Search Results

Search found 6654 results on 267 pages for 'socket io'.

Page 55/267 | < Previous Page | 51 52 53 54 55 56 57 58 59 60 61 62  | Next Page >

  • Determine if the current thread has low I/O priority

    - by Magnus Hoff
    I have a background thread that does some I/O-intensive background type work. To please the other threads and processes running, I set the thread priority to "background mode" using SetThreadPriority, like this: SetThreadPriority(GetCurrentThread(), THREAD_MODE_BACKGROUND_BEGIN); However, THREAD_MODE_BACKGROUND_BEGIN is only available in Windows Server 2008 or newer, as well as Windows Vista and newer, but the program needs to work well on Windows Server 2003 and XP as well. So the real code is more like this: if (!SetThreadPriority(GetCurrentThread(), THREAD_MODE_BACKGROUND_BEGIN)) { SetThreadPriority(GetCurrentThread(), THREAD_PRIORITY_LOWEST); } The problem with this is that on Windows XP it will totally disrupt the system by using too much I/O. I have a plan for a ugly and shameful way of mitigating this problem, but that depends on me being able to determine if the current thread has low I/O priority or not. Now, I know I can store which thread priority I ended up setting, but the control flow in the program is not really well suited for this. I would rather like to be able to test later whether or not the current thread has low I/O priority -- if it is in "background mode". GetThreadPriority does not seem to give me this information. Is there any way to determine if the current thread has low I/O priority?

    Read the article

  • best way to output a full precision double into a text file

    - by flevine100
    Hi, I need to use an existing text file to store some very precise values. When read back in, the numbers essentially need to be exactly equivalent to the ones that were originally written. Now, a normal person would use a binary file... for a number of reasons, that's not possible in this case. So... do any of you have a good way of encoding a double as a string of characters (aside from increasing the precision). My first thought was to cast the double to a char[] and write out the chars. I don't think that's going to work because some of the characters are not visible, produce sounds, and even terminate strings ('\0'... I'm talkin to you!) Thoughts?

    Read the article

  • Fastest way to read data from a lot of ASCII files

    - by Alsenes
    Hi guys, for a college exercise that I've already submitted I needed to read a .txt file wich contained a lot of names of images(1 in each line). Then I needed to open each image as an ascii file, and read their data(images where in ppm format), and do a series of things with them. The things is, I noticed my program was taking 70% of the time in the reading the data from the file part, instead of in the other calculations that I was doing (finding number of repetitions of each pixel with a hash table, finding diferents pixels beetween 2 images etc..), which I found quite odd to say the least. This is how the ppm format looks like: P3 //This value can be ignored when reading the file, because all image will be correctly formatted 4 4 255 //This value can be also ignored, will be always 255. 0 0 0 0 0 0 0 0 0 15 0 15 0 0 0 0 15 7 0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 0 0 0 15 0 15 0 0 0 0 0 0 0 0 0 This is how I was reading the data from the files: ifstream fdatos; fdatos.open(argv[1]); //Open file with the name of all the images const int size = 128; char file[size]; //Where I'll get the image name Image *img; while (fdatos >> file) { //While there's still images anmes left, continue ifstream fimagen; fimagen.open(file); //Open image file img = new Image(fimagen); //Create new image object with it's data file ……… //Rest of the calculations whith that image ……… delete img; //Delete image object after done fimagen.close(); //Close image file after done } fdatos.close(); And inside the image object read the data like this: const int tallafirma = 100; char firma[tallafirma]; fich_in >> std::setw(100) >> firma; // Read the P3 part, can be ignored int maxvalue, numpixels; fich_in >> height >> width >> maxvalue; // Read the next three values numpixels = height*width; datos = new Pixel[numpixels]; int r,g,b; //Don't need to be ints, max value is 256, so an unsigned char would be ok. for (int i=0; i<numpixels; i++) { fich_in >> r >> g >> b; datos[i] = Pixel( r, g ,b); } //This last part is the slow one, //I thing I should be able to read all this data in one single read //to buffer or something which would be stored in an array of unsigned chars, //and then I'd only need to to do: //buffer[0] -> //Pixel 1 - Red data //buffer[1] -> //Pixel 1 - Green data //buffer[2] -> //Pixel 1 - Blue data So, any Ideas? I think I can improve it quite a bit reading all to an array in one single call, I just don't know how that is done. Also, is it posible to know how many images will be in the "index file"? Is it posiible to know the number of lines a file has?(because there's one file name per line..) Thanks!!

    Read the article

  • fprintf() within a subprogram

    - by sergio
    Im stuck when trying to write to my file within my subprogram. void new_page(float *a, float *b, float *c, int *d){ fprintf(results,"\nPage Totals: %f\t%f\t%f\t%d", *a,*b,*c,*d); } I get a warning saying "Warning: incompatible implicit declaration of built-in function 'fprinf' [enabled by default]" "error: 'results' undeclared (first use in this function)" in main fprintf works fine, its just when it comes to the subprogram/function it wont work. from my understanding it thinks that results is undeclared, so do i have to pass the name or location of the file to make it work?

    Read the article

  • c++ File input/output

    - by Myx
    Hi: I am trying to read from a file using fgets and sscanf. In my file, I have characters on each line of the while which I wish to put into a vector. So far, I have the following: FILE *fp; fp = fopen(filename, "r"); if(!fp) { fprintf(stderr, "Unable to open file %s\n", filename); return 0; } // Read file int line_count = 0; char buffer[1024]; while(fgets(buffer, 1023, fp)) { // Increment line counter line_count++; char *bufferp = buffer; ... while(*bufferp != '\n') { char *tmp; if(sscanf(bufferp, "%c", tmp) != 1) { fprintf(stderr, "Syntax error reading axiom on " "line %d in file %s\n", line_count, filename); return 0; } axiom.push_back(tmp); printf("put %s in axiom vector\n", axiom[axiom.size()-1]); // increment buffer pointer bufferp++; } } my axiom vector is defined as vector<char *> axiom;. When I run my program, I get a seg fault. It happens when I do the sscanf. Any suggestions on what I'm doing wrong?

    Read the article

  • Read whole ASCII file into C++ std::string

    - by Arrieta
    Hello, I need to read a whole file into memory and place it in a C++ std::string. If I were to read it into a char, the answer would be very simple: std::ifstream t; int lenght; t.open("file.txt", "r"); // open input file t.seekg(0, std::ios::end); // go to the end length = t.tellg(); // report location (this is the lenght) t.seekg(0, std::ios::beg); // go back to the beginning buffer = new char[length]; // allocate memory for a buffer of appropriate dimension t.read(buffer, length); // read the whole file into the buffer t.close(); // close file handle // ... do stuff with buffer here ... Now, I want to do the exact same thing, but using a std::string instead of a char. I want to avoid loops, i. e., I don't want to: std::ifstream t; t.open("file.txt", "r"); std::string buffer; std::string line; while(t){ std::getline(t, line); // ... append line to buffer and go on } t.close() any ideas?

    Read the article

  • Why does C's "fopen" take a "const char *" as its second argument?

    - by Chris Cooper
    It has always struck me as strange that the C function "fopen" takes a "const char *" as the second argument. I would think it would be easier to both read your code and implement the library's code if there were bit masks defined in stdio.h, like "IO_READ" and such, so you could do things like: FILE* myFile = fopen("file.txt", IO_READ & IO_WRITE); Is there a programmatic reason for the way it actually is, or is it just historic? (i.e. "That's just the way it is.")

    Read the article

  • What file format can I use to output a formatted text file straight from a program without having the markup be too complicated?

    - by Matt
    Premise: I am parsing a file that is quite nearly XML, but not quite. From this file I would like to extract data and output in a file that a user could open up in some program and read. To make the data reasonable, I would almost certainly need to format the text. In case it matters, I will probably be using Java to write the program. Problem: I cannot find a file format that supports formatting without having terribly complex rules and encoding problems. Attempts: I looked into a basic .txt extension first, but it does not have enough formatting advantage. I then tried a .rtf extension, but the rules for outputting text seem to be terribly complicated. It was then suggested that I used XML, but I do not understand how this file would be viewed. This appears to be probably the best solution, but I don't understand much about it. Perhaps somebody could shed some light here. In Other Words: Could somebody suggest and easy to use file format and/or shed some light on how to use XML for text formatting and viewing?

    Read the article

  • How to read comma separated values from text file in JAVA?

    - by user1425223
    I have got this text file with latitude and longitude values of different points on a map. I want to store these coordinates into a mySQL database using hibernate. I want to know how can I split my string into latitudes and longitudes? What is the general way to do these type of things that is with other delimiters like space, tab etc.? File: 28.515046280572285,77.38258838653564 28.51430151808072,77.38336086273193 28.513566177802456,77.38413333892822 28.512830832397192,77.38490581512451 28.51208605426073,77.3856782913208 28.511341270865113,77.38645076751709 28.510530488025346,77.38720178604126 28.509615992924807,77.38790988922119 28.50875805732363,77.38862872123718 28.507994394490268,77.38943338394165 28.50728729434496,77.39038825035095 28.506674470385246,77.39145040512085 28.506174780521828,77.39260911941528 28.505665660113582,77.39376783370972 28.505156537248446,77.39492654800415 28.50466626846366,77.39608526229858 28.504175997400655,77.39724397659302 28.503685724059455,77.39840269088745 28.503195448440064,77.39956140518188 28.50276174118543,77.4007523059845 28.502309175192945,77.40194320678711 28.50185660725938,77.40313410758972 28.50140403738471,77.40432500839233 28.500951465568985,77.40551590919495 28.500498891812207,77.40670680999756 28.5000463161144,77.40789771080017 28.49959373847559,77.40908861160278 Code I am using to read from file: try { BufferedReader in = new BufferedReader(new FileReader("G:\\RoutePPAdvant2.txt")); String str; str = in.readLine(); while ((str = in.readLine()) != null) { System.out.println(str); } in.close(); } catch (IOException e) { System.out.println("File Read Error"); }

    Read the article

  • Search a string in a file and write the matched lines to another file in Java

    - by Geeta
    For searching a string in a file and writing the lines with matched string to another file it takes 15 - 20 mins for a single zip file of 70MB(compressed state). Is there any ways to minimise it. my source code: getting Zip file entries zipFile = new ZipFile(source_file_name); entries = zipFile.entries(); while (entries.hasMoreElements()) { ZipEntry entry = (ZipEntry)entries.nextElement(); if (entry.isDirectory()) { continue; } searchString(Thread.currentThread(),entry.getName(), new BufferedInputStream (zipFile.getInputStream(entry)), Out_File, search_string, stats); } zipFile.close(); Searching String public void searchString(Thread CThread, String Source_File, BufferedInputStream in, File outfile, String search, String stats) throws IOException { int count = 0; int countw = 0; int countl = 0; String s; String[] str; BufferedReader br2 = new BufferedReader(new InputStreamReader(in)); System.out.println(CThread.currentThread()); while ((s = br2.readLine()) != null) { str = s.split(search); count = str.length - 1; countw += count; //word count if (s.contains(search)) { countl++; //line count WriteFile(CThread,s, outfile.toString(), search); } } br2.close(); in.close(); } -------------------------------------------------------------------------------- public void WriteFile(Thread CThread,String line, String out, String search) throws IOException { BufferedWriter bufferedWriter = null; System.out.println("writre thread"+CThread.currentThread()); bufferedWriter = new BufferedWriter(new FileWriter(out, true)); bufferedWriter.write(line); bufferedWriter.newLine(); bufferedWriter.flush(); } Please help me. Its really taking 40 mins for 10 files using threads and 15 - 20 mins for a single file of 70MB after being compressed. Any ways to minimise the time.

    Read the article

  • Read from file in eclipse

    - by Buzkie
    I'm trying to read from a text file to input data to my java program. However, eclipse continuosly gives me a Source not found error no matter where I put the file. I've made an additional sources folder in the project directory, the file in question is in both it and the bin file for the project and it still can't find it. I even put a copy of it on my desktop and tried pointing eclipse there when it asked me to browse for the source lookup path. No matter what I do it can't find the file. here's my code in case it's pertinent: System.out.println(System.getProperty("user.dir")); File file = new File("file.txt"); Scanner scanner = new Scanner(file); in addition, it says the user directory is the project directory and there is a copy there too. I have no clue what to do. Thanks, Alex after attempting the suggestion below and refreshing again, I was greeted by a host of errors. FileNotFoundException(Throwable).<init>(String) line: 195 FileNotFoundException(Exception).<init>(String) line: not available FileNotFoundException(IOException).<init>(String) line: not available FileNotFoundException.<init>(String) line: not available URLClassPath$JarLoader.getJarFile(URL) line: not available URLClassPath$JarLoader.access$600(URLClassPath$JarLoader, URL) line: not available URLClassPath$JarLoader$1.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] URLClassPath$JarLoader.ensureOpen() line: not available URLClassPath$JarLoader.<init>(URL, URLStreamHandler, HashMap) line: not available URLClassPath$3.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] URLClassPath.getLoader(URL) line: not available URLClassPath.getLoader(int) line: not available URLClassPath.access$000(URLClassPath, int) line: not available URLClassPath$2.next() line: not available URLClassPath$2.hasMoreElements() line: not available ClassLoader$2.hasMoreElements() line: not available CompoundEnumeration<E>.next() line: not available CompoundEnumeration<E>.hasMoreElements() line: not available ServiceLoader$LazyIterator.hasNext() line: not available ServiceLoader$1.hasNext() line: not available LocaleServiceProviderPool$1.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] LocaleServiceProviderPool.<init>(Class<LocaleServiceProvider>) line: not available LocaleServiceProviderPool.getPool(Class<LocaleServiceProvider>) line: not available NumberFormat.getInstance(Locale, int) line: not available NumberFormat.getNumberInstance(Locale) line: not available Scanner.useLocale(Locale) line: not available Scanner.<init>(Readable, Pattern) line: not available Scanner.<init>(ReadableByteChannel) line: not available Scanner.<init>(File) line: not available code used: System.out.println(System.getProperty("user.dir")); File file = new File(System.getProperty("user.dir") + "/file.txt"); Scanner scanner = new Scanner(file);

    Read the article

  • How can I exclude words with apostrophes when reading into a table of strings?

    - by rearden
    ifstream fin; string temp; fin.open("engldict.txt"); if(fin.is_open()) { bool apos = false; while(!fin.eof()) { getline(fin, temp, '\n'); if(temp.length() > 2 && temp.length() < 7) { for(unsigned int i = 0; i < temp.length(); i++) { if(temp.c_str()[i] == '\'') apos = true; } if(!apos) dictionary.insert(temp); } } } This code gives me a runtime error: Unhandled exception at 0x00A50606 in Word Jumble.exe: 0xC0000005: Access violation reading location 0x00000014. and throws me a break point at: size_type size() const _NOEXCEPT { // return length of sequence return (this->_Mysize); } within the xstring header. This exception is thrown no matter what character I use, so long as it is present within the words I am reading in. I am aware that it is probably a super simple fix, but I just really need another set of eyes to see it. Thanks in advance.

    Read the article

  • Unable to open a file for writing

    - by asdasdas
    I am trying to write to a file. I do a file_exists check on it before I do fopen and it returns true (the file does exist). However, the file fails this code and gives me the error every time: $handle = fopen($filename, 'w'); if($handle) { flock($handle, LOCK_EX); fwrite($handle, $contents); } else { echo 'ERROR: Unable to open the file for writing.',PHP_EOL; exit(); } flock($handle, LOCK_UN); fclose($handle); Is there a way I can get more specific error details as to why this file does not let me open it for writing? I know that the filename is legit, but for some reason it just wont let me write to it. I do have write permissions, I was able to write and write over another file.

    Read the article

  • Do we need seperate file path for window and linux in java

    - by Kishor Sharma
    I have a file on linux ubuntu server hosted with path name /home/kishor/project/detail/. When I made a web app in window to upload and download file from specified location i used path "c:\kishor\projects\detail\" for saving in window. For my surprise when i used window file path name in my server i am still able to get files and upload them, i.e, "c:\kishor\projects\detail\". Can anyone explain why it is working (as window and linux both use different file path pattern).

    Read the article

  • fortran error I/O

    - by jpcgandre
    I get this error when compiling: forrtl: severe (256): unformatted I/O to unit open for formatted transfers, unit 27, file C:\Abaqus_JOBS\w.txt The error occurs in the beginning of the analysis. At the start, the file w.txt is created but is empty. The error may be related to the fact that I want to read from an empty file. My code is: OPEN(27, FILE = "C:/Abaqus_JOBS/w.txt", status = "UNKNOWN") READ(27, *, iostat=stat) w IF (stat .NE. 0) CALL del_file(27, stat) SUBROUTINE del_file(uFile, stat) IMPLICIT NONE INTEGER uFile, stat C If the unit is not open, stat will be non-zero CLOSE(unit=uFile, status='delete', iostat=stat) END SUBROUTINE Ref: Close multiple files If you agree with my opion about the cause of the error, is there a way to solve it? Thanks

    Read the article

  • Extract some data from a lot of xml files

    - by LifeH2O
    I have cricket player profiles saved in the form of .xml files in a folder. each file has these tags in it <playerid>547</playerid> <majorteam>England</majorteam> <playername>Don</playername> the playerid is same as in .xml (each file is of different size,1kb to 5kb). These are about 500 files. What i need is to extract the playername, majorteam, and playerid from all these files to a list. I will convert that list to XML later. If you know how can i do it directly to XML i will be very thankful.

    Read the article

  • Spring Integration 1.0 RC2: Streaming file content?

    - by gdm
    I've been trying to find information on this, but due to the immaturity of the Spring Integration framework I haven't had much luck. Here is my desired work flow: New files are placed in an 'Incoming' directory Files are picked up using a file:inbound-channel-adapter The file content is streamed, N lines at a time, to a 'Stage 1' channel, which parses the line into an intermediary (shared) representation. This parsed line is routed to multiple 'Stage 2' channels. Each 'Stage 2' channel does its own processing on the N available lines to convert them to a final representation. This channel must have a queue which ensures no Stage 2 channel is overwhelmed in the event that one channel processes significantly slower than the others. The final representation of the N lines is written to a file. There will be as many output files as there were routing destinations in step 4. *'N' above stands for any reasonable number of lines to read at a time, from [1, whatever I can fit into memory reasonably], but is guaranteed to always be less than the number of lines in the full file. How can I accomplish streaming (steps 3, 4, 5) in Spring Integration? It's fairly easy to do without streaming the files, but my files are large enough that I cannot read the entire file into memory. As a side note, I have a working implementation of this work flow without Spring Integration, but since we're using Spring Integration in other places in our project, I'd like to try it here to see how it performs and how the resulting code compares for length and clarity.

    Read the article

  • Most efficient way to write over file after reading

    - by Ryan McClure
    I'm reading in some data from a file, manipulating it, and then overwriting it to the same file. Until now, I've been doing it like so: open (my $inFile, $file) or die "Could not open $file: $!"; $retString .= join ('', <$inFile>); ... close ($inFile); open (my $outFile, $file) or die "Could not open $file: $!"; print $outFile, $retString; close ($inFile); However I realized I can just use the truncate function and open the file for read/write: open (my $inFile, '+<', $file) or die "Could not open $file: $!"; $retString .= join ('', <$inFile>); ... truncate $inFile, 0; print $inFile $retString; close ($inFile); I don't see any examples of this anywhere. It seems to work well, but am I doing it correctly? Is there a better way to do this?

    Read the article

  • Improve performance writing 10 million records to text file using windows service

    - by user1039583
    I'm fetching more than 10 millions of records from database and writing to a text file. It takes hours of time to complete this operation. Is there any option to use TPL features here? It would be great if someone could get me started implementing this with the TPL. using (FileStream fStream = new FileStream("d:\\file.txt", FileMode.OpenOrCreate, FileAccess.ReadWrite)) { BufferedStream bStream = new BufferedStream(fStream); TextWriter writer = new StreamWriter(bStream); for (int i = 0; i < 100000000; i++) { writer.WriteLine(i); } bStream.Flush(); writer.Flush(); // empty buffer; fStream.Flush(); }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to open files in Java Swing without JFileChooser

    - by ron
    I'm using Java Swing (GUI) and I want to add a button to my project for opening files . I don't like the JFileChooser since it opens a small window for browsing through the files of the directories . Can I use something else , instead of the JFileChooser under Java Swing ? I've tried to use elements of SWT but it didn't work , meaning is the use of the button object and then use it inside the Jframe , but that failed , so I guess SWT and Swing don't mix together? Here is the example of Java Swing with JFileChooser and I'm looking for something like this to put in my JFrame.

    Read the article

< Previous Page | 51 52 53 54 55 56 57 58 59 60 61 62  | Next Page >