; personToUpdate.BirthDate = birthDate; personToUpdate.DeathDate = deathDate; personToUpdate.DriversLicenseNumber = driversLicenseNumber; personToUpdate.DriversLicenseStateID = driversLicenseStateID; personToUpdate.PrimaryRaceID = primaryRaceID; personToUpdate.SecondaryRaceID = secondaryRaceID; personToUpdate.HispanicOriginFlag = hispanicOrigin; personToUpdate.CitizenFlag = citizenFlag; personToUpdate.VeteranFlag = veteranFlag; personToUpdate.ResidencyCountyID = residencyCountyID; personToUpdate.ResponsibilityCountyID = responsibilityCountyID; personToUpdate.EmailAddress = emailAddress; personToUpdate.MaritalStatusID = maritalStatusID; personToUpdate.UpdateUserID = userID; personToUpdate.UpdateDateTime = DateTime.Now; context.SubmitChanges(); } }

    Read the article

  • How to handle ordering of @Rule's when they are dependant on eachother

    - by Lennart Schedin
    I use embedded servers that run inside Junit test cases. Sometimes these servers require a working directory (for example the Apache Directory server). The new @Rule in Junit 4.7 can handle these cases. The TemporaryFolder-Rule can create a temporary directory. A custom ExternalResource-Rule can be created for server. But how do I handle if I want to pass the result from one rule into another: import static org.junit.Assert.assertEquals; import java.io.*; import org.junit.*; import org.junit.rules.*; public class FolderRuleOrderingTest { @Rule public TemporaryFolder folder = new TemporaryFolder(); @Rule public MyNumberServer server = new MyNumberServer(folder); @Test public void testMyNumberServer() throws IOException { server.storeNumber(10); assertEquals(10, server.getNumber()); } /** Simple server that can store one number */ private static class MyNumberServer extends ExternalResource { private TemporaryFolder folder; /** The actual datafile where the number are stored */ private File dataFile; public MyNumberServer(TemporaryFolder folder) { this.folder = folder; } @Override protected void before() throws Throwable { if (folder.getRoot() == null) { throw new RuntimeException("TemporaryFolder not properly initialized"); } //All server data are stored to a working folder File workingFolder = folder.newFolder("my-work-folder"); dataFile = new File(workingFolder, "datafile"); } public void storeNumber(int number) throws IOException { dataFile.createNewFile(); DataOutputStream out = new DataOutputStream(new FileOutputStream(dataFile)); out.writeInt(number); } public int getNumber() throws IOException { DataInputStream in = new DataInputStream(new FileInputStream(dataFile)); return in.readInt(); } } } In this code the folder is sent as a parameter into the server so that the server can create a working directory to store data. However this does not work because Junit processes the rules in reverse order as they are defined in the file. The TemporaryFolder Rule will not be executed before the server Rule. Thus the root-folder in TempraryFolder will be null, resulting that any files are created relative to the current working directory. If I reverse the order of the attributes in my class I get a compile error because I cannot reference a variable before it is defined. I'm using Junit 4.8.1 (because the ordering of rules was fixed a bit from the 4.7 release)

    Read the article

  • Are there supposed to be more restrictions on operator->* overloads?

    - by Potatoswatter
    I was perusing section 13.5 after refuting the notion that built-in operators do not participate in overload resolution, and noticed that there is no section on operator->*. It is just a generic binary operator. Its brethren, operator->, operator*, and operator[], are all required to be non-static member functions. This precludes definition of a free function overload to an operator commonly used to obtain a reference from an object. But the uncommon operator->* is left out. In particular, operator[] has many similarities. It is binary (they missed a golden opportunity to make it n-ary), and it accepts some kind of container on the left and some kind of locator on the right. Its special-rules section, 13.5.5, doesn't seem to have any actual effect except to outlaw free functions. (And that restriction even precludes support for commutativity!) So, for example, this is perfectly legal (in C++0x, remove obvious stuff to translate to C++03): #include <utility> #include <iostream> #include <type_traits> using namespace std; template< class F, class S > typename common_type< F,S >::type operator->*( pair<F,S> const &l, bool r ) { return r? l.second : l.first; } template< class T > T & operator->*( pair<T,T> &l, bool r ) { return r? l.second : l.first; } template< class T > T & operator->*( bool l, pair<T,T> &r ) { return l? r.second : r.first; } int main() { auto x = make_pair( 1, 2.3 ); cerr << x->*false << " " << x->*4 << endl; auto y = make_pair( 5, 6 ); y->*(0) = 7; y->*0->*y = 8; // evaluates to 7->*y = y.second cerr << y.first << " " << y.second << endl; } I can certainly imagine myself giving into temp[la]tation. For example, scaled indexes for vector: v->*matrix_width[5] = x; Did the standards committee forget to prevent this, was it considered too ugly to bother, or are there real-world use cases?

    Read the article

  • .NET and C# Exceptions. What is it reasonable to catch.

    - by djna
    Disclaimer, I'm from a Java background. I don't do much C#. There's a great deal of transfer between the two worlds, but of course there are differences and one is in the way Exceptions tend to be thought about. I recently answered a C# question suggesting that under some circstances it's reasonable to do this: try { some work } catch (Exeption e) { commonExceptionHandler(); } (The reasons why are immaterial). I got a response that I don't quite understand: until .NET 4.0, it's very bad to catch Exception. It means you catch various low-level fatal errors and so disguise bugs. It also means that in the event of some kind of corruption that triggers such an exception, any open finally blocks on the stack will be executed, so even if the callExceptionReporter fuunction tries to log and quit, it may not even get to that point (the finally blocks may throw again, or cause more corruption, or delete something important from the disk or database). May I'm more confused than I realise, but I don't agree with some of that. Please would other folks comment. I understand that there are many low level Exceptions we don't want to swallow. My commonExceptionHandler() function could reasonably rethrow those. This seems consistent with this answer to a related question. Which does say "Depending on your context it can be acceptable to use catch(...), providing the exception is re-thrown." So I conclude using catch (Exception ) is not always evil, silently swallowing certain exceptions is. The phrase "Until .NET 4 it is very bad to Catch Exception" What changes in .NET 4? IS this a reference to AggregateException, which may give us some new things to do with exceptions we catch, but I don't think changes the fundamental "don't swallow" rule. The next phrase really bothers be. Can this be right? It also means that in the event of some kind of corruption that triggers such an exception, any open finally blocks on the stack will be executed (the finally blocks may throw again, or cause more corruption, or delete something important from the disk or database) My understanding is that if some low level code had lowLevelMethod() { try { lowestLevelMethod(); } finally { some really important stuff } } and in my code I call lowLevel(); try { lowLevel() } catch (Exception e) { exception handling and maybe rethrowing } Whether or not I catch Exception this has no effect whatever on the excution of the finally block. By the time we leave lowLevelMethod() the finally has already run. If the finally is going to do any of the bad things, such as corrupt my disk, then it will do so. My catching the Exception made no difference. If It reaches my Exception block I need to do the right thing, but I can't be the cause of dmis-executing finallys

    Read the article

  • How To Load Images into Custom UITableViewCell?

    - by Clifton Burt
    This problem is simple, but crucial and urgent. Here's what needs to be done: load 66px x 66px images into the table cells in the MainViewController table. each TableCell has a unique image. But how? Would we use cell.image?... cell.image = [UIImage imageNamed:@"image.png"]; If so, where? Is an if/else statement required? Help? Here's the project code, hosted on Google Code, for easy and quick reference... http://www.google.com/codesearch/p?hl=en#Fcn2OtVUXnY/trunk/apple-sample-code/NavBar/NavBar/MyCustomCell.m&q=MyCustomCell%20lang:objectivec To load each cell's labels, MainViewController uses an NSDictionary and NSLocalizedString like so... //cell one menuList addObject:[NSDictionary dictionaryWithObjectsAndKeys: NSLocalizedString(@"PageOneTitle", @""), kTitleKey, NSLocalizedString(@"PageOneExplain", @""), kExplainKey, nil]]; //cell two menuList addObject:[NSDictionary dictionaryWithObjectsAndKeys: NSLocalizedString(@"PageOneTitle", @""), kTitleKey, NSLocalizedString(@"PageOneExplain", @""), kExplainKey, nil]]; ... // this is where MainViewController loads the cell content - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { MyCustomCell *cell = (MyCustomCell*)[tableView dequeueReusableCellWithIdentifier:kCellIdentifier]; if (cell == nil) { cell = [[[MyCustomCell alloc] initWithFrame:CGRectZero reuseIdentifier:kCellIdentifier] autorelease]; } ... // MyCustomCell.m adds the subviews - (id)initWithFrame:(CGRect)aRect reuseIdentifier:(NSString *)identifier { self = [super initWithFrame:aRect reuseIdentifier:identifier]; if (self) { // you can do this here specifically or at the table level for all cells self.accessoryType = UITableViewCellAccessoryDisclosureIndicator; // Create label views to contain the various pieces of text that make up the cell. // Add these as subviews. nameLabel = [[UILabel alloc] initWithFrame:CGRectZero]; // layoutSubViews will decide the final frame nameLabel.backgroundColor = [UIColor clearColor]; nameLabel.opaque = NO; nameLabel.textColor = [UIColor blackColor]; nameLabel.highlightedTextColor = [UIColor whiteColor]; nameLabel.font = [UIFont boldSystemFontOfSize:18]; [self.contentView addSubview:nameLabel]; explainLabel = [[UILabel alloc] initWithFrame:CGRectZero]; // layoutSubViews will decide the final frame explainLabel.backgroundColor = [UIColor clearColor]; explainLabel.opaque = NO; explainLabel.textColor = [UIColor grayColor]; explainLabel.highlightedTextColor = [UIColor whiteColor]; explainLabel.font = [UIFont systemFontOfSize:14]; [self.contentView addSubview:explainLabel]; //added to mark where the thumbnail image should go imageView = [[UIView alloc] initWithFrame:CGRectMake(0, 0, 66, 66)]; [self.contentView addSubview:imageView]; } return self; } HELP?

    Read the article

  • how to send put request with data as an xml element, from JavaScript ?

    - by Sarang
    Hi everyone, My data is an xml element & I want send PUT request with JavaScript. How do I do this ? For reference : Update Cell As per fredrik suggested, I did this : function submit(){ var xml = "<entry>" + "<id>https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1</id>" + "<link rel=\"edit\" type=\"application/atom+xml\"" + "href=\"https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/worksheetId/private/full/R2C1\"/>" + "<gs:cell row=\"2\" col=\"1\" inputValue=\"300\"/>" + "</entry>"; document.getElementById('submitForm').submit(xml); } </script> </head> <body> <form id="submitForm" method="put" action="https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1"> <input type="submit" value="submit" onclick="submit()"/> </form> However, it doesn't write back but positively it returns xml file like : <?xml version='1.0' encoding='UTF-8'?> <entry xmlns='http://www.w3.org/2005/Atom' xmlns:gs='http://schemas.google.com/spreadsheets/2006' xmlns:batch='http://schemas.google.com/gdata/batch'> <id>https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1</id> <updated>2011-01-11T07:35:09.767Z</updated> <category scheme='http://schemas.google.com/spreadsheets/2006' term='http://schemas.google.com/spreadsheets/2006#cell'/> <title type='text'>A2</title> <content type='text'></content> <link rel='self' type='application/atom+xml' href='https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1'/> <link rel='edit' type='application/atom+xml' href='https://spreadsheets.google.com/feeds/cells/0Aq69FHX3TV4ndDBDVFFETUFhamc5S25rdkNoRkd4WXc/od6/private/full/R2C1/1ekg'/> <gs:cell row='2' col='1' inputValue=''></gs:cell> </entry> Any further solution for the same ?

    Read the article

  • My mental block - struggling to learn Objective C

    - by iqessar
    Hello people, this would be my first question after signing up! Anyway heres my question, I did Java at university and I was always told I am a good programmer. However I never pursued it as a career - I went into support and management instead. Im pretty much bored with my job, I have therefore started to learn Objective C so that I can develop apps for the iphone. I am currently watching several different Videos / Books. My problem is that when I go through the Apple documentation, although I understand most of it, sometimes I stumble. I believe that because you/we have the Apple documentation (i.e. Framework references) , everything should be clear, and therefore you should have no need to refer to a book or video (in order to learn how to use a particular class). But I alway do refer to a book and video and subsequently feel guilty as I believe the framework reference should be enough. (I therefore feel I am not up to being a programmer) I also believe that you shouldn't need example code in order to learn how to use a particular class because Apple provides documentation for each class, but AGAIN I find my self googling example code and I find my answer like that - again I feel guilty for doing this. Am I right in saying that Apple documentation is simply not clear? and that its ok to refer to a video/book or google? or forums for that matter? I have proffesional programmers who tell me that I am worrying too much and that I should get on with it and use all the resources that I have. I just cant seem to get round this mental block that I have in my head. When I start a programming project I am able to use the excellent search skills that I have to find the code I need, copy and paste it (yes I do understand it) BUT then I feel guilty telling myself that why didn't you think up the code yourself???? Therefore your not a real programmer, your just good at googling. Currently I am going through 20+ books so that I can learn most of the frameworks, syntax etc to develop iphone apps. I believe if I do this, then when I think of a project I can make it quickly. Should I read a few books, like 2-3 and then just start a project /app , and if I get stuck just google it and get the code I need? Can anybody please answer my questions?

    Read the article

  • Memory Leak with Swing Drag and Drop

    - by tom
    I have a JFrame that accepts top-level drops of files. However after a drop has occurred, references to the frame are held indefinitely inside some Swing internal classes. I believe that disposing of the frame should release all of its resources, so what am I doing wrong? Example import java.awt.datatransfer.DataFlavor; import java.io.File; import java.util.List; import javax.swing.JFrame; import javax.swing.JLabel; import javax.swing.TransferHandler; public class DnDLeakTester extends JFrame { public static void main(String[] args) { new DnDLeakTester(); //Prevent main from returning or the jvm will exit while (true) { try { Thread.sleep(10000); } catch (InterruptedException e) { } } } public DnDLeakTester() { super("I'm leaky"); add(new JLabel("Drop stuff here")); setTransferHandler(new TransferHandler() { @Override public boolean canImport(final TransferSupport support) { return (support.isDrop() && support .isDataFlavorSupported(DataFlavor.javaFileListFlavor)); } @Override public boolean importData(final TransferSupport support) { if (!canImport(support)) { return false; } try { final List<File> files = (List<File>) support.getTransferable().getTransferData(DataFlavor.javaFileListFlavor); for (final File f : files) { System.out.println(f.getName()); } } catch (Exception e) { e.printStackTrace(); } return true; } }); setDefaultCloseOperation(DISPOSE_ON_CLOSE); pack(); setVisible(true); } } To reproduce, run the code and drop some files on the frame. Close the frame so it's disposed of. To verify the leak I take a heap dump using JConsole and analyse it with the Eclipse Memory Analysis tool. It shows that sun.awt.AppContext is holding a reference to the frame through its hashmap. It looks like TransferSupport is at fault. What am I doing wrong? Should I be asking the DnD support code to clean itself up somehow? I'm running JDK 1.6 update 19.

    Read the article

  • jquery, manipulate content inserted by ajax, without using the callback

    - by Cody
    I am using ajax to insert a series of informational blocks via a loop. The blocks each have a title, and long description in them that is hidden by default. They function like an accordion, only showing one description at a time amongst all of the blocks. The problem is opening the description on the first block. I would REALLY like to do it with javascript right after the loop that is creating them is done. Is it possible to manipulate elements created ofter an ajax call without using the callback? <!-- example code--> <style> .placeholder, .long_description{ display:none;} </style> </head><body> <script> /* yes, this script is in the body, dont know if it matters */ $(document).ready(function() { $(".placeholder").each(function(){ // Use the divs to get the blocks var blockname = $(this).html(); // the contents if the div is the ID for the ajax POST $.post("/service_app/dyn_block",'form='+blockname, function(data){ var divname = '#div_' + blockname; $(divname).after(data); $(this).setupAccrdFnctly(); //not the actual code }); }); /* THIS LINE IS THE PROBLEM LINE, is it possible to reference the code ajax inserted */ /* Display the long description in the first dyn_block */ $(".dyn_block").first().find(".long_description").addClass('active').slideDown('fast'); }); </script> <!-- These lines are generated by PHP --> <!-- It is POSSIBLE to display the dyn_blocks --> <!-- here but I would really rather not --> <div id="div_servicetype" class="placeholder">servicetype</div> <div id="div_custtype" class="placeholder">custtype</div> <div id="div_custinfo" class="placeholder">custinfo</div> <div id="div_businfo" class="placeholder">businfo</div> </body>

    Read the article

  • Losing data after reading them correct from file

    - by user1388172
    i have the fallowing class of object with a class a data structure which i use in main combined. The ADT(abstract data type) is a linked list. After i read from file the input data and create and object which at print looks just fine after a print. after i push_back() the 3-rd int variable get initializated to 0. So example and code: Example: ex.in: 1 7 31 2 2 2 3 3 3 now i create objects from each line, which at print look as they suppose, but after push_back(): 1 7 0 2 2 0 3 3 0 Class.h: class RAngle { private: int x,y,l,b; public: int solution,prec; RAngle(){ x = y = solution = prec = b = l =0; } RAngle(int i,int j,int k){ x = i; y = j; l = k; solution = 0; prec=0; b=0; } friend ostream& operator << (ostream& out, const RAngle& ra){ out << ra.x << " " << ra.y << " " << ra.l <<endl; return out; } friend istream& operator >>( istream& is, RAngle& ra){ is >> ra.x; is >> ra.y; is >> ra.l; return is ; } }; ADT.h: template <class T> class List { private: struct Elem { T data; Elem* next; }; Elem* first; T pop_front(){ if (first!=NULL) { T aux = first->data; first = first->next; return aux; } T a; return a; } void push_back(T data){ Elem *n = new Elem; n->data = data; n->next = NULL; if (first == NULL) { first = n; return ; } Elem *current; for(current=first;current->next != NULL;current=current->next); current->next = n; } Main.cpp(after i call this function in main which prints object as they suppose to be the x var(from RAngle class) changes to 0 in all cases.) void readData(List <RAngle> &l){ RAngle r; ifstream f_in; f_in.open("ex.in",ios::in); for(int i=0;i<10;++i){ f_in >> r; cout << r; l.push_back(r); }

    Read the article

  • LINQ Except operator and object equality

    - by Abhijeet Patel
    Here is an interesting issue I noticed when using the Except Operator: I have list of users from which I want to exclude some users: The list of users is coming from an XML file: The code goes like this: interface IUser { int ID { get; set; } string Name { get; set; } } class User: IUser { #region IUser Members public int ID { get; set; } public string Name { get; set; } #endregion public override string ToString() { return ID + ":" +Name; } public static IEnumerable<IUser> GetMatchingUsers(IEnumerable<IUser> users) { IEnumerable<IUser> localList = new List<User> { new User{ ID=4, Name="James"}, new User{ ID=5, Name="Tom"} }.OfType<IUser>(); var matches = from u in users join lu in localList on u.ID equals lu.ID select u; return matches; } } class Program { static void Main(string[] args) { XDocument doc = XDocument.Load("Users.xml"); IEnumerable<IUser> users = doc.Element("Users").Elements("User").Select (u => new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType<IUser>(); //still a query, objects have not been materialized var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes should contain 6 users but here it contains 8 users } } When I call User.GetMatchingUsers(users) I get 2 matches as expected. The issue is that when I call users.Except(matches) The matching users are not being excluded at all! I am expecting 6 users ut "excludes" contains all 8 users instead. Since all I'm doing in GetMatchingUsers(IEnumerable users) is taking the IEnumerable and just returning the IUsers whose ID's match( 2 IUsers in this case), my understanding is that by default "Except" will use reference equality for comparing the objects to be excluded. Is this not how "Except" behaves? What is even more interesting is that if I materialize the objects using .ToList() and then get the matching users, and call "Except", everything works as expected! Like so: IEnumerable users = doc.Element("Users").Elements("User").Select (u = new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType().ToList(); //explicity materializing all objects by calling ToList() var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes now contains 6 users as expected I don't see why I should need to materialize objects for calling "Except" given that its defined on IEnumerable? Any suggesstions / insights would be much appreciated.

    Read the article

  • Few doubts regarding Bitmaps , Images & `using` blocks

    - by imageWorker
    I caught up in this problem. http://stackoverflow.com/questions/2559826/garbage-collector-not-doing-its-job-memory-consumption-1-5gb-outofmemory-exc I feel that there is something wrong in my understanding. Please clarify these things. Destructor & IDisposable.Dispose are two methods for freeing resources that are not not under the control of .NET. Which means, everything except memory. right? using blocks are just better way of calling IDisposable.Dispose() method of an object. This is the main code I'm referring to. class someclass { static someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //statement1 // some code here and return } } here is class I'm using for testing: class someotherClass { public static voide Main() { foreach (string imagePath in imagePathsArray) { using (Bitmap img1 = new Bitmap(imagePath)) { someclass.someMethod(img1); // does some more processing on `img1` } } } } Is there any memory leak with statement1? Question1: If each image size is say 10MB. Then does this bmp object occupy atleast 10MB? What I mean is, will it make completely new copy of entire image? or just refer to it? Question2:should I or should I not put the statement1 in using block? My Argument: We should not. Because using is not for freeing memory but for freeing the resources (file handle in this case). If I use it in using block. It closes file handle here encapsulated by this bmp object. It means we are also closing filehandle for the caller's img1 object. Which is not correct? As of the memory leak. No there is no scope of memory leak here. Because reference bmp is destroyed when this method is returned. Which leaves memory it refered without any pointer. So, its garbage collected. Am I right? Edit: class someclass { static Bitmap someMethod(Bitmap img) { Bitmap bmp = new Bitmap(img); //can I use `using` block on this enclosing `return bmp`; ??? // do some processing on bmp here return bmp; } }

    Read the article

  • Programmatically Binding to a Property

    - by M312V
    I know it's a generic title, but my question is specific. I think it will boil down to a question of practice. So, I have the following code: public class Component : UIElement { public Component() { this.InputBindings.Add(new MouseBinding(SomeCommandProperty, new MouseGesture(MouseAction.LeftClick))); } } I could easily aggregate the ViewModel that owns SomeCommandProperty into the Component class, but I'm currently waiving that option assuming there is another way. Component is a child of ComponentCollection which is child of a Grid which DataContext is the ViewModel. ComponentCollection as the name suggests contains a collection of Components. <Grid Name="myGrid"> <someNamespace:ComponentCollection x:Name="componentCollection"/> </Grid> It's the same scenario as the XAML below, but with TextBlock. I guess I'm trying to replicate what's being done in the XAML below programatically. Again, Component's top most ancestor's DataContext is set to ViewModel. <Grid Name="myGrid"> <TextBlock Text="SomeText"> <TextBlock.InputBindings> <MouseBinding Command="{Binding SomeCommandProperty}" MouseAction="LeftClick" /> </TextBlock.InputBindings> </TextBlock> </Grid> Update 1 Sorry, I'm unable to comment because I lack the reputation points. Basically, I have a custom control which inherit from a Panel which children are a collection of Component. It's not a hack, like I've mentioned, I could directly have access to SomeCommandProperty If I aggregate the ViewModel into Component. Doing so, however, feels icky. That is, having direct access to ViewModel from a Model. I guess the question I'm asking is. Given the situation that Component's parent UIElement's DataContext is set to ViewModel, is it possible to access SomeCommandProperty without Component owning a reference to the ViewModel that owns SomeCommandProperty? Programatically, that is. Using ItemsControl doesn't change the fact that I still need to bind SomeCommandProperty to each Items.

    Read the article

  • Can't access font resource in Silverlight class library

    - by Matt
    I have a reasonably large Silveright 3.0 project on the go, and I'm having issues accessing a couple of custom font resources from within one of the assemblies. I've got a working test solution where I have added a custom font as a resource, and can access it fine from XAML using: <TextBlock Text="Test" FontFamily="FontName.ttf#Font Name" /> The test solution consists of the TestProject.Application and the TestProject.Application.Web projects, with all the fun and games obviously in the TestProject.Application project However, when I try this in my main solution, the fonts refuse to show in the correct type face (instead showing in the default font). There's no difference in the way the font has been added to project between the test solution and the main solution, and the XAML is identical. However, there is a solution layout difference. In the main solution, as well as having a MainApp.Application and MainApp.Application.Web project, I also have a MainApp.Application.ViewModel project and a MainApp.Application.Views project, and the problem piece of XAML is the in the MainApp.Application.Views project (not the .Application project like the test solution). I've tried putting the font into either the .Application or .Application.Views project, tried changing the Build Action to Content, Embedded Resource etc, all to no avail. So, is there an issue accessing font resources from a child assembly that I don't know about, or has anyone successfully done this? My long term need will be to have the valid custom fonts being stored as resources in a separate .Application.FontLibrary assembly that will be on-demand downloaded and cached, and the XAML controls in the .Application.Views project will need to reference this FontLibrary assembly to get the valid fonts. I've also tried xcreating this separate font library assembly, and I can't seem to get the fonts from the second assembly. As some additional information, I've also tried the following font referencing approaches: <TextBlock Text="Test" FontFamily="/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/MainApp.Application.Views;/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/MainApp.Application.Views;component/FontName.ttf#Font Name" /> And a few similar variants with different assembly references/sub directories/random semi colons. And so far nothing works... anyone struck this (and preferably solved it)?

    Read the article

  • Regarding Sqlite Datbase connectivity in iphone

    - by Prash.......
    hi.. I am developing an application in iphone in which i have to do the database connectivity using sqlite. I have made a "clsDBManage" class which contains 4 functions open_database, close_database, is_database_open, getdatabase_connection, which are globally defined ,i have a screen called "user details" in which i am filling the user details such as name , mobileno , email-id , password, i want that when user feeds the info it should get connected with database and store the details entered and should authenticate the user the next time he logs in. (Just as we have yahoo login,gmail login screen) clsDBManage.h +(int) openDBConnection; +(int) closeDBConnection; +(BOOL) IsDatabaseOpen; +(sqlite3 *)getDBConnection; clsDBManage.m import "clsDBManage.h" import "Types.h" sqlite3 *DBConnection=nil; @implementation clsDBManage +(int) openDBConnection { NSArray *paths = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES); NSString *documentsDirectory = [paths objectAtIndex:0]; NSString *path = [documentsDirectory stringByAppendingPathComponent:@"iphone.sqlite"]; //Before if ([self IsDatabaseOpen] == YES) [self closeDBConnection]; // Open the database. The database was prepared outside the application. if (sqlite3_open([path UTF8String], &DBConnection ) == SQLITE_OK) { ifdef _DEBUG NSLog(@"Database Successfully Opened :)"); endif return CON_RET_SUCCESSFUL; } else { ifdef _DEBUG NSLog(@"Error in opening database :("); endif return CON_RET_ERROR; } } +(BOOL) IsDatabaseOpen { if(DBConnection != nil) { //add if condition to check database is in open state or close state return YES; } else { return NO; } } +(int) closeDBConnection { @try { if(DBConnection != nil) { sqlite3_close(DBConnection); DBConnection = nil; return CON_RET_SUCCESSFUL; } else { return CON_RET_ERROR; } } @catch (NSException * e) { NSLog([e reason]); } } +(sqlite3 *)getDBConnection { if ([self openDBConnection] == 1) return DBConnection; else return nil; } @end //classDBManage file is my handler class where i have written code to open database //my addprofile functions -(NSInteger)addProfile:(NSString *)mobileno:(NSString *)country:(NSString *)username:(NSString *)screenname:(NSString *)emailid:(NSString *)password:(NSString *)retypepassword { @try { sqlite3 *db =[clsDBManage getDBConnection]; if (db != nil) { sqlite3_stmt *statement =nil; const char *sql = "insert into SPCaccountdetails(MobileNo , Country , UserName , ScreenName, EmailId, Password, RetypePawssword) Values(?,?,?,?,?,?,?)"; if(sqlite3_prepare_v2(db, sql, -1, &statement, NULL) != SQLITE_OK) { //NSAssert1(0, @"Error while creating add statement. '%s'", sqlite3_errmsg(db)); } sqlite3_bind_text(statement, 1, [mobileno UTF8String], -1, SQLITE_TRANSIENT); sqlite3_bind_text(statement, 2, [country UTF8String], -1, SQLITE_TRANSIENT); sqlite3_bind_text(statement, 3, [username UTF8String], -1, SQLITE_TRANSIENT); sqlite3_bind_text(statement, 4, [screenname UTF8String], -1, SQLITE_TRANSIENT); sqlite3_bind_text(statement, 5, [emailid UTF8String], -1, SQLITE_TRANSIENT); sqlite3_bind_text(statement, 6, [password UTF8String], -1, SQLITE_TRANSIENT); sqlite3_bind_text(statement, 7, [retypepassword UTF8String], -1, SQLITE_TRANSIENT); if(SQLITE_DONE != sqlite3_step(statement)) { NSAssert1(0, @"Error while inserting data. '%s'", sqlite3_errmsg(db)); } sqlite3_finalize(statement); } } @catch(NSException *e) { //[clsMessageBox ShowMessageOK:@CON_MESSAGE_TITLE_MESSAGE_USER_PROFILE :[e reason]]; } return CON_RET_SUCCESSFUL; } //button click event where i am calling addprofile function;_ [self addProfile:txtMobile :txtCountry :txtName :txtScreenname :txtemailid :txtpassword :txtretypepassword];

    Read the article

  • Different cursor formats in IOFrameBufferShared

    - by Thomi
    Hi, I'm reading the moust cursor pixmap data from the StdFBShmem_t structure, as defined in the IOFrameBufferShared API. Everything works fine, 90% of the time. However, I have noticed that some applications on the mac set a cursor in a different format. According to the documentation for the data structures, the cursor pixmap format should always be in the same format as the frame buffer. My frame buffer is 32BPP. I expect the pixmap data to be in the format 0xAARRGGBB, which is it. However, in some cases, I'm reading data that looks like a mask. Specifically, the pixel will either be 0x00FFFFFF or `0x00000000. This looks to me to be a mask for separate pixel data stored somewhere else. As far as I can tell, the only application that uses this cursor pixel format is Qt Creator, but I need to work with all applications, so I'd like to sort this out. The code I'm using to read the cursor pixmap data is: NSAutoreleasePool *autoReleasePool = [[NSAutoreleasePool alloc] init]; NSPoint mouseLocation = [NSEvent mouseLocation]; NSArray *allScreens = [NSScreen screens]; NSEnumerator *screensEnum = [allScreens objectEnumerator]; NSScreen *screen; NSDictionary *screenDesc = nil; while ((screen = [screensEnum nextObject])) { NSRect screenFrame = [screen frame]; screenDesc = [screen deviceDescription]; if (NSMouseInRect(mouseLocation, screenFrame, NO)) break; } if (screen) { kern_return_t err; CGDirectDisplayID displayID = (CGDirectDisplayID) [[screenDesc objectForKey:@"NSScreenNumber"] pointerValue]; task_port_t taskPort = mach_task_self(); io_service_t displayServicePort = CGDisplayIOServicePort(displayID); io_connect_t displayConnection =0; err = IOFramebufferOpen(displayServicePort, taskPort, kIOFBSharedConnectType, &displayConnection); if (KERN_SUCCESS == err) { union { vm_address_t vm_ptr; StdFBShmem_t *fbshmem; } cursorInfo; vm_size_t size; err = IOConnectMapMemory(displayConnection, kIOFBCursorMemory, taskPort, &cursorInfo.vm_ptr, &size, kIOMapAnywhere | kIOMapDefaultCache | kIOMapReadOnly); if (KERN_SUCCESS == err) { // for some reason, cursor data is not always in the same format as the frame buffer. For this reason, we need // some way to detect which structure we should be reading. QByteArray pixData((const char*)cursorInfo.fbshmem->cursor.rgb24.image[currentFrame], m_mouseInfo.currentSize.width() * m_mouseInfo.currentSize.height() * 4); IOConnectUnmapMemory(displayConnection, kIOFBCursorMemory, taskPort, cursorInfo.vm_ptr); } // IOConnectMapMemory else qDebug() << "IOConnectMapMemory Failed:" << err; IOServiceClose(displayConnection); } // IOServiceOpen else qDebug() << "IOFramebufferOpen Failed:" << err; }// if screen [autoReleasePool release]; My question is: How can I detect if the cursor is a different format from the framebuffer? Where can I read the actual pixel data? the bm18Cursor structure contains a mask section, but it's not in the right place for me to be reading it using the code above. Cheers,

    Read the article

  • Windows phone app xaml error

    - by thewarri0r9
    i am developing an app for windows phone 8 and i stuck on this code which visual studio showing invalid xaml. But Code compiles and works well. Invalid xaml Code is : <DataTemplate x:Key="AddrBookItemTemplate"> <StackPanel Margin="0,0,0,2" Orientation="Horizontal"> <StackPanel Width="80" Orientation="Horizontal" Height="80"> <Ellipse Margin="0" Height="70" Width="70" HorizontalAlignment="Left" Stroke="{x:Null}"> <Ellipse.Fill> <ImageBrush Stretch="Fill" ImageSource="{Binding imageBytes, Converter={StaticResource BytesToImageConverter}}"/> </Ellipse.Fill> </Ellipse> </StackPanel> <StackPanel Height="80" Margin="0" Width="380" HorizontalAlignment="Left"> <TextBlock FontWeight="Bold" Text="{Binding FirstName}" FontFamily="Segoe WP Semibold" FontSize="30" VerticalAlignment="Top" Margin="5,0,0,0" HorizontalAlignment="Left" /> <TextBlock Text="{Binding Phone}" FontFamily="Segoe WP" FontSize="24" Foreground="{StaticResource PhoneTextBoxReadOnlyBrush}" Margin="5,0,0,-12" Width="320" HorizontalAlignment="Left" VerticalAlignment="Top"/> </StackPanel> </StackPanel> </DataTemplate> I am serializing image by converting it to byte, it works fine but if image is null it gives an error. code behind: if (e.Results != null) { List<AddressBook> source = new List<AddressBook>(); foreach (var result in e.Results) { if (result.PhoneNumbers.FirstOrDefault() != null && result.GetPicture()!=null) { BitmapImage bmp = new BitmapImage(); BitmapImage nullbmp = new BitmapImage(); if (result.GetPicture() == null) { bmp.UriSource = new Uri(@"/Images/ci2.png", UriKind.RelativeOrAbsolute); } else { bmp.SetSource(result.GetPicture()); } listobj.Add(new AddressBook() { FirstName = result.DisplayName != null ? result.DisplayName : "", imageBytes = AddressBook.imageConvert(bmp), EmailAddress = "", LastName = "", Phone = result.PhoneNumbers.FirstOrDefault() != null ? result.PhoneNumbers.FirstOrDefault().PhoneNumber : "", }); } } Above code show an error "object reference not set to instance of an object". I want to show the default image (or color) in ellipse when image is null.What should I do?

    Read the article

  • Assembly Load and loading the "sub-modules" dependencies - "cannot fild the file specified"

    - by Ted
    There are several questions out there that ask the same question. However the answers they received I cannot understand, so here goes: Similar questions: http://stackoverflow.com/questions/1874277/dynamically-load-assembly-and-manually-force-path-to-get-referenced-assemblies ; http://stackoverflow.com/questions/22012/loading-assemblies-and-its-dependencies-closed The question in short: I need to figure out how dependencies, ie References in my modules can be loaded dynamically. Right now I am getting "The system cannot find the file specified" on Assemblies referenced in my so called modules. I cannot really get how to use the AssemblyResolve event... The longer version I have one application, MODULECONTROLLER, that loads separate modules. These "separate modules" are located in well-known subdirectories, like appBinDir\Modules\Module1 appBinDir\Modules\Module2 Each directory contains all the DLLs that exists in the bin-directory of those projects after a build. So the MODULECONTROLLER loads all the DLLs contained in those folders using this code: byte[] bytes = File.ReadAllBytes(dllFileFullPath); Assembly assembly = null; assembly = Assembly.Load(bytes); I am, as you can see, loading the byte[]-array (so I dont lock the DLL-files). Now, in for example MODULE1, I have a static reference called MyGreatXmlProtocol. The MyGreatXmlProtocol.dll then also exists in the directory appBinDir\Modules\Module1 and is loaded using the above code When code in the MODULE1 tries to use this MyGreatXmlProtocol, I get: Could not load file or assembly 'MyGreatXmlProtocol, Version=1.0.3797.26527, Culture=neutral, PublicKeyToken=null' or one of its dependencies. The system cannot find the file specified. So, in a post (like this one) they say that To my understanding reflection will load the main assembly and then search the GAC for the referenced assemblies, if it cannot find it there, you can then incorparate an assemblyResolve event: First; is it really needed to use the AssemblyResolve-event to make this work? Shouldnt my different MODULEs themself load their DLLs, as they are statically referenced? Second; if AssemblyResolve is the way to go - how do I use it? I have attached a handler to the Event but I never get anything on MyGreatXmlProctol... === EDIT === CODE regarding the AssemblyResolve-event handler: public GUI() { InitializeComponent(); AppDomain.CurrentDomain.AssemblyResolve += new ResolveEventHandler(CurrentDomain_AssemblyResolve); ... } // Assembly CurrentDomain_AssemblyResolve(object sender, ResolveEventArgs args) { Console.WriteLine(args.Name); return null; } Hope I wasnt too fuzzy =) Thx

    Read the article

  • Do You Really Know Your Programming Languages?

    - by Kristopher Johnson
    I am often amazed at how little some of my colleagues know or care about their craft. Something that constantly frustrates me is that people don't want to learn any more than they need to about the programming languages they use every day. Many programmers seem content to learn some pidgin sub-dialect, and stick with that. If they see a keyword or construct that they aren't familiar with, they'll complain that the code is "tricky." What would you think of a civil engineer who shied away from calculus because it had "all those tricky math symbols?" I'm not suggesting that we all need to become "language lawyers." But if you make your living as a programmer, and claim to be a competent user of language X, then I think at a minimum you should know the following: Do you know the keywords of the language and what they do? What are the valid syntactic forms? How are memory, files, and other operating system resources managed? Where is the official language specification and library reference for the language? The last one is the one that really gets me. Many programmers seem to have no idea that there is a "specification" or "standard" for any particular language. I still talk to people who think that Microsoft invented C++, and that if a program doesn't compile under VC6, it's not a valid C++ program. Programmers these days have it easy when it comes to obtaining specs. Newer languages like C#, Java, Python, Ruby, etc. all have their documentation available for free from the vendors' web sites. Older languages and platforms often have standards controlled by standards bodies that demand payment for specs, but even that shouldn't be a deterrent: the C++ standard is available from ISO for $30 (and why am I the only person I know who has a copy?). Programming is hard enough even when you do know the language. If you don't, I don't see how you have a chance. What do the rest of you think? Am I right, or should we all be content with the typical level of programming language expertise? Update: Several great comments here. Thanks. A couple of people hit on something that I didn't think about: What really irks me is not the lack of knowledge, but the lack of curiosity and willingness to learn. It seems some people don't have any time to hone their craft, but they have plenty of time to write lots of bad code. And I don't expect people to be able to recite a list of keywords or EBNF expressions, but I do expect that when they see some code, they should have some inkling of what it does. Few people have complete knowledge of every dark corner of their language or platform, but everyone should at least know enough that when they see something unfamiliar, they will know how to get whatever additional information they need to understand it.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Flex/Air/AS3 Selecting and Populating a unFocused tab.

    - by Deyon
    I'm having a problem displaying data from a function to text box within a tab. If you run the code and click "Select Tab 2 and Fill..." I get an error; "TypeError: Error #1009: Cannot access a property or method of a null object reference." I'm guessing this is because "Tab 2" is/was not rendered yet. Now if I run the code, select "Tab 2" then select "Tab 1" and click "Select Tab 2 and Fill..." it works the way I would like. Dose any one know a way around this problem. ----Full Flex 4/Flash Builder Code just copy paste---- <?xml version="1.0" encoding="utf-8"?> <s:WindowedApplication xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:mx="library://ns.adobe.com/flex/halo" creationComplete=" "> <fx:Script> <![CDATA[ public function showtab2():void { mytextbox.text="I made it!"; tn.selectedIndex=1; } ]]> </fx:Script> <fx:Declarations> <!-- Place non-visual elements (e.g., services, value objects) here --> </fx:Declarations> <mx:Panel title="TabNavigator Container Example" height="90%" width="90%" paddingTop="10" paddingLeft="10" paddingRight="10" paddingBottom="10"> <mx:Label width="100%" color="blue" text="Select the tabs to change the panel."/> <mx:TabNavigator id="tn" width="100%" height="100%"> <!-- Define each panel using a VBox container. --> <mx:VBox label="Panel 1"> <mx:Label text="TabNavigator container panel 1"/> <mx:Button label="Select Tab 2 and Fill with Text" click="showtab2()"/> </mx:VBox> <mx:VBox label="Panel 2"> <mx:Label text="TabNavigator container panel 2"/> <s:TextInput id="mytextbox" /> </mx:VBox> </mx:TabNavigator> <mx:HBox> </mx:HBox> </mx:Panel> </s:WindowedApplication>

    Read the article

  • Trappings MySQL Warnings on Calls Wrapped in Classes -- Python

    - by chernevik
    I can't get Python's try/else blocks to catch MySQL warnings when the execution statements are wrapped in classes. I have a class that has as a MySQL connection object as an attribute, a MySQL cursor object as another, and a method that run queries through that cursor object. The cursor is itself wrapped in a class. These seem to run queries properly, but the MySQL warnings they generate are not caught as exceptions in a try/else block. Why don't the try/else blocks catch the warnings? How would I revise the classes or method calls to catch the warnings? Also, I've looked through the prominent sources and can't find a discussion that helps me understand this. I'd appreciate any reference that explains this. Please see code below. Apologies for verbosity, I'm newbie. #!/usr/bin/python import MySQLdb import sys import copy sys.path.append('../../config') import credentials as c # local module with dbase connection credentials #============================================================================= # CLASSES #------------------------------------------------------------------------ class dbMySQL_Connection: def __init__(self, db_server, db_user, db_passwd): self.conn = MySQLdb.connect(db_server, db_user, db_passwd) def getCursor(self, dict_flag=True): self.dbMySQL_Cursor = dbMySQL_Cursor(self.conn, dict_flag) return self.dbMySQL_Cursor def runQuery(self, qryStr, dict_flag=True): qry_res = runQueryNoCursor(qryStr=qryStr, \ conn=self, \ dict_flag=dict_flag) return qry_res #------------------------------------------------------------------------ class dbMySQL_Cursor: def __init__(self, conn, dict_flag=True): if dict_flag: dbMySQL_Cursor = conn.cursor(MySQLdb.cursors.DictCursor) else: dbMySQL_Cursor = conn.cursor() self.dbMySQL_Cursor = dbMySQL_Cursor def closeCursor(self): self.dbMySQL_Cursor.close() #============================================================================= # QUERY FUNCTIONS #------------------------------------------------------------------------------ def runQueryNoCursor(qryStr, conn, dict_flag=True): dbMySQL_Cursor = conn.getCursor(dict_flag) qry_res =runQueryFnc(qryStr, dbMySQL_Cursor.dbMySQL_Cursor) dbMySQL_Cursor.closeCursor() return qry_res #------------------------------------------------------------------------------ def runQueryFnc(qryStr, dbMySQL_Cursor): qry_res = {} qry_res['rows'] = dbMySQL_Cursor.execute(qryStr) qry_res['result'] = copy.deepcopy(dbMySQL_Cursor.fetchall()) qry_res['messages'] = copy.deepcopy(dbMySQL_Cursor.messages) qry_res['query_str'] = qryStr return qry_res #============================================================================= # USAGES qry = 'DROP DATABASE IF EXISTS database_of_armaments' dbConn = dbMySQL_Connection(**c.creds) def dbConnRunQuery(): # Does not trap an exception; warning displayed to standard error. try: dbConn.runQuery(qry) except: print "dbConn.runQuery() caught an exception." def dbConnCursorExecute(): # Does not trap an exception; warning displayed to standard error. dbConn.getCursor() # try/except block does catches error without this try: dbConn.dbMySQL_Cursor.dbMySQL_Cursor.execute(qry) except Exception, e: print "dbConn.dbMySQL_Cursor.execute() caught an exception." print repr(e) def funcRunQueryNoCursor(): # Does not trap an exception; no warning displayed try: res = runQueryNoCursor(qry, dbConn) print 'Try worked. %s' % res except Exception, e: print "funcRunQueryNoCursor() caught an exception." print repr(e) #============================================================================= if __name__ == '__main__': print '\n' print 'EXAMPLE -- dbConnRunQuery()' dbConnRunQuery() print '\n' print 'EXAMPLE -- dbConnCursorExecute()' dbConnCursorExecute() print '\n' print 'EXAMPLE -- funcRunQueryNoCursor()' funcRunQueryNoCursor() print '\n'

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 536 537 538 539 540 541 542 543 544 545 546 547  | Next Page >