Search Results

Search found 39082 results on 1564 pages for 'magic function'.

Page 554/1564 | < Previous Page | 550 551 552 553 554 555 556 557 558 559 560 561  | Next Page >

• HREF link that targets nothing, does not want to use hash or void(0)

  - by Mattis

  I have a link that I want to be able to click to trigger a piece of jQuery code. Currently I have <a href="#" id="foo">Link</a> and $('#foo').click(function(){ // Do stuff }); which works well. But, I have always hated using hash in this way. The page flickers and the hash is added to the page url. One alternative is to use <a href="javascript:void(0);" id="foo">Link</a> but I also dislike seeing that piece of code in the browser status bar. It looks tacky. What I'd rather have is an explanatory javascript placeholder that does nothing, like <a href="javascript:zoom();" id="foo">Link</a> which actually works, but throws an ReferenceError in the javascript console since there are no such function. What's the minimum definition of a function that does nothing? Are there any other alternatives? Should I just skip the link and use something like <span id="foo" style="cursor:pointer;cursor:hand;">Link</span> instead?

  Read the article

• Dom Nodes manipulations, how remove tags which wrap my selection?

  - by sanceray3

  Hi, I try to explain you my "problem". I would like to know when I select a part of text, if this text is “wrapped” by html tags, and in function delete them. For example with this sentence : The car is <strong>green</strong>, and the boat is black If I select “green” and click on a button, I would like verify if green is wrapped by <strong>(for that it’s ok), and in function delete <strong> tags without delete containing “green”. I have tried to do it, but when I remove child and recreate one, my new node is empty and if I try to put directly text in document.createTextNode, my new node appears but the <strong> tags stay. // Bouton CLICK $('input[type=button].btn_transform').click(function(){ var selObj = window.getSelection(); var parent=selObj.anchorNode.parentNode; if (parent.nodeName=='STRONG'){ parent.removeChild(selObj.anchorNode); var theText = document.createTextNode(selObj); parent.appendChild(theText); } }); I’m not a DOM manipulation specialist. Could you help me to solve this? Thanks very much for your precious help.

  Read the article

• Iteration over a linq to sql query is very slow.

  - by devzero

  I have a view, AdvertView in my database, this view is a simple join between some tables (advert, customer, properties). Then I have a simple linq query to fetch all adverts for a customer: public IEnumerable<AdvertView> GetAdvertForCustomerID(int customerID) { var advertList = from advert in _dbContext.AdvertViews where advert.Customer_ID.Equals(customerID) select advert; return advertList; } I then wish to map this to modelItems for my MVC application: public List<AdvertModelItem> GetAdvertsByCustomer(int customerId) { List<AdvertModelItem> lstAdverts = new List<AdvertModelItem>(); List<AdvertView> adViews = _dataHandler.GetAdvertForCustomerID(customerId).ToList(); foreach(AdvertView adView in adViews) { lstAdverts.Add(_advertMapper.MapToModelClass(adView)); } return lstAdverts; } I was expecting to have some performance issues with the SQL, but the problem seems to be with the .ToList() function. I'm using ANTS performance profiler and it reports that the total runtime of the function is 1.400ms, and 850 of those is with the ToList(). So my question is, why does the tolist function take such a long time here?

  Read the article

• Loading city/state from SQL Server to Google Maps?

  - by knawlejj

  I'm trying to make a small application that takes a city & state and geocodes that address to a lat/long location. Right now I am utilizing Google Map's API, ColdFusion, and SQL Server. Basically the city and state fields are in a database table and I want to take those locations and get marker put on a Google Map showing where they are. This is my code to do the geocoding, and viewing the source of the page shows that it is correctly looping through my query and placing a location ("Omaha, NE") in the address field, but no marker, or map for that matter, is showing up on the page: function codeAddress() { <cfloop query="GetLocations"> var address = document.getElementById(<cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput>).value; if (geocoder) { geocoder.geocode( {<cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput>: address}, function(results, status) { if (status == google.maps.GeocoderStatus.OK) { var marker = new google.maps.Marker({ map: map, position: results[0].geometry.location, title: <cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput> }); } else { alert("Geocode was not successful for the following reason: " + status); } }); } </cfloop> } And here is the code to initialize the map: var geocoder; var map; function initialize() { geocoder = new google.maps.Geocoder(); var latlng = new google.maps.LatLng(42.4167,-90.4290); var myOptions = { zoom: 5, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP } var marker = new google.maps.Marker({ position: latlng, map: map, title: "Test" }); map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); } I do have a map working that uses lat/long that was hard coded into the database table, but I want to be able to just use the city/state and convert that to a lat/long. Any suggestions or direction? Storing the lat/long in the database is also possible, but I don't know how to do that within SQL.

  Read the article

• jQuery Ajax loads URL multiple times, how do I unbind/rebind properly?

  - by gmoz22

  I load a SELECT element via Ajax (list of brands), get its selected value (brand id) and load another SELECT via another Ajax URL (list of templates for currently selected brand). Here's my code: $(document).ready( function() { // DO NOT cache Ajax calls $.ajaxSetup ({ cache: false }); // loader var ajax_load = "Loading..."; // Brands List URL var loadBrandUrl = "getBrandsList.php"; // Templates List URL var loadTemplateUrl = "getTemplatesList.php"; $("#brandslistSelect").html(ajax_load).load(loadBrandUrl) .ajaxComplete(function(){ // Brands select loaded /* Load Templates SELECT the first time since no .change() has happened */ var selectedBrand = $("#brandslistSelect option:selected").attr("value"); // get the value console.log(selectedBrand); // Log selected brand to console // get Templates select, commented for now since it does an infinite loop // $("#templateslistSelect").html(ajax_load).load(loadTemplateUrl, { BrandId: selectedBrand } ); /* End initial load template */ /* On interaction with the Brands SELECT */ $("#brandslistSelect").change(function () { // on interaction with select selectedBrand = $("#brandslistSelect option:selected").attr("value"); // get the value // get Templates SELECT $("#templateslistSelect").html(ajax_load).load(loadTemplateUrl, { BrandId: selectedBrand } ) }); /* End interaction with the Brands SELECT */ }); }); It returns selectedBrand in the console 3 times : selectedBrand = undefined selectedBrand = undefined selectedBrand = 101 Now, if I uncomment the following line, same output as above but it also loads the templates URL indefinitely : // $("#templateslistSelect").html(ajax_load).load(loadTemplateUrl, { BrandId: selectedBrand } ); Any idea how I could modify this code to make it work as intended? Thanks for your help stackOverflow community!

  Read the article

• waiting for a signal

  - by Umesha MS

  Hi, I am working on an application which uploads the content of the file to server. To upload the file to server I am using ‘QNetworkAccessManager’ class. Since it works as asynchronous way, I changed it to work as synchronous way by using QEventLoop. Class FileTransfer { Public : QNetworkAccessManager mNetworkManager; Void Upload(QNetworkRequest request, QIODevice *data) { responce = mNetworkManager.put(request, data); EventLoop.exec(); ReadResponce(responce); } Void Stop() { responce ->close(); } } In my sample application I have 2 windows. 1st to select the files and 2nd to show the progress. When user click on upload button in the first window, the 2nd window will be displayed and then I create the FileTransfer object and start uploading. While uploading the file if user closes the form then in the destructor of the window I call the stop of ‘FileTransfer’ after that I delete the ‘FileTransfer’ object. But here the Upload() function is not yet completed so it will crash. Please help me to: How to wait in 'stop()' function until the Upload() function is completed

  Read the article

• jQuery indexOf select box manipulation

  - by kenny99

  Hi, I'm trying to figure out how to remove options from a select box when that option has been selected in an adjacent select box. Basically the user has the option to add multiple records here via select boxes, but I want to remove the list of options available to them so that, for example, they can't enter the same value in two select boxes. When an Add More button is clicked, I fade in the next select box container. A number of select boxes have been generated by PHP and I use JS to hide them. Each select box has a unique number appended to the ID, so i want to access those select boxes which contain the string "other_pet_types", then I want to iterate through the currently visible ones and build an array of the values which have been selected, which I will then remove from the list of options in the newly displayed select box. This is what I have so far, but it's definitely not right - I can't get the initial test on the ID to work. Any pointers greatly appreciated as i realise i'm pretty wide of the mark at the moment! var vals = new Array(); //build array with currently selected options $('p.mult_entries select').each(function(){ vals += $(this).val(); }); $("p.mult_entries:hidden:first").fadeIn("slow", function() { $(this).find(('select').attr('id').indexOf('other_pet_types') > 0).each(function(){ console.log($(this).val()); //as expected prints nothing - need to iterate through the options of the above select //once i extract the correct values, iterate through new select box and use inArray to remove options where that value already exists in one of previous select boxes }); });

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Noobie Jquery Question

  - by piratebill

  I've been working with Jquery fro a grand total of two hours now. Up until this point I have made this really simple FAQ page. <script type="text/javascript" src="jquery.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#void").click(function(event) { event.preventDefault(); }); $('#faq').find('dd').hide().end().find('dt').click(function() { $(this).next().slideToggle(); }); }); </script> <dl id="faq"> <dt><a href="" id="void">Coffee</a></dt> <dd>- black hot drink</dd> <dt><a href="" id="void">Milk</a></dt> <dd>- white cold drink</dd> </dl> The problem is only the first item is working. My questions are, why is only the first entree working and how do I fix it? I've tried using an each() but I am unsure where to put it.

  Read the article

• Error 2025: The supplied DisplayObject must be a child of the caller

  - by Mocca

  Hi, sorry, new to actionscript 3. I have a display() function for an object rotator(image based like a QT object movie). It first saves the current image in a helper variable and then allocates a new image, from the library, beneath the old one. To get a nice crossfade effect, the old image's alpha is looped down via enter_frame and then removed. Which is where there seems to be an issue with the display list, maybe recognizing oldImg's value as being already added? (it's not a first pass error) Btw, do i have to remove the old image or can i leave it, for when it's being called up via the mouse position again? (the image number can get fairly large) Does anyone have further insight? Thanks! function display(num:Number):void //num: image number { ... oldImg = newImg; ClassReference = getDefinitionByName("Class"+num) as Class; imgBD = new ClassReference(0,0); newImg = new Bitmap(imgBD); images.addChild(newImg); newImg.x=0; newImg.y=0; } function onEnter(evt:Event):void { if (oldImg) { if (oldImg.alpha > 0) oldImg.alpha -= 0.15; **else images.removeChild(oldImg);** } ... }

  Read the article

• Visual Studio 2008 linker wants all symbols to be resolved, not only used ones

  - by user343011

  We recently upgraded to Visual Studio 2008 from 2005, and I think those error started after that. In our solution, we have a multitude of projects. Many of those are utility projects, or projects containing core functionality used by other projects. The output of those is lib files that are linked to when building the projects generating the final binaries using the "Project dependencies..." option. One of the other projects---Let us call it ResultLib---generates a DLL, and it needs one single function from the core project. This function uses only static function from its own source file, but the project in its entirety uses a lot of low-level Windows functions and also imports a DLL---Let us call it Driver.dll. Our problem is that when building ExtLib, the linker complains about a multitude of unresolved externals, for example all functions exported from Driver.dll, since its lib file is not specified when linking. If we try to fix this by adding all lib files used by other projects that use all of the core project, our resulting ResultLib DLL ends up importing Driver.dll and also exporting all functions defined in it. How do we tell Visual Studio to only try to resolve symbols that are actually used?

  Read the article

• Flex customized Horizental List

  - by muzammal

  i have customized Horizontal List (items are image and some text) of a reel with some no of clips . i have customized highlight , un highlight and select style , which will be implemented dynamically and mouse over and out. now pproblem is to make un highlight previously playing clip. enter code here styleName="unhighlightedClip" updateComplete="currentlyPlaying();" rollOver="highlighted();" rollOut="unhighlighted();" .currentlyPlayingClip{ borderColor: #95123E; borderStyle: solid; borderThickness: 2; } .unhighlightedClip{ borderStyle: none; } .highlightedClip{ borderColor: #70BAE7; borderStyle: solid; borderThickness: 2; } </mx:Style> <mx:Script> <![CDATA[ import mx.controls.Alert; import mx.controls.HorizontalList; private var prevIndex:int = -1; protected function unhighlighted():void{ var selected:Boolean = HorizontalList(this.owner).isItemSelected(this.data); clipDesription.useHandCursor = false; clipStartTime.useHandCursor = false; this.useHandCursor = false; if(!selected) this.setStyle('styleName', 'unhighlightedClip'); } protected function highlighted():void{ clipDesription.useHandCursor = true; clipStartTime.useHandCursor = true; this.useHandCursor = true; var selected:Boolean = HorizontalList(this.owner).isItemSelected(this.data); if(!selected) this.setStyle('styleName', 'highlightedClip'); } protected function currentlyPlaying():void{ var selected:Boolean = HorizontalList(this.owner).isItemSelected(this.data); var currentIndex:int = HorizontalList(this.owner).selectedIndex; if(selected) this.setStyle('styleName', 'currentlyPlayingClip'); // else if(prevIndex != currentIndex ) // this.setStyle('styleName', 'unhighlightedClip'); // // prevIndex = currentIndex; } ]]

  Read the article

• C++ read registry string value in char*

  - by Sunny

  I'm reading a registry value like this: char mydata[2048]; DWORD dataLength = sizeof(mydata); DWORD dwType = REG_SZ; ..... open key, etc ReqQueryValueEx(hKey, keyName, 0, &dwType, (BYTE*)mydata, &dataLength); My problem is, that after this, mydata content looks like: [63, 00, 3A, 00, 5C, 00...], i.e. this looks like a unicode?!?!. I need to convert this somehow to be a normal char array, without these [00], as they fail a simple logging function I have. I.e. if I call like this: WriteMessage(mydata), it outputs only "c", which is the first char in the registry. I have calls to this logging function all over the place, so I'd better of not modify it, but somehow "fix" the registry value. Here is the log function: void Logger::WriteMessage(const char *msg) { time_t now = time(0); struct tm* tm = localtime(&now); std::ofstream logFile; logFile.open(filename, std::ios::out | std::ios::app); if ( logFile.is_open() ) { logFile << tm->tm_mon << '/' << tm->tm_mday << '/' << tm->tm_year << ' '; logFile << tm->tm_hour << ':' << tm->tm_min << ':' << tm->tm_sec << "> "; logFile << msg << "\n"; logFile.close(); } }

  Read the article

• Adding date to multiple fields via datepicker

  - by Andy

  i have a form in drupal with jquery based date module. there are multiple fields with date picker enabled. i want to set the value of all of them (they all have class .date-popup-init) to the value of the first field (#edit-field, the 'from' date) when that field is set. my code so far: <script type="text/javascript"> var DatePicked = function() { var firstdate = $("#edit-field"); var updater = firstdate.datepicker("getDate"); $(".date-popup-init").each(function(){ $(this).datepicker("setDate", updater); }); } $(function() { $("#edit-field").datepicker({ onSelect: DatePicked }); }); </script> this seems to randomly work; it sets the date of some fields to the value of #edit-field, seemingly different fields each time. also, the form adds more datepicker-enabled fields via ajax. is there any way to ensure that all these new fields, when they load, pick up the value of #edit-field as well? disclaimer: last night was my first attempt at javascript of any kind. i have a basic idea now. the above was cobbled through countless google examples.

  Read the article

• <input type="file"> reads only file name not full path

  - by Deep

  I am using Glassfish Server.I have seen the apache file upload to solve it...but i want to implement it in glassfish server. image.html <form action="" method="post" enctype="multipart/form-data"> Select a file: <input type="file" name="first" id="first"/> <br /> <input type="button" name="button" value="upload" id="button" /> <p id="test"></p> <img src='Unknown.png' id="profile_img" height="200px" width="150px"/> </form> test.js $(document).ready(function() { var filepath= $("#first"); $('#button').click(function() { $.ajax({ type: "post", url: "imageservlet", data: "user="+filepath.val(), success: function(msg) { $("#profile_img").attr('src',msg); $("#test").html(msg) .fadeIn("fast"); } }); }); }); imageservlet.java String user=request.getParameter("user"); out.print(user); the output is file name not full path.

  Read the article

• JSON to javaScript array

  - by saturn_research

  I'm having a problem handling JSON data within JavaScript, specifically in regards to using the data as an array and accessing and iterating through individual values. The JSON file is structured as follows: { "head": { "vars": [ "place" , "lat" , "long" , "page" ] } , "results": { "bindings": [ { "place": { "type": "literal" , "value": "Building A" } , "lat": { "datatype": "http://www.w3.org/2001/XMLSchema#float" , "type": "typed-literal" , "value": "10.3456" } , "long": { "datatype": "http://www.w3.org/2001/XMLSchema#float" , "type": "typed-literal" , "value": "-1.2345" } , "page": { "type": "uri" , "value": "http://www.example.com/a.html" } } , { "place": { "type": "literal" , "value": "Building B" } , "lat": { "datatype": "http://www.w3.org/2001/XMLSchema#float" , "type": "typed-literal" , "value": "11.3456" } , "long": { "datatype": "http://www.w3.org/2001/XMLSchema#float" , "type": "typed-literal" , "value": "-2.2345" } , "page": { "type": "uri" , "value": "http://www.example.com/b.html" } } , { "place": { "type": "literal" , "value": "Building C" } , "lat": { "datatype": "http://www.w3.org/2001/XMLSchema#float" , "type": "typed-literal" , "value": "12.3456" } , "long": { "datatype": "http://www.w3.org/2001/XMLSchema#float" , "type": "typed-literal" , "value": "-3.2345" } , "page": { "type": "uri" , "value": "http://www.example.com/c.html" } } ] } } I want to be able to convert this into a JavaScript array as follows in order that I can iterate through it and pull out the values for each location in order: var locations = [ ['Building A',10.3456,-1.2345,'http://www.example.com/a.html'], ['Building B',11.3456,-2.2345,'http://www.example.com/b.html'], ['Building C',12.3456,-3.2345,'http://www.example.com/c.html'] ]; Does anyone have any advice on how to achieve this? I have tried the following, but it picks up the "type" within the JSON, rather than just the value: $.each(JSONObject.results.bindings, function(i, object) { $.each(object, function(property, object) { $.each(object, function(property, value) { value; }); }); }); Any help, suggestions, advice or corrections would be greatly appreciated.

  Read the article

• Fitting Text into an Image

  - by Abs

  Hello all, I have a function which takes in a font (ttf or otf file) and generates an image of text in different fonts. The problem I have is trying to work out how I can make the text fit in the image regardless of the font-size, type of font, and amount of text. I have tried to make the image rectangle variable so that it contains the text of different fonts without cutting a bit of the text since the image is not long or wide enough. Here is the function that I currently have, I have tried using the number of characters to determine the width of the image, but in some cases for some fonts and sizes, it still gets cut off. function generate_image($save_path, $text, $font_path){ $length = strlen($text) * 15; // Create the image $im = imagecreatetruecolor($length, 40); $white = imagecolorallocate($im, 255, 255, 255); $grey = imagecolorallocate($im, 128, 128, 128); $black = imagecolorallocate($im, 0, 0, 0); imagefilledrectangle($im, 0, 0, $length, 40, $white); $font = $font_path; imagettftext($im, 30, 0, 0, 25, $black, $font, $text); if(imagepng($im, $save_path)){ $status = true; }else{ $status = false; } imagedestroy($im); return $status; } Thank you all for any help

  Read the article

• JSON Array Created in PHP/MySQL incorrectly decoded using JQuery

  - by Zak

  I am attempting to make an AJAX call to a very small PHP script that should return me an array that could be echo'd and decoded using JQuery. Here is what I have: My PHP page called to by AJAX: $web_q=mysql_query("select * from sec_u_g where uid='$id' "); $rs = array(); while($rs[] = mysql_fetch_assoc($web_q)) { } print_r(json_encode($rs)); This outputs: [{"id":"3","uid":"39","gid":"16"},{"id":"4","uid":"39","gid":"4"},{"id":"5","uid":"39","gid":"5"},{"id":"6","uid":"39","gid":"6"},{"id":"7","uid":"39","gid":"7"},{"id":"8","uid":"39","gid":"8"},{"id":"9","uid":"39","gid":"9"},false] I don't understand the "false" at the end for one .. But then I send to to JQuery and use: $.each(json.result, function(i, object) { $.each(object, function(property, value) { alert(property + "=" + value); }); }); This just fails. I try to alert "result" by itself which is set by: $.post("get_ug.php",{id:txt},function(result){ }); My output alerts are as follows: 1) The key is '0' and the value is '[' 2) The key is '1' and the value is 'f' 3) The key is '2' and the value is 'a' 4) The key is '3' and the value is 'l' 5) The key is '4' and the value is 's' 6) The key is '5' and the value is 'e' 7) The key is '6' and the value is ']' 8) The key is '7' and the value is ' ' (<-- Yes the line break is there in the alert) I am exhausted from trying different ideas and scripts. Other than setting a delimiter myself and concatenating my own array and decoding it with a custom script, does anyone have any ideas?? Thank you!!

  Read the article

• Drupal - Search box not working - custom theme template

  - by vr3690

  Hello, I am using a customised version of search-theme-from.tpl When I use the search box, I do get transferred to the search page. But the search does not actually take place. The search box on the search results page does work though. This is my search-them-form.tpl.php file (demo : <input type="text" name="search_theme_form_keys" id="edit-search-theme-form-keys" value="Search" title="Enter the terms you wish to search for" class="logininput" height="24px" onblur="restoreSearch(this)" onfocus="clearInput(this)" /> <input type="submit" name="op" id="edit-submit" value="" class="form-submit" style="display: none;" /> <input type="hidden" name="form_token" id="edit-search-theme-form-form-token" value="<?php print drupal_get_token('search_theme_form'); ?>" /> <input type="hidden" name="form_id" id="edit-search-theme-form" value="search_theme_form" /> There is also a javascript file involved. I guess it's use is pretty clear from the code: function trim(str) { return str.replace(/^\s+|\s+$/g, ''); } function clearInput(e) { e.value=""; // clear default text when clicked e.className="longininput_onfocus"; //change class } function restoreSearch(e) { if (trim(e.value) == '') { { e.value="Search"; // reset default text onBlur e.className="logininput"; //reset class } } } What can be the problem and how can I fix it?

  Read the article

• JavaScript onClick() Display

  - by junaidkaps

  I have an array consisting of several objects containing Strings. I am successfully able to display the array by using: <td><p onclick="theMiddle(this)">The Middle</td> As you see from the td tag this is part of a table. Issue is that the browser opens up a new page to display my text. I have been trying to display the array above my table in a p tag. //JavaScript var arrayTheMiddle = new Array (showName.theMiddle, beginingTime.theMiddle, network.abc, duration.thirty, rating.general, description.theMiddle, showImage.theMiddle); function theMiddle(obj){ for(i=0; i < arrayTheMiddle.length; i++) { document.write(arrayTheMiddle[i] + "<br>"); } } //HTML File <p>Would like the array/function displayed here while the user clicks within the table below (entire table has not been listed)</p> <td><p onclick="theMiddle(this)">The Middle</td> Unfortunately I am constantly failing at utilizing get element by id to call my function which consists of an array. I have searched for all sorts of stuff, yet frankly I'm lost. Not even sure if my approach is correct at this point. I'm sure this is one of those simple things that are blowing over my head!

  Read the article

• Two Objects created with the same Address in Flex

  - by James

  Hi, I have an issue in flex which is causing a bit of a headache! I am adding objects to an ArrayCollection but in doing so, another ArrayCollection is also picking up these changes even though there is no binding occurring. I can see from the debug that the two ACs have the same address but for the life of me can't figure out why. I have two Array Collections: model.index.rows //The main array collection model.index.holdRows //The array collection that imitates the above This phantom data binding occurs only for the first iteration in the loop and for all others it will just write it the once. The reason this is proving troublesome is that it creates duplicate entries in my datagrid. public override function handleMessage(message:IMessage):void { super.handleMessage(message); if (message is IndexResponse) { var response:IndexResponse = message as IndexResponse; model.index.rows.removeAll(); model.index.indexIsEmpty = response.nullIndex; if (model.index.indexIsEmpty !== true) { //Update the index model from the response. Note: each property of the row object will be shown in the UI as a column in the grid response.index.forEach(function(entry:EntryData, i:int, a:Array):void { var row:Object = { fileID: entry.fileID, dadName: entry.dadName }; entry.tags.forEach(function(tag:Tag, i:int, a:Array):void { row[tag.name] = tag.value; }); model.index.rows.addItem(row); }); if(model.index.indexForNetworkView == true){ model.index.holdRows.source = model.index.holdRows.source.concat(model.index.rows.source); model.index.indexCounter++; model.index.indexForNetworkView = false; controller.indexController.showNetwork(model.index.indexCounter); } model.index.rows.refresh(); controller.networkController.show(); } } Has anyone else who has encountered something simillar propose a solution?

  Read the article

• change value after ajax request!

  - by Lina

  if i have 3 html pages as follows: home.html: <form method="get"> <input class="someForm" type="radio" value="1" name="someForm" /> Name <input class="someForm" type="radio" value="2" name="someForm" /> Email <div id="container"></div> <input type="submit" /> </form> <script type="text/javascript" src="jquery.js"></script> <script> var ajaxResponse = new Object(); $(document).ready(function () { $('.someForm').click(function () { var rbVal = $(this).val(); var myContent; if (ajaxResponse[rbVal]) { //in cache myContent = ajaxResponse[rbVal]; $("#container").html(myContent); } else { // not in cache var urlForAjaxCall = "file" + rbVal + ".html"; $.get(urlForAjaxCall, function (myContent) { ajaxResponse[rbVal] = myContent; $("#container").html(myContent); }); } }); }); </script> file1.html: Name: <input type="text" name="1" value="myName" /> file2.html: Email: <input type="text" name="2" value="[email protected]" /> what i want to do is that when i write something in one of the textboxes and then click whichever radio button in home.html, the value attribute should be changed to the new value, any idea on how to do that? tia

  Read the article

• Filtering a select list via input box & jquery

  - by zSysop

  Hi all, I was wondering if i could get some help with filtering a select list using an input box via jquery. Here's what my js looks like, but it doesnt seem to work. I'm guessing this is because options within a select list are not hide-able. <script type="text/javascript"> $(document).ready(function() { $("#inputFilter").change(function() { var filter = $(this).val(); $("#selectList option").each(function() { var match = $(this).text().search(new RegExp(filter, "i")); if (match > 0) { $(this).show(); // Does not work } else $(this).hide(); }); }); }); </script> and here's my html <input id="inputFilter" /> <select id="selectList"> <option value="1111" text="1111 - London" /> <option value="1112" text="1111 - Paris" /> </select>

  Read the article

• optimize output value using a class and public member

  - by wiso

  Suppose you have a function, and you call it a lot of times, every time the function return a big object. I've optimized the problem using a functor that return void, and store the returning value in a public member: #include <vector> const int N = 100; std::vector<double> fun(const std::vector<double> & v, const int n) { std::vector<double> output = v; output[n] *= output[n]; return output; } class F { public: F() : output(N) {}; std::vector<double> output; void operator()(const std::vector<double> & v, const int n) { output = v; output[n] *= n; } }; int main() { std::vector<double> start(N,10.); std::vector<double> end(N); double a; // first solution for (unsigned long int i = 0; i != 10000000; ++i) a = fun(start, 2)[3]; // second solution F f; for (unsigned long int i = 0; i != 10000000; ++i) { f(start, 2); a = f.output[3]; } } Yes, I can use inline or optimize in an other way this problem, but here I want to stress on this problem: with the functor I declare and construct the output variable output only one time, using the function I do that every time it is called. The second solution is two time faster than the first with g++ -O1 or g++ -O2. What do you think about it, is it an ugly optimization?

  Read the article

• Packages name conflicting with getters and setters?

  - by MrKishi

  Hello, folks. So, I've came across this compilation error a while ago.. As there's an easy fix and I didn't find anything relevant at the time, I eventually let it go. I just remembered it and I'm now wondering if this is really part of the language grammar (which I highly doubt) or if it's a compiler bug. I'm being purely curious about this -- it doesn't really affect development, but it would be nice to see if any of you have seen this already. package view { import flash.display.Sprite; public class Main extends Sprite { private var _view:Sprite = new Sprite(); public function Main() { this.test(); } private function test():void { trace(this.view.x, this.view.y); //1178: Attempted access of inaccessible property x through a reference with static type view:Main. //1178: Attempted access of inaccessible property y through a reference with static type view:Main. //Note that I got this due to the package name. //It runs just fine if I rename the package or getter. } public function get view():Sprite { return this._view; } } }

  Read the article

< Previous Page | 550 551 552 553 554 555 556 557 558 559 560 561  | Next Page >