Search Results

Search found 14689 results on 588 pages for 'executable format'.

Page 547/588 | < Previous Page | 543 544 545 546 547 548 549 550 551 552 553 554  | Next Page >

  • Paging & Sorting grids with ASP.Net MVC

    - by Scott Ivey
    I'm new to MVC, and am not following how you'd do paging and sorting on a grid. I'm used to using the asp.Net GridView control with an ObjectDataSource pointed at objects in our business layer - and in that case the ODS handles all of the paging & sorting using the methods that our ORM generates on the objects. I've looked at using the same ORM with MVC - and things work out fine there - i just loop thru the collections to build the table on the page - but without the ODS to handle the paging & sorting, i'm confused as to how I'd handle that. Would I have a separate controller for the paging and sorting? I'm not sure what the best practices are for this scenario, so if someone can point me in the right direction it would be much appreciated. Edit: Ok, so I understand that I need to roll my own - but where do I start? I've created a CustomerController, and a view that displays a table of customers that looks like below - and I want to sort on FirstName or LastName columns. My Model has a Sort() method on it that'll take a string sort expression in the format that would be used by a GridView/ODS pair. Would I create a new Action on my CustomerController called Sort, and put an ActionLink in my header? <table> <tr> <th> First Name </th> <th> Last Name </th> </tr> <% foreach (var item in Model) { %> <tr> <td> <%= Html.Encode(item.FirstName) %> </td> <td> <%= Html.Encode(item.LastName) %> </td> </tr> <% } %> </table>

    Read the article

  • clarification on the concept of "web service"

    - by udit
    Im a little confused on the varying definitions and implementations of web services available as implementations. Need some clarification please. Ones I have used till now: If a vendor gives me a specific format of XML that I can send populated with data to request and I make a simple HTTP POST over the internet passing in the XML String as the payload, is this a web service call ? If so, is there a specific name to it, this kind of web service ? Because obviously, it does not use anything like Axis, WSDL or SOAP to establish this connection. A variant of this is If the vendor gives me an XSD, I use JAXB to make a java class out of it and pass in the serialized version of the object, which eventually works out to be the same as option 1. RESTful web service: Vendor gives me a URL like http://restfulservice/products and I can make HTTP Requests to the URL and depending on what HTTP verb I use, the appropropriate action is called and the response sent over the wire. Ones I have only read about\ have a vague idea about SOAP. How does this work?.. Ive read the W3Schools tutorial and I undertsand that there is a very specific form of XML that is standardized according to W3C standards that we use to pass the same kind of messages as we did in option 1. But how does this work in real life? Vendor sends me what? Do I generate classes? Do I serialize some objects and http post them over to an address? Or do the generated objects themselves have connection methods that will do them for me? What about WSDL? When does a vendor send me WSDL and what do I do with it ? I guess I can generate classes from it. If yes, then what do I do with the generated classes ? When do I need that axis jar to generate classes from something that the vendor sends ? As you can see, I have some clear and other mostly vague ideas about the different kinds of web services available. would help if someone ould clarify and\or point to more real-world resources. I've looked a little bit into Java Web Services on the internet and the numerous four letter acronyms that get thrown at me make me dizzy. Thanks

    Read the article

  • Selecting the contents of an ASP.NET TextBox in an UpdatePanel after a partial page postback

    - by Scott Mitchell
    I am having problems selecting the text within a TextBox in an UpdatePanel. Consider a very simple page that contains a single UpdatePanel. Within that UpdatePanel there are two Web controls: A DropDownList with three statically-defined list items, whose AutoPostBack property is set to True, and A TextBox Web control The DropDownList has a server-side event handler for its SelectedIndexChanged event, and in that event handler there's two lines of code: TextBox1.Text = "Whatever"; ScriptManager.RegisterStartupScript(this, this.GetType(), "Select-" + TextBox1.ClientID, string.Format("document.getElementById('{0}').select();", TextBox1.ClientID), true); The idea is that whenever a user chooses and item from the DropDownList there is a partial page postback, at which point the TextBox's Text property is set and selected (via the injected JavaScript). Unfortunately, this doesn't work as-is. (I have also tried putting the script in the pageLoad function with no luck, as in: ScriptManager.RegisterStartupScript(..., "function pageLoad() { ... my script ... }");) What happens is the code runs, but something else on the page receives focus at the conclusion of the partial page postback, causing the TextBox's text to be unselected. I can "fix" this by using JavaScript's setTimeout to delay the execution of my JavaScript code. For instance, if I update the emitted JavaScript to the following: setTimeout("document.getElementById('{0}').select();", 111); It "works." I put works in quotes because it works for this simple page on my computer. In a more complex page on a slower computer with more markup getting passed between the client and server on the partial page postback, I have to up the timeout to over a second to get it to work. I would hope that there is a more foolproof way to achieve this. Rather than saying, "Delay for X milliseconds," it would be ideal to say, "Run this when you're not going to steal the focus." What's perplexing is that the .Focus() method works beautifully. That is, if I scrap my JavaScript and replace it with a call to TextBox1.Focus(); then the TextBox receives focus (although the text is not selected). I've examined the contents of MicrosoftAjaxWebForms.js and see that the focus is set after the registered scripts run, but I'm my JavaScript skills are not strong enough to decode what all is happening here and why the selected text is unselected between the time it is selected and the end of the partial page postback. I've also tried using Firebug's JavaScript debugger and see that when my script runs the TextBox's text is selected. As I continue to step through it the text remains selected, but then after stepping off the last line of script (apparently) it all of the sudden gets unselected. Any ideas? I am pulling my hair out. Thanks in advance...

    Read the article

  • How to stream semi-live audio over internet

    - by Thomas Tempelmann
    I want to write something like Skype, i.e. I have a constant audio stream on one computer and then recompress it in a format that's suitable for a latent internet connection, receive it on the other end and play it. Let's also assume that the internet connection is fairly modern and fast, i.e. DSL or alike, no slow connections over phone and such. The involved computers will also be rather modern (Dual Core Intel CPUs at 2GHz or more). I know how to handle the audio on the machines. What I don't know is how to transmit the audio in an efficient way. The challenges are: I'd like get good audio quality across the line. The stream should be received without drops. The stream may, however, be received with a little delay (a second delay is acceptable). I imagine that the transport software could first determine the average (and max) latency, then start the stream and tell the receiver to wait for that max latency before starting to play the audio. With that, if the latency doesn't get any higher, the entire stream will be playable on the other side without stutter or drops. If, due to unexpected IP latencies or blockages, the stream does get cut off, I want to be able to notice this so that I can take actions (e.g. abort the stream) and eventually start a new transmission. What are my options if I want do use ready-made software for the compression and tranmission? I have no intention to write my own audio compression engine, really. OTOH, I plan to sell the solution in a vertical market, meaning I can afford a few dollars of license fees per copy, but not $100s. I guess the simplest solution would be to just open a TCP stream, send a few packets back and forth to determine their running time (or even use UDP for that), then use the results as the guide for my max latency value, then simply fire the audio data in its raw form (uncompressed 16 bit stereo), along with a timing code over the TCP connection. The receiver reads the data and plays it with the pre-determined delay. That might just work with the type of fast connection I expect. I just wonder if there are better solutions to reach this goal, with better performance (lower latency) and less data (compressed). BTW, I first try to implement this on OS X, but might want to do it on Windows, too, if it proves successful.

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Is "Systems Designer" the job title that best describes what I do? [closed]

    - by ivo-rossi
    After having worked as Java developer for almost 3 years in the same company that I currently work at, I moved to a new position associated with the development of the same application. I’m in this new position for more than 1 year now. My official job title is Systems Designer, but I’m not sure this is a title that expresses well what I do. So my question here is what would be the most appropriate job title for me? I see this question as important for my career development. After all, I should be able to explain in one word what I do. And it’s no longer “Java Developer”. Well, in more than one word, this is what I do: The business analysts gather requirements / business problems to be solved with the clients and then discuss these requirements with me. Given the requirements, I design the high level solutions to be implemented in our system (e.g. a new screen on the client application, modifications to existing reports, extension to the XML export format of some objects, etc). I base my decision on the current capabilities of the system, the overall impact that the solutions would have on the system and the estimated effort to implement them (as I was a developer of this same application for almost 3 years before I moved to this position, I’m confident in my estimates). The solutions are discussed iteratively with the business analysts until we agree that they are good. The outcome of this analysis is what we call the “requirements design” document, which is written by me, shared with clients for approval and then also with the team that is going to implement the solutions and test them. Note that there are a few problems that I need to find a solution for that are non-functional. If the users are unhappy with the performance of a certain tool, I will investigate what can be done to speed it up. I will do some research – often based in the Java code itself - to identify possibilities of optimizations. But in this new position I no longer code, the main outcome of my work is really the “requirements design”. Is “Systems Designer” really the most appropriate job title?

    Read the article

  • How do I do distributed UML development (à la FOSS)?

    - by James A. Rosen
    I have a UML project (built in IBM's Rational System Architect/Modeler, so stored in their XML format) that has grown quite large. Additionally, it now contains several pieces that other groups would like to re-use. I come from a software development (especially FOSS) background, and am trying to understand how to use that as an analogy here. The problem I am grappling with is similar to the Fragile Base Class problem. Let me start with how it works in an object-oriented (say, Java or Ruby) FOSS ecosystem: Group 1 publishes some "core" package, say "net/smtp version 1.0" Group 2 includes Group 1's net/smtp 1.0 package in the vendor library of their software project At some point, Group 1 creates a new 2.0 branch of net/smtp that breaks backwards compatibility (say, it removes an old class or method, or moves a class from one package to another). They tell users of the 1.0 version that it will be deprecated in one year. Group 2, when they have the time, updates to net/smtp 2.0. When they drop in the new package, their compiler (or test suite, for Ruby) tells them about the incompatibility. They do have to make some manual changes, but all of the changes are in the code, in plain text, a medium with which they are quite familiar. Plus, they can often use their IDE's (or text editor's) "global-search-and-replace" function once they figure out what the fixes are. When we try to apply this model to UML in RSA, we run into some problems. RSA supports some fairly powerful refactorings, but they seem to only work if you have write access to all of the pieces. If I rename a class in one package, RSA can rename the references, but only at the same time. It's very difficult to look at the underlying source (the XML) and figure out what's broken. To fix such a problem in the RSA editor itself means tons of clicking on things -- there is no good equivalent of "global-search-and-replace," at least not after an incomplete refactor. They real sticking point seems to be that RSA assumes that you want to do all your editing using their GUI, but that makes certain operations prohibitively difficult. Does anyone have examples of open-source UML projects that have overcome this problem? What strategies do they use for communicating changes?

    Read the article

  • How to convert m4a file to aac adts file in Xcode?

    - by Bird Hsuie
    I have a mp4 file copied from iPod lib and saved to my Document for my next step, I need it to convert to .mp3 or .aac(ADTS type) I use this code and failed... -(IBAction)compressFile:(id)sender{ NSLog (@"handleConvertToPCMTapped"); // open an ExtAudioFile NSLog (@"opening %@", exportURL); ExtAudioFileRef inputFile; CheckResult (ExtAudioFileOpenURL((__bridge CFURLRef)exportURL, &inputFile), "ExtAudioFileOpenURL failed"); // prepare to convert to a plain ol' PCM format AudioStreamBasicDescription myPCMFormat; myPCMFormat.mSampleRate = 44100; // todo: or use source rate? myPCMFormat.mFormatID = kAudioFormatMPEGLayer3 ; myPCMFormat.mFormatFlags = kAudioFormatFlagsCanonical; myPCMFormat.mChannelsPerFrame = 2; myPCMFormat.mFramesPerPacket = 1; myPCMFormat.mBitsPerChannel = 16; myPCMFormat.mBytesPerPacket = 4; myPCMFormat.mBytesPerFrame = 4; CheckResult (ExtAudioFileSetProperty(inputFile, kExtAudioFileProperty_ClientDataFormat, sizeof (myPCMFormat), &myPCMFormat), "ExtAudioFileSetProperty failed"); // allocate a big buffer. size can be arbitrary for ExtAudioFile. // you have 64 KB to spare, right? UInt32 outputBufferSize = 0x10000; void* ioBuf = malloc (outputBufferSize); UInt32 sizePerPacket = myPCMFormat.mBytesPerPacket; UInt32 packetsPerBuffer = outputBufferSize / sizePerPacket; // set up output file NSString *outputPath = [myDocumentsDirectory() stringByAppendingPathComponent:@"m_export.mp3"]; NSURL *outputURL = [NSURL fileURLWithPath:outputPath]; NSLog (@"creating output file %@", outputURL); AudioFileID outputFile; CheckResult(AudioFileCreateWithURL((__bridge CFURLRef)outputURL, kAudioFileCAFType, &myPCMFormat, kAudioFileFlags_EraseFile, &outputFile), "AudioFileCreateWithURL failed"); // start convertin' UInt32 outputFilePacketPosition = 0; //in bytes while (true) { // wrap the destination buffer in an AudioBufferList AudioBufferList convertedData; convertedData.mNumberBuffers = 1; convertedData.mBuffers[0].mNumberChannels = myPCMFormat.mChannelsPerFrame; convertedData.mBuffers[0].mDataByteSize = outputBufferSize; convertedData.mBuffers[0].mData = ioBuf; UInt32 frameCount = packetsPerBuffer; // read from the extaudiofile CheckResult (ExtAudioFileRead(inputFile, &frameCount, &convertedData), "Couldn't read from input file"); if (frameCount == 0) { printf ("done reading from file"); break; } // write the converted data to the output file CheckResult (AudioFileWritePackets(outputFile, false, frameCount, NULL, outputFilePacketPosition / myPCMFormat.mBytesPerPacket, &frameCount, convertedData.mBuffers[0].mData), "Couldn't write packets to file"); NSLog (@"Converted %ld bytes", outputFilePacketPosition); // advance the output file write location outputFilePacketPosition += (frameCount * myPCMFormat.mBytesPerPacket); } // clean up ExtAudioFileDispose(inputFile); AudioFileClose(outputFile); // show size in label NSLog (@"checking file at %@", outputPath); [self transMitFile:outputPath]; if ([[NSFileManager defaultManager] fileExistsAtPath:outputPath]) { NSError *fileManagerError = nil; unsigned long long fileSize = [[[NSFileManager defaultManager] attributesOfItemAtPath:outputPath error:&fileManagerError] fileSize]; } any suggestion?.......thanks for your great help!

    Read the article

  • using LoadControl with object initializer to create properties

    - by lloydphillips
    In the past I've used UserControls to create email templates which I can fill properties on and then use LoadControl and then RenderControl to get the html for which to use for the body text of my email. This was within asp.net webforms. I'm in the throws of building an mvc website and wanted to do something similar. I've actually considered putting this functionality in a seperate class library and am looking into how I can do this so that in my web layer I can just call EmailTemplate.SubscriptionEmail() which will then generate the html from my template with properties in relevant places (obviously there needs to be parameters for email address etc in there). I wanted to create a single Render control method for which I can pass a string to the path of the UserControl which is my template. I've come across this on the web that kind of suits my needs: public static string RenderUserControl(string path, string propertyName, object propertyValue) { Page pageHolder = new Page(); UserControl viewControl = (UserControl)pageHolder.LoadControl(path); if (propertyValue != null) { Type viewControlType = viewControl.GetType(); PropertyInfo property = viewControlType.GetProperty(propertyName); if (property != null) property.SetValue(viewControl, propertyValue, null); else { throw new Exception(string.Format( "UserControl: {0} does not have a public {1} property.", path, propertyName)); } } pageHolder.Controls.Add(viewControl); StringWriter output = new StringWriter(); HttpContext.Current.Server.Execute(pageHolder, output, false); return output.ToString(); } My issue is that my UserControl(s) may have multiple and differing properties. So SubscribeEmail may require FirstName and EmailAddress where another email template UserControl (lets call it DummyEmail) would require FirstName, EmailAddress and DateOfBirth. The method above only appears to carry one parameter for propertyName and propertyValue. I considered an array of strings that I could put the varying properties into but then I thought it'd be cool to have an object intialiser so I could call the method like this: RenderUserControl("EmailTemplates/SubscribeEmail.ascs", new object() { Firstname="Lloyd", Email="[email protected]" }) Does that make sense? I was just wondering if this is at all possible in the first place and how I'd implement it? I'm not sure if it would be possible to map the properties set on 'object' to properties on the loaded user control and if it is possible where to start in doing this? Has anyone done something like this before? Can anyone help? Lloyd

    Read the article

  • disable dates using jquery inside gridview control

    - by bladerunner
    Hi there, I have a gridview which contains a textbox control. I need to show the calendar for the user to pick the date and certain dates are to be disabled using jquery. I found a post on stackoverflow that talked about how to disable certain dates. I am done with that part, except not sure how to pass the textbox control to this jquery function. Here is the code. <script type="text/javascript" language="javascript"> function pageLoad(sender, args) { var enabledDays = ['09/21/2011', '10/05/2011', '10/19/2011', '11/02/2011', '11/16/2011']; /* utility functions */ function editDays(date) { for (var i = 0; i < enabledDays.length; i++) { if (new Date(enabledDays[i]).toString() == date.toString()) { return [true]; } } return [false]; } /* create datepicker */ $(document).ready(function() { $('#<%= txtInHomeDate.ClientID %>').datepicker({ beforeShow: springDate, beforeShowDay: editDays, dateFormat: 'mm/dd/yy', buttonImage: 'images/cal.gif', buttonText: 'Choose date', firstDay: 1, buttonImageOnly: true, showOn: 'both', showAnim: 'fadeIn', onSelect: function() { $(this).trigger("onchange", null); } }); function springDate() { var defaultMin = new Date(); var defaultMax = new Date(); var Min = defaultMin; var Max = defaultMax; // make valid date from hiddenfied value format is MM/dd/yyyy dateMin = $('#<%= hfStDate.ClientID %>').val(); dateMin = new Date(dateMin); dateMax = $('#<%= hfEndDate.ClientID %>').val(); dateMax = new Date(dateMax); if (dateMin && dateMax) { Min = new Date(dateMin.getFullYear(), dateMin.getMonth(), dateMin.getDate()); Max = new Date(dateMax.getFullYear(), dateMax.getMonth(), dateMax.getDate()); } return { minDate: Min, maxDate: Max }; } }); } <.... <asp:TemplateField HeaderText="In-Home Date"> <ItemStyle HorizontalAlign="Center" /> <ItemTemplate> <asp:HiddenField ID="hfStDate" runat="server" Value="09/01/2011" /> <asp:HiddenField ID="hfEndDate" runat="server" Value="11/30/2011" /> <asp:TextBox ID="txtInHomeDate" runat="server" /> </ItemTemplate> </asp:TemplateField> Currently, it errors out since the jquery function won't find the txtInHomeDate. Could I get some help as I am pretty close to get this done? Thanks!!

    Read the article

  • Optimize slow ranking query

    - by Juan Pablo Califano
    I need to optimize a query for a ranking that is taking forever (the query itself works, but I know it's awful and I've just tried it with a good number of records and it gives a timeout). I'll briefly explain the model. I have 3 tables: player, team and player_team. I have players, that can belong to a team. Obvious as it sounds, players are stored in the player table and teams in team. In my app, each player can switch teams at any time, and a log has to be mantained. However, a player is considered to belong to only one team at a given time. The current team of a player is the last one he's joined. The structure of player and team is not relevant, I think. I have an id column PK in each. In player_team I have: id (PK) player_id (FK -> player.id) team_id (FK -> team.id) Now, each team is assigned a point for each player that has joined. So, now, I want to get a ranking of the first N teams with the biggest number of players. My first idea was to get first the current players from player_team (that is one record top for each player; this record must be the player's current team). I failed to find a simple way to do it (tried GROUP BY player_team.player_id HAVING player_team.id = MAX(player_team.id), but that didn't cut it. I tried a number of querys that didn't work, but managed to get this working. SELECT COUNT(*) AS total, pt.team_id, p.facebook_uid AS owner_uid, t.color FROM player_team pt JOIN player p ON (p.id = pt.player_id) JOIN team t ON (t.id = pt.team_id) WHERE pt.id IN ( SELECT max(J.id) FROM player_team J GROUP BY J.player_id ) GROUP BY pt.team_id ORDER BY total DESC LIMIT 50 As I said, it works but looks very bad and performs worse, so I'm sure there must be a better way to go. Anyone has any ideas for optimizing this? I'm using mysql, by the way. Thanks in advance Adding the explain. (Sorry, not sure how to format it properly) id select_type table type possible_keys key key_len ref rows Extra 1 PRIMARY t ALL PRIMARY NULL NULL NULL 5000 Using temporary; Using filesort 1 PRIMARY pt ref FKplayer_pt77082,FKplayer_pt265938,new_index FKplayer_pt77082 4 t.id 30 Using where 1 PRIMARY p eq_ref PRIMARY PRIMARY 4 pt.player_id 1 2 DEPENDENT SUBQUERY J index NULL new_index 8 NULL 150000 Using index

    Read the article

  • Does CakePHP treat all INT fields as ID's for join tables?

    - by Jonnie
    I am trying to save a User, their Profile, and some tags and my join table that links the profile and the tags keeps getting messed up. The profile model is called Instructor, the tag model is called Subject. The Instructor has a phone number and a zip code and for some reason CakePHP thinks these are the fields it should use when creating entries in my join table. My Join table always comes out as: id | instructor_id | subject_id | 1 | 90210 | 1 | // thinks that the zip code is an instructor_id 2 | 1112223333 | 1 | // thinks that the phone number is an instructor_id 3 | 1 | 1 | // thinks that user_id is an instructor_id 4 | 1 | 1 | // the actual instructor_id, this one's correct 5 | 90210 | 2 | 6 | 1112223333 | 2 | 3 | 1 | 2 | 4 | 1 | 2 | My Models: class Instructor extends AppModel { var $name = 'Instructor'; var $belongsTo = array('User', 'State'); var $hasAndBelongsToMany = array( 'Subject' = array( 'className' = 'Subject', 'joinTable' = 'instructors_subjects', 'foreignKey' = 'instructor_id', 'associationForeignKey' = 'subject_id', 'unique' = true, 'conditions' = '', 'fields' = '', 'order' = '', 'limit' = '', 'offset' = '', 'finderQuery' = '', 'deleteQuery' = '', 'insertQuery' = '' ) ); } class Subject extends AppModel { var $name = 'Subject'; var $hasAndBelongsToMany = array( 'Instructor' = array( 'className' = 'Instructor', 'joinTable' = 'instructors_subjects', 'foreignKey' = 'subject_id', 'associationForeignKey' = 'instructor_id', 'unique' = true, 'conditions' = '', 'fields' = '', 'order' = '', 'limit' = '', 'offset' = '', 'finderQuery' = '', 'deleteQuery' = '', 'insertQuery' = '' ) ); } My Model Associations: User hasOne Instructor Instructor belongsTo User Instructor hasAndBelongsToMany Subject Subject hasAndBelongsToMany Instructor My form data looks like: Array ( [User] = Array ( [username] = MrInstructor [password] = cddb06c93c72f34eb9408610529a34645c29c55d [group_id] = 2 ) [Instructor] = Array ( [name] = Jimmy Bob [email] = [email protected] [phone] = 1112223333 [city] = Beverly Hills [zip_code] = 90210 [states] = 5 [website] = www.jimmybobbaseballschool.com [description] = Jimmy Bob is an instructor. [user_id] = 1 [id] = 1 ) [Subject] = Array ( [name] = hitting, pitching ) ) My function for processing the form looks like: function instructor_register() { $this-set('groups', $this-User-Group-find('list')); $this-set('states', $this-User-Instructor-State-find('list')); if (!empty($this-data)) { // Set the group to Instructor $this-data['User']['group_id'] = 2; // Save the user data $user = $this-User-save($this-data, true, array( 'username', 'password', 'group_id' )); // If the user was saved, save the instructor's info if (!empty($user)) { $this-data['Instructor']['user_id'] = $this-User-id; $instructor = $this-User-Instructor-save($this-data, true, array( 'user_id', 'name', 'email', 'phone', 'city', 'zip_code', 'state_id', 'website', 'description' )); // If the instructor was saved, save the rest if(!empty($instructor)) { $instructorId = $this-User-Instructor-id; $this-data['Instructor']['id'] = $instructorId; // Save each subject seperately $subjects = explode(",", $this-data['Subject']['name']); foreach ($subjects as $_subject) { // Get the correct subject format $_subject = strtolower(trim($_subject)); $this-User-Instructor-Subject-create($this-data); $this-User-Instructor-Subject-set(array( 'name' = $_subject )); $this-User-Instructor-Subject-save(); echo ''; print_r($this-data); echo ''; } } } } }

    Read the article

  • basic operations for modifying a source document with XSLT

    - by SpliFF
    All the tutorials and examples I've found of XSLT processing seem to assume your destination will be a significantly different format/structure to your source and that you know the structure of the source in advance. I'm struggling with finding out how to perform simple "in-place" modifications to a HTML document without knowing anything else about its existing structure. Could somebody show me a clear example that, given an arbitrary unknown HTML source will: 1.) delete the classname 'foo' from all divs 2.) delete a node if its empty (ie <p></p>) 3.) delete a <p> node if its first child is <br> 4.) add newattr="newvalue" to all H1 5.) replace 'heading' in text nodes with 'title' 6.) wrap all <u> tags in <b> tags (ie, <u>foo</u> -> <b><u>foo</u></b>) 7.) output the transformed document without changing anything else The above examples are the primary types of transform I wish to accomplish. Understanding how to do the above will go a long way towards helping me build more complex transforms. To help clarify/test the examples here is a sample source and output, however I must reiterate that I want to work with arbitrary samples without rewriting the XSLT for each source: <!doctype html> <html> <body> <h1>heading</h1> <p></p> <p><br>line</p> <div class="foo bar"><u>baz</u></div> <p>untouched</p> </body> </html> output: <!doctype html> <html> <body> <h1 newattr="newvalue">title</h1> <div class="bar"><b><u>baz</u></b></div> <p>untouched</p> </body> </html>

    Read the article

  • Why do I get a WCF timeout even though my service call and callback are successful?

    - by KallDrexx
    I'm playing around with hooking up an in-game console to a WCF interface, so an external application can send console commands and receive console output. To accomplish this I created the following service contracts: public interface IConsoleNetworkCallbacks { [OperationContract(IsOneWay = true)] void NewOutput(IEnumerable<string> text, string category); } [ServiceContract(SessionMode = SessionMode.Required, CallbackContract = typeof(IConsoleNetworkCallbacks))] public interface IConsoleInterface { [OperationContract] void ProcessInput(string input); [OperationContract] void ChangeCategory(string category); } On the server I implemented it with: public class ConsoleNetworkInterface : IConsoleInterface, IDisposable { public ConsoleNetworkInterface() { ConsoleManager.Instance.RegisterOutputUpdateHandler(OutputHandler); } public void Dispose() { ConsoleManager.Instance.UnregisterOutputHandler(OutputHandler); } public void ProcessInput(string input) { ConsoleManager.Instance.ProcessInput(input); } public void ChangeCategory(string category) { ConsoleManager.Instance.UnregisterOutputHandler(OutputHandler); ConsoleManager.Instance.RegisterOutputUpdateHandler(OutputHandler, category); } protected void OutputHandler(IEnumerable<string> text, string category) { var callbacks = OperationContext.Current.GetCallbackChannel<IConsoleNetworkCallbacks>(); callbacks.NewOutput(text, category); } } On the client I implemented the callback with: public class Callbacks : IConsoleNetworkCallbacks { public void NewOutput(IEnumerable<string> text, string category) { MessageBox.Show(string.Format("{0} lines received for '{1}' category", text.Count(), category)); } } Finally, I establish the service host with the following class: public class ConsoleServiceHost : IDisposable { protected ServiceHost _host; public ConsoleServiceHost() { _host = new ServiceHost(typeof(ConsoleNetworkInterface), new Uri[] { new Uri("net.pipe://localhost") }); _host.AddServiceEndpoint(typeof(IConsoleInterface), new NetNamedPipeBinding(), "FrbConsolePipe"); _host.Open(); } public void Dispose() { _host.Close(); } } and use the following code on my client to establish the connection: protected Callbacks _callbacks; protected IConsoleInterface _proxy; protected void ConnectToConsoleServer() { _callbacks = new Callbacks(); var factory = new DuplexChannelFactory<IConsoleInterface>(_callbacks, new NetNamedPipeBinding(), new EndpointAddress("net.pipe://localhost/FrbConsolePipe")); _proxy = factory.CreateChannel(); _proxy.ProcessInput("Connected"); } So what happens is that my ConnectToConsoleServer() is called and then it gets all the way to _proxy.ProcessInput("Connected");. In my game (on the server) I immediately see the output caused by the ProcessInput call, but the client is still stalled on the _proxy.ProcessInput() call. After a minute my client gets a JIT TimeoutException however at the same time my MessageBox message appears. So obviously not only is my command being sent immediately, my callback is being correctly called. So why am I getting a timeout exception? Note: Even removing the MessageBox call, I still have this issue, so it's not an issue of the GUI blocking the callback response.

    Read the article

  • Application error when drawing to SurfaceView

    - by DKDiveDude
    I'm am doing a simple coding attempt trying to draw on a SurfaceView created on my main.xml layout. I can change background color and display an icon fine, but when I try to draw I get an error. I am a newbie so obvious I am missing something, please lent a helping hint, thanks! main.xml <?xml version="1.0" encoding="utf-8"?> <SurfaceView android:id="@+id/Paper" android:layout_height="fill_parent" android:layout_width="fill_parent"> </SurfaceView> and code here; package com.example.SurfaceViewTest; import android.app.Activity; import android.graphics.Bitmap; import android.graphics.Canvas; import android.graphics.Color; import android.graphics.Paint; import android.os.Bundle; import android.view.SurfaceHolder; import android.view.SurfaceView; public class SurfaceViewTest extends Activity implements SurfaceHolder.Callback { private SurfaceView mSurfaceView; private SurfaceHolder mSurfaceHolder; private Paint paint; private Canvas canvas; Bitmap mDrawing; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); mSurfaceView = (SurfaceView) this.findViewById(R.id.Paper); mSurfaceHolder = mSurfaceView.getHolder(); mSurfaceHolder.addCallback(this); mSurfaceHolder.setType(SurfaceHolder.SURFACE_TYPE_PUSH_BUFFERS); } @Override public void surfaceChanged(SurfaceHolder holder, int format, int width, int height) { // TODO Auto-generated method stub } @Override public void surfaceCreated(SurfaceHolder holder) { mSurfaceView.setBackgroundColor(Color.rgb(0, 255, 0)); //mSurfaceView.setBackgroundResource(R.drawable.icon); canvas = holder.lockCanvas(null); mDrawing = Bitmap.createBitmap(100, 100, Bitmap.Config.RGB_565); canvas.setBitmap(mDrawing); paint = new Paint(); paint.setColor(Color.rgb(255, 255,255)); canvas.drawLine(1,1,200,300, paint); holder.unlockCanvasAndPost(canvas); } @Override public void surfaceDestroyed(SurfaceHolder holder) { // TODO Auto-generated method stub } }

    Read the article

  • .NET Extension Objects with XSLT -- how to iterate over a collection?

    - by Pandincus
    Help me, Stackoverflow! I have a simple .NET 3.5 console app that reads some data and sends emails. I'm representing the email format in an XSLT stylesheet so that we can easily change the wording of the email without needing to recompile the app. We're using Extension Objects to pass data to the XSLT when we apply the transformation: <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:msxsl="urn:schemas-microsoft-com:xslt" exclude-result-prefixes="msxsl" xmlns:EmailNotification="ext:EmailNotification"> -- this way, we can have statements like: <p> Dear <xsl:value-of select="EmailNotification:get_FullName()" />: </p> The above works fine. I pass the object via code like this (some irrelevant code omitted for brevity): // purely an example structure public struct EmailNotification { public string FullName { get; set; } } // Somewhere in some method ... var notification = new Notification("John Smith"); // ... XsltArgumentList xslArgs = new XsltArgumentList(); xslArgs.AddExtensionObject("ext:EmailNotification", notification); // ... // The part where it breaks! (This is where we do the transformation) xslt.Transform(fakeXMLDocument.CreateNavigator(), xslArgs, XmlWriter.Create(transformedXMLString)); So, all of the above code works. However, I wanted to get a little fancy (always my downfall) and pass a collection, so that I could do something like this: <p>The following accounts need to be verified:</p> <xsl:for-each select="EmailNotification:get_SomeCollection()"> <ul> <li> <xsl:value-of select="@SomeAttribute" /> </li> </ul> <xsl:for-each> When I pass the collection in the extension object and attempt to transform, I get the following error: "Extension function parameters or return values which have Clr type 'String[]' are not supported." or List, or IEnumerable, or whatever I try to pass in. So, my questions are: How can I pass in a collection to my XSLT? What do I put for the xsl:value-of select="" inside the xsl:for-each ? Is what I am trying to do impossible?

    Read the article

  • populate CoreData data model from JSON files prior to app start

    - by johannes_d
    I am creating an iPad App that displays data I got from an API in JSON format. My Core Data model has several entities(Countries, Events, Talks, ...). For each entity I have one .json file that contains all instances of the entity and its attributes as well as its relationships. I would like to populate my Core Data data model with these entities before the start of the App (otherwise it takes about 15 minutes for the iPad to create all the instances of the entities from the several JSON files using factory methods). I am currently importing the data into CoreData like this: -(void)fetchDataIntoDocument:(UIManagedDocument *)document { dispatch_queue_t dataQ = dispatch_queue_create("Data import", NULL); dispatch_async(dataQ, ^{ //Fetching data from application bundle NSURL *tedxgroupsurl = [[NSBundle mainBundle] URLForResource:@"contries" withExtension:@"json"]; NSURL *tedxeventsurl = [[NSBundle mainBundle] URLForResource:@"events" withExtension:@"json"]; //converting the JSON files to NSDictionaries NSError *error = nil; NSDictionary *countries = [NSJSONSerialization JSONObjectWithData:[NSData dataWithContentsOfURL:countriesurl] options:kNilOptions error:&error]; countries = [countries objectForKey:@"countries"]; NSDictionary *events = [NSJSONSerialization JSONObjectWithData:[NSData dataWithContentsOfURL:eventsurl] options:kNilOptions error:&error]; events = [events objectForKey:@"events"]; //creating entities using factory methods in NSManagedObject Subclasses (Country / Event) [document.managedObjectContext performBlock:^{ NSLog(@"creating countries"); for (NSDictionary *country in countries) { [Country countryWithCountryInfo:country inManagedObjectContext:document.managedObjectContext]; //creating Country entities } NSLog(@"creating events"); for (NSDictionary *event in events) { [Event eventWithEventInfo:event inManagedObjectContext:document.managedObjectContext]; // creating Event entities } NSLog(@"done creating, saving document"); [document saveToURL:document.fileURL forSaveOperation:UIDocumentSaveForOverwriting completionHandler:NULL]; }]; }); dispatch_release(dataQ); } This combines the different JSON files into one UIManagedDocument which i can then perform fetchRequests on to populate tableViews, mapView, etc. I'm looking for a way to create this document outside my application & add it to the mainBundle. Then I could copy it once to the apps DocumentsDirectory and be able I use it (instead of creating the Document within the app from the original JSON files). Any help is appreciated!

    Read the article

  • Generating Unordered List with PHP + CodeIgniter from a MySQL Database

    - by Tim
    Hello Everyone, I am trying to build a dynamically generated unordered list in the following format using PHP. I am using CodeIgniter but it can just be normal php. This is the end output I need to achieve. <ul id="categories" class="menu"> <li rel="1"> Arts &amp; Humanities <ul> <li rel="2"> Photography <ul> <li rel="3"> 3D </li> <li rel="4"> Digital </li> </ul> </li> <li rel="5"> History </li> <li rel="6"> Literature </li> </ul> </li> <li rel="7"> Business &amp; Economy </li> <li rel="8"> Computers &amp; Internet </li> <li rel="9"> Education </li> <li rel="11"> Entertainment <ul> <li rel="12"> Movies </li> <li rel="13"> TV Shows </li> <li rel="14"> Music </li> <li rel="15"> Humor </li> </ul> </li> <li rel="10"> Health </li> And here is my SQL that I have to work with. -- -- Table structure for table `categories` -- CREATE TABLE IF NOT EXISTS `categories` ( `id` mediumint(8) NOT NULL auto_increment, `dd_id` mediumint(8) NOT NULL, `parent_id` mediumint(8) NOT NULL, `cat_name` varchar(256) NOT NULL, `cat_order` smallint(4) NOT NULL, PRIMARY KEY (`id`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=1 ; So I know that I am going to need at least 1 foreach loop to generate the first level of categories. What I don't know is how to iterate inside each loop and check for parents and do that in a dynamic way so that there could be an endless tree of children. Thanks for any help you can offer. Tim

    Read the article

  • How to put Google adsense in iPhone application?

    - by oksk
    Hi all. I have a question about adsense. I want to put Google adsense in my application to be developed. But after testing my code, It wasn't shown. this is my code self.webView.userInteractionEnabled = NO; NSMutableString *manageableHTML = [[[NSMutableString alloc] init] autorelease]; [manageableHTML appendFormat:@"<html><head></head>"]; [manageableHTML appendFormat:@"<body>"]; [manageableHTML appendFormat:@"<script type=\"text/javascript\"><!--"]; [manageableHTML appendFormat:@"window.googleAfmcRequest = {"]; [manageableHTML appendFormat:@"client: 'ca-mb-pub-7564235160823935',"]; [manageableHTML appendFormat:@"ad_type: 'text_image',"]; [manageableHTML appendFormat:@"output: 'html',"]; [manageableHTML appendFormat:@"channel: '2052458338',"]; [manageableHTML appendFormat:@"format: '320x50_mb',"]; [manageableHTML appendFormat:@"oe: 'utf8',"]; [manageableHTML appendFormat:@"color_border: '336699',"]; [manageableHTML appendFormat:@"color_bg: 'FFFFFF',"]; [manageableHTML appendFormat:@"color_link: '0000FF',"]; [manageableHTML appendFormat:@"color_text: '000000',"]; [manageableHTML appendFormat:@"color_url: '008000',"]; [manageableHTML appendFormat:@"};"]; [manageableHTML appendFormat:@"//--></script>"]; [manageableHTML appendFormat:@"<script type=\"text/javascript\" "]; [manageableHTML appendFormat:@"src=\"http://pagead2.googlesyndication.com/pagead/show_afmc_ads.js\"></script>"]; [manageableHTML appendFormat:@"</body></html>"]; [self.webView loadHTMLString:manageableHTML baseURL:nil]; [self.view addSubview:self.webView]; Bofore testing, this javascript code are well operated in my google blog. I found that this code work at only mobile device. and I checked it through safari of my ipod touch. (It works well.) But Checking in the application, I don't see adsense. what is something wrong?

    Read the article

  • j2me bluetooth client. Function startInquiry nothing found.

    - by Hugi
    I develop simple j2me bluetooth client and have problem with bluetooth device search. Function startInquiry nothing found. Client : nokia 5220 Server : my pc with bluetooth adapter All bluetooth devices is on. /* * To change this template, choose Tools | Templates * and open the template in the editor. */ import javax.microedition.midlet.*; import javax.bluetooth.*; import java.util.Vector; import javax.microedition.lcdui.*; /** * @author ????????????? */ public class Midlet extends MIDlet implements DiscoveryListener { private static Vector vecDevices=new Vector(); private static String connectionURL=null; private LocalDevice localDevice; private DiscoveryAgent agent; private RemoteDevice remoteDevice; private RemoteDevice[] devList; private Display display; private Form form; public void startApp() { display = Display.getDisplay(this); form = new Form( "Client" ); try { localDevice = LocalDevice.getLocalDevice(); } catch( BluetoothStateException e ) { e.printStackTrace(); } form.append("Address: "+localDevice.getBluetoothAddress()+"\n\n"); form.append("Name: "+localDevice.getFriendlyName()+"\n\n"); try { agent = localDevice.getLocalDevice().getDiscoveryAgent(); form.append("Starting device inquiry... \n\n"); boolean si = agent.startInquiry(DiscoveryAgent.GIAC, this); if ( si ) { form.append("true"); } else { form.append("false"); } } catch( BluetoothStateException e ) { } int deviceCount = vecDevices.size(); if(deviceCount <= 0){ form.append("No Devices Found ."); } else{ //print bluetooth device addresses and names in the format [ No. address (name) ] form.append("Bluetooth Devices: "); for (int i = 0; i < deviceCount; i++) { remoteDevice=(RemoteDevice)vecDevices.elementAt(i); form.append( remoteDevice.getBluetoothAddress() ); } } display.setCurrent(form); } public void pauseApp() { } public void destroyApp(boolean unconditional) { } public void deviceDiscovered(RemoteDevice btDevice, DeviceClass cod) { //add the device to the vector if(!vecDevices.contains(btDevice)){ vecDevices.addElement(btDevice); } } public void inquiryCompleted(int discType) { } //implement this method since services are not being discovered public void servicesDiscovered(int transID, ServiceRecord[] servRecord) { if(servRecord!=null && servRecord.length>0){ connectionURL=servRecord[0].getConnectionURL(0,false); } } //implement this method since services are not being discovered public void serviceSearchCompleted(int transID, int respCode) { } }

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • How can call a JQuery function when it in side the from view (asp.net control)?

    - by ricky roy
    Hi, All I have a Span in side the Form view. I wanted to Call a Jquery Fucntion when the from load how can i do this? Thanks Waiting for your reply here is my code <asp:FormView ID="FormView1" runat="server" OnItemCommand="FormView1_ItemCommand"> <ItemTemplate> <asp:HiddenField ID="hidProductID" Value='<%#Eval("ProductID") %>' runat="server" /> <asp:HiddenField ID="hidCustomerID" Value='<%#Eval("CustomerID") %>' runat="server" /> <a href='<%=WinToSave.SettingsConstants.SiteURL%>WintoSave/AuctionProduct.aspx?id=<%#Eval("ProductID") %>'> <%#Eval("ProductName")%> </a> <br /> <img src='<%#Eval("ImagePath")%>' alt="Image No available" /> <br /> <asp:Label ID="lblTime" runat="server" Text='<%#Convert.ToDateTime(Eval("ModifiedOn")).ToString("hh:mm:ss") %>'></asp:Label> <span id='Countdown_<%#Eval("ProductID") %>' onload="GetTimeOnLoad('<%#Eval("ModifiedOn")%>','Countdown_<%#Eval("ProductID") %>');"></span> <br /> <asp:Label ID="lblFinalPrice" runat="server" Text='<%#Convert.ToDouble(Eval("FinalPrice")).ToString("#.00")%>'></asp:Label> <br /> <asp:Label ID="lblFullName" runat="server" Text='<%#Eval("FullName") %>'></asp:Label> <br /> <asp:Button ID="btnAddbid" Text="Bid" CommandName="AddBid" CommandArgument='<%#Eval("ID")%>' runat="server" /> </ItemTemplate> </asp:FormView> and following is my jquery code function GetTimeOnLoad(shortly,DivID) { var dt = new Date(shortly); alert(dt); alert(shortly); alert(DivID); var ProductDivID = "#" +DivID; alert(ProductDivID); $(ProductDivID).countdown({ until: dt, onExpiry: liftOff, onTick: watchCountdown, format: 'HMS', layout: '{hnn}{sep}{mnn}{sep}{snn}' }); } function liftOff(){}; function watchCountdown(){}; In above code I Used ' onload="GetTimeOnLoad('<%#Eval("ModifiedOn")%','Countdown_<%#Eval("ProductID") %');" but is not working

    Read the article

  • How do you programmatically set a Style on a View?

    - by Greg
    I would like to do something like this: <Button android:id="@+id/button" android:layout_width="wrap_content" android:layout_height="wrap_cotent" style="@style/SubmitButtonType" /> But in code The xml approach works fine provided that SubmitButtonType is defined. Now what I assume happens is that the appt parser runs through this xml, generates an AttributeSet. That AttributeSet when passed to context/theme#obtainStyledAttributes() will have the style ref mask anything that is not written inline in this tag. Great that's fine! Now how do we do this programmatically. Button, as well as other View types, has a constructor that has the form: <Widget>(Context context, AttributeSet set, int defStyle). So I thought this would work. Button button = new Button(context, null, R.style.SubmitButtonType); However, I am finding that defStyle is badly documented as it really should be written to be a resourceId to an attribute (from R.attrs) that will be passed to obtainStyledAttributes() as the attribute resource, and not the style resource. After looking at the code, all the view implementations seem to pass 0 as the styleRef. I don't see the harm in having it passed as both the attr and the style resource (more flexible and negligible overhead) However I might be approaching this all wrong. How do you do this in code then other than by setting each individual element of the style to the specific widget you want to style (only possible by looking a the code to see what param maps to which method or set of methods). The only way I have found to do this is: <declare-styleable> <attr name="totallyAdhoc_attribute_just_for_this_case" format="reference"> </declare-styleable> <style name="MyAlreadyExistantTheme" > ... ... <item name="totallyAdhoc_attribute_just_for_this_case">@style/SubmitButtonType</item> </style> And instead of passing R.style.SubmitButtonType as defStyle, I pass the new R.attr.totallyAdhoc_attribute_just_for_this_case. Button button = new Button(context, null, R.attr.totallyAdhoc_attribute_just_for_this_case); This works but sounds way too complicated.

    Read the article

  • Jquery Autocomplete after space press

    - by Limpep
    I am having an issue with my auto-complete feature such as when a user presses the space button the auto-complete doesn't show up again. Here is my code script type="text/javascript"> function lookup(inputString) { if(inputString.length == 0) { // Hide the suggestion box. $('#suggestions').hide(); } else { $.post("autocomplete.php", { queryString: ""+inputString+"" }, function(data){ if(data.length >0) { $('#suggestions').show(); $('#autoSuggestionsList').html(data); } }); } } // lookup function fill(thisValue) { $('#tag').val(thisValue); setTimeout("$('#suggestions').hide();", 200); } here my php code <?php require_once('config.php'); $db = new mysqli(DB_HOST, DB_USER, DB_PASSWORD,DB_DATABASE); if(!$db) { // Show error if we cannot connect. echo 'ERROR: Could not connect to the database.'; } else { // Is there a posted query string? if(isset($_POST['queryString'])) { $queryString = $db->real_escape_string($_POST['queryString']); // Is the string length greater than 0? if(strlen($queryString) >0) { // Run the query: We use LIKE '$queryString%' // The percentage sign is a wild-card, in my example of countries it works like this... // $queryString = 'Uni'; // Returned data = 'United States, United Kindom'; $query = $db->query("SELECT name FROM tag WHERE name LIKE '$queryString%' ORDER BY name LIMIT 10"); if($query) { // While there are results loop through them - fetching an Object (i like PHP5 btw!). while ($result = $query ->fetch_object()) { // Format the results, im using <li> for the list, you can change it. // The onClick function fills the textbox with the result. echo '<li onClick="fill(\''.$result->name.'\');">'.$result->name.'</li>'; } } else { echo 'ERROR: There was a problem with the query.'; } } else { // Dont do anything. } // There is a queryString. } else { echo 'There should be no direct access to this script!'; } } ? Any help would be great, thanks.

    Read the article

< Previous Page | 543 544 545 546 547 548 549 550 551 552 553 554  | Next Page >