Search Results

Search found 37573 results on 1503 pages for 'browser close event'.

Page 554/1503 | < Previous Page | 550 551 552 553 554 555 556 557 558 559 560 561  | Next Page >

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • destroy cfwindow in javascript 'is not a function'

    - by Ryan French
    Hi All, Having an issue here that I have tried everything I can think of but cant get it to work. I have a page with a link that creates a cfwindow like so function create_window(ID){ var config = new Object(); config.modal=true; config.center=true; config.height=775; config.width=700; config.resizable=false; config.closable=false; config.draggable=false; config.refreshonshow=true; ColdFusion.Window.create('newWindow','Window Title', '/source/url'+ID, config) The window is created and the URL has the ID parsed to it that is used for displaying the correct item in the window. This all works fine. The problem is when I try and close the window and open a new window with a different item being displayed, the URL is not changed. I realise that this is because the window is being hidden, and not destroyed, and therefore it is the same window being opened. So I have created an onHide event handler to destroy the window like so. function showItemDetails(){ var ID=document.getElementById("sList").value create_window(ID); ColdFusion.Window.onHide('newWindow', refreshList); } function refreshList(){ ColdFusion.bindHandlerCache['sList'].call(); ColdFusion.Window.destroy('newWindow',true); } Now when I close the window Firebug is returning the error "ColdFusion.Window.destroy is not a function" (In IE the error is "Object doesn't support this property or method"). I have made sure we are running the latest version of ColdFusion 8.01 on the server (as I know that .destroy wasnt added until 8.01) and have applied the latest hotfixes to the server as well. Any ideas?

    Read the article

  • ASP.net AppendHeader not working in ASP MVC

    - by Chao
    I'm having problems getting AppendHeader to work properly if I am also using an authorize filter. I'm using an actionfilter for my AJAX actions that applies Expires, Last-Modified, Cache-Control and Pragma (though while testing I have tried including it in the action method itself with no change in results). If I don't have an authorize filter the headers work fine. Once I add the filter the headers I tried to add get stripped. The headers I want to add Response.AppendHeader("Expires", "Sun, 19 Nov 1978 05:00:00 GMT"); Response.AppendHeader("Last-Modified", String.Format("{0:r}", DateTime.Now)); Response.AppendHeader("Cache-Control", "no-store, no-cache, must-revalidate"); Response.AppendHeader("Cache-Control", "post-check=0, pre-check=0"); Response.AppendHeader("Pragma", "no-cache"); An example of the headers from a correct page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:22:24 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache Expires Sun, 19 Nov 1978 05:00:00 GMT Last-Modified Mon, 14 Jun 2010 18:22:24 GMT Cache-Control no-store, no-cache, must-revalidate, post-check=0, pre-check=0 Content-Type text/html; charset=utf-8 Content-Length 352 Connection Close And from an incorrect page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:27:34 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache, no-cache Cache-Control private, s-maxage=0 Content-Type text/html; charset=utf-8 Content-Length 4937 Connection Close

    Read the article

  • MS-Access: What could cause one form with a join query to load right and another not?

    - by Daniel Straight
    Form1 Form1 is bound to Table1. Table1 has an ID field. Form2 Form2 is bound to Table2 joined to Table1 on Table2.Table1_ID=Table1.ID Here is the SQL (generated by Access): SELECT Table2.*, Table1.[FirstFieldINeed], Table1.[SecondFieldINeed], Table1.[ThirdFieldINeed] FROM Table1 INNER JOIN Table2 ON Table1.ID = Table2.[Table1_ID]; Form2 is opened with this code in Form1: DoCmd.RunCommand acCmdSaveRecord DoCmd.OpenForm "Form2", , , , acFormAdd, , Me.[ID] DoCmd.Close acForm, "Form1", acSaveYes And when loaded runs: Me.[Table1_ID] = Me.OpenArgs When Form2 is loaded, fields bound to columns from Table1 show up correctly. Form3 Form3 is bound to Table3 joined to Table2 on Table3.Table2_ID=Table2.ID Here is the SQL (generated by Access): SELECT Table3.*, Table2.[FirstFieldINeed], Table2.[SecondFieldINeed] FROM Table2 INNER JOIN Table3 ON Table2.ID = Table3.[Table2_ID]; Form3 is opened with this code in Form2: DoCmd.RunCommand acCmdSaveRecord DoCmd.OpenForm "Form3", , , , acFormAdd, , Me.[ID] DoCmd.Close acForm, "Form2", acSaveYes And when loaded runs: Me.[Table2_ID] = Me.OpenArgs When Form3 is loaded, fields bound to columns from Table2 do not show up correctly. WHY? UPDATES I tried making the join query into a separate query and using that as my record source, but it made no difference at all. If I go to the query for Form3 and view it in datasheet view, I can see that the information that should be pulled into the form is there. It just isn't showing up on the form.

    Read the article

  • Java HttpURLConnection bekommt keine cookies

    - by TeNNoX
    ich versuche über eine HttpURLConnection einen Login auf einer Webseite durchzuführen, und davon dann die cookies zu erhalten... Bei meinen Testseiten auf einem eigenen Server geht es problemlos, ich sende "a=3&b=5" und als cookie erhalte ich "8", also die Summe. Wenn ich dies allerdings auf der gewollten Seite anwende, kommt einfach nur die Seite, als ob ich gar nichts per POST gesendet hätte... :( Generelle Verbesserungsvorschläge sind auch erwünscht! :) Mein Code: HttpURLConnection conn = (HttpURLConnection) new URL(url).openConnection(); conn.setDoInput(true); conn.setDoOutput(true); conn.setRequestMethod("POST"); conn.setRequestProperty("useragent", "Mozilla/5.0 (Windows NT 6.1; WOW64; rv:17.0) Gecko/20100101 Firefox/17.0"); conn.setRequestProperty("Connection", "keep-alive"); DataOutputStream out = new DataOutputStream(conn.getOutputStream()); out.writeBytes("USER=tennox&PASS=*****"); out.close(); BufferedReader in = new BufferedReader(new InputStreamReader(conn.getInputStream())); String line; String response = new String(); while ((line = in.readLine()) != null) { response = response + line + "\n"; } in.close(); System.out.println("headers:"); int i = 0; String header; while ((header = conn.getHeaderField(i)) != null) { String key = conn.getHeaderFieldKey(i); System.out.println(((key == null) ? "" : key + ": ") + header); i++; } String cookies = conn.getHeaderField("Set-Cookie"); System.out.println("\nCookies: \"" + cookies + "\"");

    Read the article

  • How can I terminate a system command with alarm in Perl?

    - by rockyurock
    I am running the below code snippet on Windows. The server starts listening continuously after reading from client. I want to terminate this command after a time period. If I use alarm() function call within main.pl, then it terminates the whole Perl program (here main.pl), so I called this system command by placing it in a separate Perl file and calling this Perl file (alarm.pl) in the original Perl File using the system command. But in this way I was unable to take the output of this system() call neither in the original Perl File nor in called one Perl File. Could anybody please let me know the way to terminate a system() call or take the output in that way I used above? main.pl my @output = system("alarm.pl"); print"one iperf completed\n"; open FILE, ">display.txt" or die $!; print FILE @output_1; close FILE; alarm.pl alarm 30; my @output_1 = readpipe("adb shell cd /data/app; ./iperf -u -s -p 5001"); open FILE, ">display.txt" or die $!; print FILE @output_1; close FILE; In both ways display.txt is always empty.

    Read the article

  • Making .NET assembly COM-visible and working for VB5

    - by Cyberherbalist
    I have an assembly which I have managed to make visible to VB6 and it works, but having a problem accomplishing the same thing with VB5. For VB6, I have built the assembly, made it COM-visible, registered it as a COM object etc., and the assembly shows in VB6's References list, and allows me to use it successfully. The Object Browser also shows the method in the assy. I copied the assembly and its TLB to a virtual workstation used for VB5 development, and ran Regasm, apparently successfully: C:\>C:\WINDOWS\Microsoft.NET\Framework\v2.0.50727 \regasm arserviceinterface.dll /tlb:arserviceinterface.tlb Microsoft (R) .NET Framework Assembly Registration Utility 2.0.50727.3053 Copyright (C) Microsoft Corporation 1998-2004. All rights reserved. Assembly exported to 'C:\Projects\AR\3rd Party\ARService\arserviceinterface.tlb' , and the type library was registered successfully Note that the virtual W/S is Win2k and does not have .NET Fx 3.5 on it, just 2.0. The assembly shows up in the References that can be selected in VB5, but the method of the assembly doesn't show up in the Object Browser, and it is generally unusable. Either there is a step to do that I haven't done, or VB5 doesn't know how to use such a COM object. Note that the VB5 setup is on a virtual workstation, not the same workstation that VB6 is installed on. Any ideas? One thing that occurred to me is that I might need to generate and use a strong name on the workstation in question, but...

    Read the article

  • In Java, send commands to another command-line program

    - by bradvido
    I am using Java on Windows XP and want to be able to send commands to another program such as telnet. I do not want to simply execute another program. I want to execute it, and then send it a sequence of commands once it's running. Here's my code of what I want to do, but it does not work: (If you uncomment and change the command to "cmd" it works as expected. Please help.) try { Runtime rt = Runtime.getRuntime(); String command = "telnet"; //command = "cmd"; Process pr = rt.exec(command); BufferedReader processOutput = new BufferedReader(new InputStreamReader(pr.getInputStream())); BufferedWriter processInput = new BufferedWriter(new OutputStreamWriter(pr.getOutputStream())); String commandToSend = "open localhost\n"; //commandToSend = "dir\n" + "exit\n"; processInput.write(commandToSend); processInput.flush(); int lineCounter = 0; while(true) { String line = processOutput.readLine(); if(line == null) break; System.out.println(++lineCounter + ": " + line); } processInput.close(); processOutput.close(); pr.waitFor(); } catch(Exception x) { x.printStackTrace(); }

    Read the article

  • Perl program - Dynamic Bootstrapping code

    - by mgj
    Hi.. I need to understand the working of this particular program, It seems to be quite complicated, could you please see if you could help me understanding what this program in Perl does, I am a beginner so I hardly can understand whats happening in the code given on the following link below, Any kind of guidance or insights wrt this program is highly appreciated. Thank you...:) This program is called premove.pl.c Its associated with one more program premove.pl, Its code looks like this: #!perl open (newdata,">newdata.txt") || die("cant create new file\n");#create passwd file $linedata = ""; while($line=<>){ chomp($line); #chop($line); print newdata $line."\n"; } close(newdata); close(olddata); __END__ I am even not sure how to run the two programs mentioned here. I wonder also what does the extension of the first program signify as it has "pl.c" extension, please let me know if you know what it could mean. I need to understand it asap thats why I am posting this question, I am kind of short of time else I would try to figure it out myself, This seems to be a complex program for a beginner like me, hope you understand. Thank you again for your time.

    Read the article

  • Tracking iPhone on Yahoo Web Analytics using ASIHTTPRequest

    - by Mads Mobæk
    I'm trying to track an event in my app using Yahoo Web Analytics. The code I am using looks like ASIHTTPRequest *yahooTrack = [ASIHTTPRequest requestWithURL: [NSURL URLWithString:@"http://s.analytics.yahoo.com/p.pl?a=xxxxxxxxxxxxx&js=no&b=yyyyyyyyyyyy&cf6=zzzzzzzzzzz"]]; yahooTrack.didFinishSelector = @selector(statisticsFinished:); yahooTrack.delegate = self; [yahooTrack startAsynchronous]; Then the statisticsFinished looks like: NSLog(@"Cookies: %@", request.requestCookies); NSLog(@"Redircount: %d", [request redirectCount]); NSLog(@"Responsecode %d %@\nMsg: %@", request.responseStatusCode, request.responseStatusMessage, [request responseString]); And all the information I get back looks correct. Cookies are set, redirectcount is 1 the first time (as it redirects to s.analytics.yahoo.com/itr.pl?.... a normal browser does). Then the redirectcount is 0 for subsequent request until the app is restarted and session cleared. The responseString returns GIF89a. Even if the data looks correct, Yahoo still won't track. As soon as I call the tracking url directly in my browser it works as expected. I realize Flurry is a better option, but I'm forced to use Yahoo in this case. Also, using a UIWebView probably would work, but I'm against putting in a webview just for tracking purposes. Is there any difference in how ASIHTTPRequest and Safari would handle a call to a simple URL as this? Or do you see anything else that could explain why the tracking isn't working?

    Read the article

  • Nginx not responding to remote IP

    - by bucabay
    I just installed Nginx listening on 8083 I can get a HTTP response when sending a HTTP request from the local machine. eg: curl -i localhost:8083 However, when I do the same from a remote machine, it just hangs until the ssh times out, or when the browser times out if accessed from the browser. I pretty much have the default config: user apache apache; worker_processes 1; error_log logs/error.log; #error_log logs/error.log notice; #error_log logs/error.log info; pid logs/nginx.pid; events { worker_connections 1024; } http { include mime.types; default_type application/octet-stream; log_format main '$remote_addr - $remote_user [$time_local] "$request" ' '$status $body_bytes_sent "$http_referer" ' '"$http_user_agent" "$http_x_forwarded_for"'; access_log logs/access.log main; sendfile on; tcp_nopush on; #keepalive_timeout 0; keepalive_timeout 65; #gzip on; server { listen 8083; server_name _; charset utf-8; #access_log logs/host.access.log main; location / { root html; index index.html index.php; } #error_page 404 /404.html; # redirect server error pages to the static page /50x.html # error_page 500 502 503 504 /50x.html; location = /50x.html { root html; } location ~ /\.ht { deny all; } } } any ideas?

    Read the article

  • Excel Reader ASP.NET

    - by user304429
    I declared a DataGrid in a ASP.NET View and I'd like to generate some C# code to populate said DataGrid with an Excel spreadsheet (.xlsx). Here's the code I have: <asp:DataGrid id="DataGrid1" runat="server"/> <script language="C#" runat="server"> protected void Page_Load(object sender, EventArgs e) { string connString = @"Provider=Microsoft.Jet.OLEDB.4.0;Data Source=c:\FileName.xlsx;Extended Properties=""Excel 12.0;HDR=YES;"""; // Create the connection object OleDbConnection oledbConn = new OleDbConnection(connString); try { // Open connection oledbConn.Open(); // Create OleDbCommand object and select data from worksheet Sheet1 OleDbCommand cmd = new OleDbCommand("SELECT * FROM [sheetname$]", oledbConn); // Create new OleDbDataAdapter OleDbDataAdapter oleda = new OleDbDataAdapter(); oleda.SelectCommand = cmd; // Create a DataSet which will hold the data extracted from the worksheet. DataSet ds = new DataSet(); // Fill the DataSet from the data extracted from the worksheet. oleda.Fill(ds, "Something"); // Bind the data to the GridView DataGrid1.DataSource = ds.Tables[0].DefaultView; DataGrid1.DataBind(); } catch { } finally { // Close connection oledbConn.Close(); } } </script> When I run the website, nothing really happens. What gives?

    Read the article

  • Java - Save video stream from Socket to File

    - by Alex
    I use my Android application for streaming video from phone camera to my PC Server and need to save them into file on HDD. So, file created and stream successfully saved, but the resulting file can not play with any video player (GOM, KMP, Windows Media Player, VLC etc.) - no picture, no sound, only playback errors. I tested my Android application into phone and may say that in this instance captured video successfully stored on phone SD card and after transfer it to PC played witout errors, so, my code is correct. In the end, I realized that the problem in the video container: data streamed from phone in MP4 format and stored in *.mp4 files on PC, and in this case, file may be incorrect for playback with video players. Can anyone suggest how to correctly save streaming video to a file? There is my code that process and store stream data (without errors handling to simplify): // getOutputMediaFile() returns a new File object DataInputStream in = new DataInputStream (server.getInputStream()); FileOutputStream videoFile = new FileOutputStream(getOutputMediaFile()); int len; byte buffer[] = new byte[8192]; while((len = in.read(buffer)) != -1) { videoFile.write(buffer, 0, len); } videoFile.close(); server.close(); Also, I would appreciate if someone will talk about the possible "pitfalls" in dealing with the conservation of media streams. Thank you, I hope for your help! Alex.

    Read the article

  • C# Error reading two dates from a binary file

    - by Jamie
    Hi all, When reading two dates from a binary file I'm seeing the error below: "The output char buffer is too small to contain the decoded characters, encoding 'Unicode (UTF-8)' fallback 'System.Text.DecoderReplacementFallback'. Parameter name: chars" My code is below: static DateTime[] ReadDates() { System.IO.FileStream appData = new System.IO.FileStream( appDataFile, System.IO.FileMode.Open, System.IO.FileAccess.Read); List<DateTime> result = new List<DateTime>(); using (System.IO.BinaryReader br = new System.IO.BinaryReader(appData)) { while (br.PeekChar() > 0) { result.Add(new DateTime(br.ReadInt64())); } br.Close(); } return result.ToArray(); } static void WriteDates(IEnumerable<DateTime> dates) { System.IO.FileStream appData = new System.IO.FileStream( appDataFile, System.IO.FileMode.Create, System.IO.FileAccess.Write); List<DateTime> result = new List<DateTime>(); using (System.IO.BinaryWriter bw = new System.IO.BinaryWriter(appData)) { foreach (DateTime date in dates) bw.Write(date.Ticks); bw.Close(); } } What could be the cause? Thanks

    Read the article

  • display sqlite datatable in a jtable

    - by tuxou
    Hi I'm trying to display an sqlite data table in a jtable but i have an error " sqlite is type forward only" how could I display it in a jtable try { long start = System.currentTimeMillis(); Statement state = ConnectionBd.getInstance().createStatement( ResultSet.TYPE_SCROLL_INSENSITIVE, ResultSet.CONCUR_READ_ONLY ); ResultSet res = state.executeQuery("SELECT * FROM data"); ResultSetMetaData meta = res.getMetaData(); Object[] column = new Object[meta.getColumnCount()]; for(int i = 1 ; i <= meta.getColumnCount(); i++){ column[i-1] = meta.getColumnName(i); } res.last(); int rowCount = res.getRow(); Object[][] data = new Object[res.getRow()][meta.getColumnCount()]; res.beforeFirst(); int j = 1; while(res.next()){ for(int i = 1 ; i <= meta.getColumnCount(); i++) data[j-1][i-1] = res.getObject(i); j++; } res.close(); state.close(); long totalTime = System.currentTimeMillis() - start; result.removeAll(); result.add(new JScrollPane(new JTable(data, column)), BorderLayout.CENTER); result.add(new JLabel("execute in " + totalTime + " ms and has " + rowCount + " ligne(s)"), BorderLayout.SOUTH); result.revalidate(); } catch (SQLException e) { result.removeAll(); result.add(new JScrollPane(new JTable()), BorderLayout.CENTER); result.revalidate(); JOptionPane.showMessageDialog(null, e.getMessage(), "ERREUR ! ", JOptionPane.ERROR_MESSAGE); } thank you

    Read the article

  • Winforms: How to display a "loading" form?

    - by Martijn
    I have a grid and when a row is double clicked a form is loaded. However a lot of data must be loaded, so I'd like to display a simple form with the text 'loading, please wait..'. And when all loading is finished, the form must disappear. This is what I have right now, but it doesn't work: Code that invokes the form with lots of data: FormWithLotData form = new FormWithLotData(); form.ShowDialog(this); Constructor of FormWithLotData: // Show load form FormIsLoading frm = new FormIsLoading(); _CloseLoadForm closeForm = new _CloseLoadForm(frm.Close); System.Threading.Thread thread = new System.Threading.Thread(frm.Show); thread.Start(); InitializeComponent(); this.Visible = false; LoadAllData(); this.Visible = true; // Close load form Invoke(closeForm); Hope you can help me out. EDIT: I'd like to show an animated gif on the loading form.

    Read the article

  • Simple perl program failing to execute

    - by yves Baumes
    Here is a sample that fails: #!/usr/bin/perl -w # client.pl #---------------- use strict; use Socket; # initialize host and port my $host = shift || 'localhost'; my $port = shift || 55555; my $server = "10.126.142.22"; # create the socket, connect to the port socket(SOCKET,PF_INET,SOCK_STREAM,(getprotobyname('tcp'))[2]) or die "Can't create a socket $!\n"; connect( SOCKET, pack( 'Sn4x8', AF_INET, $port, $server )) or die "Can't connect to port $port! \n"; my $line; while ($line = <SOCKET>) { print "$line\n"; } close SOCKET or die "close: $!"; with the error: Argument "10.126.142.22" isn't numeric in pack at D:\send.pl line 16. Can't connect to port 55555! I am using this version of Perl: This is perl, v5.10.1 built for MSWin32-x86-multi-thread (with 2 registered patches, see perl -V for more detail) Copyright 1987-2009, Larry Wall Binary build 1006 [291086] provided by ActiveState http://www.ActiveState.com Built Aug 24 2009 13:48:26 Perl may be copied only under the terms of either the Artistic License or the GNU General Public License, which may be found in the Perl 5 source kit. Complete documentation for Perl, including FAQ lists, should be found on this system using "man perl" or "perldoc perl". If you have access to the Internet, point your browser at http://www.perl.org/, the Perl Home Page. While I am running the netcat command on the server side. Telnet does work.

    Read the article

  • Paypal sandbox account in dotnet: "IPN Response invalid"

    - by Sam
    I am integrating Paypal with my website. I use a sandbox account, one buyer account and one seller account. I downloaded the code below from Paypal: string strSandbox = "https://www.sandbox.paypal.com/cgi-bin/webscr"; HttpWebRequest req = (HttpWebRequest)WebRequest.Create(strSandbox); //Set values for the request back req.Method = "POST"; req.ContentType = "application/x-www-form-urlencoded"; byte[] param = Request.BinaryRead(HttpContext.Current.Request.ContentLength); string strRequest = Encoding.ASCII.GetString(param); strRequest += "&cmd=_notify-validate"; req.ContentLength = strRequest.Length; //for proxy //WebProxy proxy = new WebProxy(new Uri("http://url:port#")); //req.Proxy = proxy; //Send the request to PayPal and get the response StreamWriter streamOut = new StreamWriter(req.GetRequestStream(), System.Text.Encoding.ASCII); streamOut.Write(strRequest); streamOut.Close(); StreamReader streamIn = new StreamReader(req.GetResponse().GetResponseStream()); string strResponse = streamIn.ReadToEnd(); streamIn.Close(); if (strResponse == "VERIFIED") { //check the payment_status is Completed //check that txn_id has not been previously processed //check that receiver_email is your Primary PayPal email //check that payment_amount/payment_currency are correct //process payment } else if (strResponse == "INVALID") { //log for manual investigation } else { //log response/ipn data for manual investigation } When I add this snippet in my pageload event of my success page, I show the IPN response as INVALID, but amount is paid successfully. Why is this? Paypal's docs are not clear.

    Read the article

  • Parallel scroll textarea and webpage with jquery

    - by Roger Rogers
    This is both a conceptual and how-to question: In wiki formatting, or non WYSIWYG editor scenarios, you typically have a textarea for content entry and then an ancillary preview pane to show results, just like StackOverflow. This works fairly well, except with larger amounts of text, such as full page wikis, etc. I have a concept that I'd like critical feedback/advice on: Envision a two pane layout, with the preview content on the left side, taking up ~ 2/3 of the page, and the textarea on the right side, taking up ~ 1/3 of the page. The textarea would float, to remain in view, even if the user scrolls the browser window. Furthermore, if the user scrolls the textarea content, supposing it has exceeded the textarea's frame size, the page would scroll so that the content presently showing in the textarea syncs/is parallel with the content showing in the browser window. I'm imagining a wiki scenario, where going back and forth between markup and preview is frustrating. I'm curious what others think; is there anything out there like this? Any suggestions on how to attack this functionality (ideally using jquery)? Thanks

    Read the article

  • ibatis problem using <isNull> whilst iterating over a List

    - by onoma
    Hi, I'm new to iBatis and I'm struggling with the and elements. I want to iterate over a List of Book instances (say) that are passed in as a HashMap: MyParameters. The list will be called listOfBooks. The clause of the overall SQL statement will therefore look like this: <iterate prepend="AND" property="MyParameters.listOfBooks" conjunction="AND" open="(" close=")"> ... </iterate> I also need to produce different SQL within the iterate elements depending on whether a property of each Book instance in the 'listOfBooks' List is null, or not. So, I need a statement something like this: <iterate prepend="AND" property="MyParameters.listOfBooks" conjunction="AND" open="(" close=")"> <isNull property="MyParameter.listOfBooks.title"> <!-- SQL clause #1 here --> </isNull> <isNotNull property="MyParameter.listOfBooks.title"> <!-- SQL clause #2 here --> </isNotNull> When I do this I get an error message stating that there is no "READABLE" property named 'title' in my Book class. However, each Book instance does contain a title property, so I'm confused! I can only assuem that I have managled the syntax in trying to pinpoint the title of particular Book instance in listOfBooks. I'm struggling to find the correct technique for trying to achieve this. If anyone can advise a way forward I'd be grateful. Thanks

    Read the article

  • Writing to a new window with javascript... get access denied

    - by Søren
    Hello gurus :) I have been struggling with this for a while now, and decided it was time to ask for help. I am trying to create a print function on an aspx page, and I am using javascript to do this: function PrintContentCell() { var display_setting = "toolbar=yes, location=no, directories=yes, menubar=yes,"; display_setting += "scrollbars=yes, width=750, height=600, left=100, top=25"; var content_innerhtml = document.getElementById("testTable").innerHTML; var document_print = window.open("Loading.htm", "", display_setting); document_print.document.open(); document_print.document.write('<html><head><title>Print</title></head>'); document_print.document.write('<body style="font-family:verdana; font-size:12px;" onLoad="self.print();self.close();" >'); document_print.document.write(content_innerhtml); document_print.document.write('</body></html>'); document_print.print(); document_print.document.close(); return false; } I get "Access Denied" when the script tries to write to the new window. The Loading.htm file is just a very slim html document writing out the text "Loading...". I had hoped this would work after reading this thread: http://stackoverflow.com/questions/735136/ie-6-7-access-denied-trying-to-access-a-popup-window-document Anybody can help?

    Read the article

  • How can I control the action of onbeforeunload in IE?

    - by SpawnCxy
    Hi all I've got a problem about onbeforeunload recently that I need to pop up a voting page if the user try closes their IE browser.And I did it by using <body onbeforeunload="makevote()"> And the main structure of makevote() in javascript as follows: function makevote() { comet.distruct(); if(csid != null && isvote == null) { window.event.returnValue = false window.event.returnValue='press “cancel” to vote please!' showComDiv(popvote,"popiframe",400,120,'your vote here','dovote()'); } } For last three months this voting function performed so ugly that I got only less than 8,000 votes from more than 4,50,000 vistors.I think the problem is, when the users try to close their browsers,the onbeforeunload property pops up a comfirm box which covered my voting box while most users click the OK button,which means close comfirming is done,as a habit.So my question is how can I control the comfirming box made by onbeforeunload myself? So far I can only define the message it shows.For example if I click the "OK" ,I'll go to the voting box instead of closing my IE.And if there's any other better way to do this?Help would be greatly appreciated! Regards

    Read the article

  • how can load images from plist in to UITableView ?

    - by srikanth rongali
    I have stored the videos and the thumbnail images of the videos in Documents folder. And I have given the path in plist. In plist I took an array and I added directories to the array. And in the dictionary I stored the image path /Users/srikanth/Library/Application Support/iPhone Simulator/User/Applications/9E6E8B22-C946-4442-9209-75BB0E924434/Documents/image1 for key imagePath. for video /Users/srikanth/Library/Application Support/iPhone Simulator/User/Applications/9E6E8B22-C946-4442-9209-75BB0E924434/Documents/video1.mp4 for key filePath. I used following code but it is not working. I am trying only for images. I need the images to be loaded in the table in each cell. - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithFrame:CGRectZero reuseIdentifier:CellIdentifier] autorelease]; [cell setAccessoryType:UITableViewCellAccessoryDetailDisclosureButton]; UIImageView *image2 = [[UIImageView alloc]init]; image2.frame = CGRectMake(0.0f, 0.0f, 80.0f, 80.0f); image2.backgroundColor = [UIColor clearColor]; //image2.image = [UIImage imageNamed:@"snook.png"]; image2.tag = tag7; } NSDictionary *dictOfplist = [cells objectAtIndex:indexPath.row]; [(UIImageView *)[cell viewWithTag:tag7] setImage:[dictOfplist objectForKey:@"imagePath"]]; return cell; } - (void)viewDidLoad { [super viewDidLoad]; self.title = @"Library"; self.navigationItem.rightBarButtonItem = [[UIBarButtonItem alloc] initWithTitle:@"Close" style:UIBarButtonItemStyleBordered target:self action:@selector(close:)]; NSString* plistPath = [[NSBundle mainBundle] pathForResource:@"details" ofType:@"plist"]; contentArray = [NSArray arrayWithContentsOfFile:plistPath]; cells = [[NSMutableArray alloc]initWithCapacity:[contentArray count]]; for(dCount = 0; dCount < [contentArray count]; dCount++) [cells addObject:[contentArray objectAtIndex:dCount]]; } How can I make this work. Thank you.

    Read the article

  • C#,coding with AES

    - by lolalola
    Hi, why i can coding only 128 bytes text? Work: string plainText = "1234567890123456"; Don't work: string plainText = "12345678901234561"; Don't work: string plainText = "123456789012345"; string plainText = "1234567890123456"; byte[] plainTextBytes = Encoding.UTF8.GetBytes(plainText); byte[] keyBytes = System.Text.Encoding.UTF8.GetBytes("1234567890123456"); byte[] initVectorBytes = System.Text.Encoding.UTF8.GetBytes("1234567890123456"); RijndaelManaged symmetricKey = new RijndaelManaged(); symmetricKey.Mode = CipherMode.CBC; symmetricKey.Padding = PaddingMode.Zeros; ICryptoTransform encryptor = symmetricKey.CreateDecryptor(keyBytes, initVectorBytes); MemoryStream memoryStream = new MemoryStream(); CryptoStream cryptoStream = new CryptoStream(memoryStream, encryptor, CryptoStreamMode.Write); cryptoStream.Write(plainTextBytes, 0, plainTextBytes.Length); cryptoStream.FlushFinalBlock(); byte[] cipherTextBytes = memoryStream.ToArray(); memoryStream.Close(); cryptoStream.Close(); string cipherText = Convert.ToBase64String(cipherTextBytes); Console.ReadLine();

    Read the article

  • Trying to return data asynchronously using jQuery AND jSon in MVC 2.0

    - by Calibre2010
    Hi, I am trying to use Jquerys getJSON method to return data server side to my browser, what happens is the url the getJSON method points to does get reached but upon the postback the result does not get returned to the browser for some odd reason. I wasen't sure if it was because I was using MVC 2.0 and jQuery 1.4.1 and it differs to the MVC 1.0 version and jQuerys 1.3.2 version. . this is the code sections Controller public JsonResult StringReturn() { NameDTO myName = new NameDTO(); myName.nameID = 1; myName.name= "James"; myName.nameDescription = "Jmaes"; return Json(myName); } View with JQuery <script type="text/javascript"> $(document).ready(function () { $("#myButton").click(function () { $.getJSON("Home/StringReturn/", null, function (data) { alert(data.name); $("#show").append($("<div>" + data.name + "</div>")); }); }); }); </script> HTML <input type="button" value="clickMe" id="myButton"/> <div id="show">d</div>

    Read the article

< Previous Page | 550 551 552 553 554 555 556 557 558 559 560 561  | Next Page >