Search Results

Search found 39082 results on 1564 pages for 'magic function'.

Page 554/1564 | < Previous Page | 550 551 552 553 554 555 556 557 558 559 560 561  | Next Page >

  • <input type="file"> reads only file name not full path

    - by Deep
    I am using Glassfish Server.I have seen the apache file upload to solve it...but i want to implement it in glassfish server. image.html <form action="" method="post" enctype="multipart/form-data"> Select a file: <input type="file" name="first" id="first"/> <br /> <input type="button" name="button" value="upload" id="button" /> <p id="test"></p> <img src='Unknown.png' id="profile_img" height="200px" width="150px"/> </form> test.js $(document).ready(function() { var filepath= $("#first"); $('#button').click(function() { $.ajax({ type: "post", url: "imageservlet", data: "user="+filepath.val(), success: function(msg) { $("#profile_img").attr('src',msg); $("#test").html(msg) .fadeIn("fast"); } }); }); }); imageservlet.java String user=request.getParameter("user"); out.print(user); the output is file name not full path.

    Read the article

  • Loading city/state from SQL Server to Google Maps?

    - by knawlejj
    I'm trying to make a small application that takes a city & state and geocodes that address to a lat/long location. Right now I am utilizing Google Map's API, ColdFusion, and SQL Server. Basically the city and state fields are in a database table and I want to take those locations and get marker put on a Google Map showing where they are. This is my code to do the geocoding, and viewing the source of the page shows that it is correctly looping through my query and placing a location ("Omaha, NE") in the address field, but no marker, or map for that matter, is showing up on the page: function codeAddress() { <cfloop query="GetLocations"> var address = document.getElementById(<cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput>).value; if (geocoder) { geocoder.geocode( {<cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput>: address}, function(results, status) { if (status == google.maps.GeocoderStatus.OK) { var marker = new google.maps.Marker({ map: map, position: results[0].geometry.location, title: <cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput> }); } else { alert("Geocode was not successful for the following reason: " + status); } }); } </cfloop> } And here is the code to initialize the map: var geocoder; var map; function initialize() { geocoder = new google.maps.Geocoder(); var latlng = new google.maps.LatLng(42.4167,-90.4290); var myOptions = { zoom: 5, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP } var marker = new google.maps.Marker({ position: latlng, map: map, title: "Test" }); map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); } I do have a map working that uses lat/long that was hard coded into the database table, but I want to be able to just use the city/state and convert that to a lat/long. Any suggestions or direction? Storing the lat/long in the database is also possible, but I don't know how to do that within SQL.

    Read the article

  • HREF link that targets nothing, does not want to use hash or void(0)

    - by Mattis
    I have a link that I want to be able to click to trigger a piece of jQuery code. Currently I have <a href="#" id="foo">Link</a> and $('#foo').click(function(){ // Do stuff }); which works well. But, I have always hated using hash in this way. The page flickers and the hash is added to the page url. One alternative is to use <a href="javascript:void(0);" id="foo">Link</a> but I also dislike seeing that piece of code in the browser status bar. It looks tacky. What I'd rather have is an explanatory javascript placeholder that does nothing, like <a href="javascript:zoom();" id="foo">Link</a> which actually works, but throws an ReferenceError in the javascript console since there are no such function. What's the minimum definition of a function that does nothing? Are there any other alternatives? Should I just skip the link and use something like <span id="foo" style="cursor:pointer;cursor:hand;">Link</span> instead?

    Read the article

  • jQuery Ajax loads URL multiple times, how do I unbind/rebind properly?

    - by gmoz22
    I load a SELECT element via Ajax (list of brands), get its selected value (brand id) and load another SELECT via another Ajax URL (list of templates for currently selected brand). Here's my code: $(document).ready( function() { // DO NOT cache Ajax calls $.ajaxSetup ({ cache: false }); // loader var ajax_load = "Loading..."; // Brands List URL var loadBrandUrl = "getBrandsList.php"; // Templates List URL var loadTemplateUrl = "getTemplatesList.php"; $("#brandslistSelect").html(ajax_load).load(loadBrandUrl) .ajaxComplete(function(){ // Brands select loaded /* Load Templates SELECT the first time since no .change() has happened */ var selectedBrand = $("#brandslistSelect option:selected").attr("value"); // get the value console.log(selectedBrand); // Log selected brand to console // get Templates select, commented for now since it does an infinite loop // $("#templateslistSelect").html(ajax_load).load(loadTemplateUrl, { BrandId: selectedBrand } ); /* End initial load template */ /* On interaction with the Brands SELECT */ $("#brandslistSelect").change(function () { // on interaction with select selectedBrand = $("#brandslistSelect option:selected").attr("value"); // get the value // get Templates SELECT $("#templateslistSelect").html(ajax_load).load(loadTemplateUrl, { BrandId: selectedBrand } ) }); /* End interaction with the Brands SELECT */ }); }); It returns selectedBrand in the console 3 times : selectedBrand = undefined selectedBrand = undefined selectedBrand = 101 Now, if I uncomment the following line, same output as above but it also loads the templates URL indefinitely : // $("#templateslistSelect").html(ajax_load).load(loadTemplateUrl, { BrandId: selectedBrand } ); Any idea how I could modify this code to make it work as intended? Thanks for your help stackOverflow community!

    Read the article

  • Jquery tabs with cookie support restore wrong tab position after page refresh.

    - by zenonych
    Hello, all. I have tricky problem which I can't completely understand... It's jquery tabs with cookie support. I've following code: $(document).ready(function() { var $tabs = $("#tabs").tabs(); $tabs.tabs('select', $.cookie("tabNumber")); $('#tabs ul li a').click(function() { $.cookie("tabNumber", $tabs.tabs('option', 'selected')); }); $('#btnSelect').click(function() { //alert($.cookie("tabNumber")); //$tabs.tabs('select', 2); $tabs.tabs('select', $.cookie("tabNumber")); }); }); So, I've 3 tabs (with positions 0,1,2) inside div named "tabs". When user selects one tab, then tab position stores in cookie. After that if user refresh page, active tab position must be restored. But each time I refresh page I get active tab in previous position (if I select 2nd tab, then after refresh I got active tab in position 1, etc.). I add some test in code (button btnSelect with onclick handler which duplicates load position functionality). So, if I uncomment and use $tabs.tabs('select', 2); Then after I click btnSelect I've got right position. Ok, that's right. Then I comment that line and uncomment next one: alert($.cookie("tabNumber")); So, I select tab, click button, get dialog message "2", and after that tab in position 1 became active. Why?? In both cases I call 'select' method with parameter 2... I know I can use aliases for tabs, but I want to understate why my code doesn't work properly.

    Read the article

  • Best suited tool to document message processing done in C written program

    - by user3494614
    I am relatively new to UML and it's seems to be very vast I have a small program which basically receives messages on socket and then depending upon message ID embedded as first byte of message it processes the buffer. There are around 5 different message ID which it processes and communicates on another socket and has around 8 major functions. So program in short is like this. I am not pasting entire .c file or main function but just giving some bits and pieces of it so that to get idea of program flow. int main(int argc, char** argv) { register_shared_mem(); listen(); while(get_next_message(buffer)) { switch((msg)(buffer)->id) { case TYPE1: process1(); answer(); ..... } } } I want to document this is pictorial way like for Message type 1 it calls this function which calls another and which calls another. Please let me know any open source tool which will allow me to quickly draw such kind of UML or sequence diagram and will also allow me to write brief description of what each function does? Thanks In Advance

    Read the article

  • datepicker not working in chrome

    - by DotnetSparrow
    I have a Jquery UI datepicker control in my asp.net MVC application and it works fine in IE and Firefox but it doens't work in chrome when I click the datepicker button. Here is my Index view: $(function() { $('#datepicker').datepicker({ changeMonth: true, dateFormat: "dd M yy", changeYear: true, showButtonPanel: true, autoSize: true, altField: "input#txtDate", onSelect: function(dateText, inst) { $.ajax({ type: "POST", url: "/LiveGame/Partial3?gameDate=" + dateText, dataType: "html", success: function(result) { var domElement = $(result); $("#dvGames").html(domElement); } }); } }); $("#txtDate").val($.format.date(new Date(), 'dd MMM yyyy')); $('#dvGames').load( '<%= Url.Action("Partial3", "LiveGame") %>', { gameDate: $("#txtDate").val() } ); }); Here is my partial: public ActionResult Partial3(string gameDate) { return PartialView("Partial3", gameDate); } <div id="dvGames" class="cornerdate1"> <%= Url.Action("LiveGame","Partial3") %> </div> <input type="text" id="txtDate" name="txtDate" readonly="readonly" class="cornerdate" /> <input id="datepicker" class="cornerimage" type="image" src="../../Content/images/calendar.gif" alt="date" /> </div>

    Read the article

  • Segmentation fault on certain inputs and not others

    - by Brandon Schwandt
    Heres a function I wrote that has some debugging elements in it already. When i enter either a "y" or a "Y" as the input I get a segmentation fault during runtime. When I enter any other value the code runs. The seg fault kicks out after it scans and gives me the response but before the "scan worked" line is output. DOn't know why it would act like this only on these values. If anyone needs the function call I have that as well. query_user(char *response [10]) { printf("response after query call before clear=%s\n",response); strcpy(response,""); printf("response after clearing before scan=%s\n",response); printf("Enter another person into the line? y or n\n"); scanf("%s", response); printf("response after scan=%s\n",response); printf("scan worked"); } main() { char response [10]; strcpy(response,"y"); printf("response=%s\n",response); printf("When finished with program type \"done\" to exit\n"); while (strcmp(response,"done") != 0) { printf("response after while loop and before query call=%s\n",response); query_user(&response); } } output on error: response after query call before clear=y response after clearing before scan= Enter another person into the line? y or n y response after scan=y Segmentation Fault (core dumped) output on non-error: response after query call before clear=y response after clearing before scan= Enter another person into the line? y or n n response after scan=n scan worked Cycle number 0 (program continues to run outside this function)

    Read the article

  • Access is denied. Javascript error on request to secured page

    - by ihorko
    On SomePage.aspx page by javascript (XMLHttpRequest) I call SecuredPage.aspx used next code: var httpRequest = GetXmlHttp(); var url = "https://myhost.com/SecuredPage.aspx"; var params = "param1=" + document.getElementById('param1').value + "&param2=" + document.getElementById('param2').value; httpRequest.open("POST", url, true); httpRequest.setRequestHeader("Content-Type", "application/x-www-form-urlencoded"); httpRequest.onreadystatechange = function() { //Call a function when the state changes. if (httpRequest.readyState == 4 && httpRequest.status == 200) { alert(httpRequest.responseText); } } httpRequest.send(params); // HERE ACCESS IS DENIED //--------------------------------------------- function GetXmlHttp() { var xmlhttp = false; if (window.XMLHttpRequest) { xmlhttp = new XMLHttpRequest(); } else if (window.ActiveXObject) // code for IE { try { xmlhttp = new ActiveXObject("Msxml2.XMLHTTP"); } catch (e) { try { xmlhttp = new ActiveXObject("Microsoft.XMLHTTP"); } catch (E) { xmlhttp = false; } } } return xmlhttp; } It throws Access is denied error. if send to http (http://myhost.com/SecuredPage.aspx), it works fine. How is it possible to resolve that problem. Thanks!

    Read the article

  • Getting Response From Jquery JSON

    - by Howdy_McGee
    I'm having trouble getting a response from my php jquery / json / ajax. I keep combining all these different tutorials together but I still can't seem to pull it all together since no one tutorial follow what I'm trying to do. Right now I'm trying to pass two arrays (since there's no easy way to pass associative arrays) to my jquery ajax function and just alert it out. Here's my code: PHP $names = array('john doe', 'jane doe'); $ids = array('123', '223'); $data['names'] = $names; $data['ids'] = $ids; echo json_encode($data); Jquery function getList(){ $.ajax({ type: "GET", url: 'test.php', data: "", complete: function(data){ var test = jQuery.parseJSON(data); alert(test.names[0]); alert("here"); } }, "json"); } getList(); In my html file all I'm really calling is my javascript file for debugging purposes. I know i'm returning an object but I'm getting an error with null values in my names section, and i'm not sure why. What am I missing? My PHP file returns {"names":["john doe","jane doe"],"ids":["123","223"]} It seems to be just ending here Uncaught TypeError: Cannot read property '0' of undefined so my sub0 is killing me.

    Read the article

  • JS: Object itteration fails

    - by Newbie
    Hello! In my JS, I have an object called box_object. It looks like this: ({ id:"3", text:"this is a box object", connection_parent:["1", "2"], connection_child:["5", "6"], connectiondata_child:{ 0:{id:"5", linepoint:"bottom"}, 1:{id:"6", linepoint:"bottom"}}, connectiondata_parent:{ 0:{id:"1", linepoint:"top"}, 1:{id:"2", linepoint:"top"}} }) Now, I want to add some position values to box_object.connectiondata_parent. Using jQuery I can use the .each() method. So I tried it, but it failed. In my function I do the following: $(box_object.connectiondata_parent).each(function(it, obj){ if(typeof(obj[it]) != "undefined" && obj[it].linepoint == "top"){ var point_position_top = new Object(); point_position_top.left = startingpoint_left; point_position_top.top = startingpoint_top; obj[it].position = point_position_top; }else if(typeof(obj[it]) != "undefined" && obj[it].linepoint == "bottom"){ var point_position_bottom = new Object(); point_position_bottom.left = startingpoint_left; point_position_bottom.top = startingpoint_bottom; obj[it].position = point_position_bottom; }else{} }); After the function my box_object looks like this: ({ id:"3", text:"this is third box", connection_parent:["1", "2"], connection_child:["5", "6"], connectiondata_child:{ 0:{id:"5", linepoint:"bottom"}, 1:{id:"6", linepoint:"bottom"}}, connectiondata_parent:{ 0:{id:"1", linepoint:"top", position:{left:500, top:104}}, 1:{id:"2", linepoint:"top"}} }) It seems it only writes the values to the first "value". Any Ideas why?

    Read the article

  • Noobie Jquery Question

    - by piratebill
    I've been working with Jquery fro a grand total of two hours now. Up until this point I have made this really simple FAQ page. <script type="text/javascript" src="jquery.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#void").click(function(event) { event.preventDefault(); }); $('#faq').find('dd').hide().end().find('dt').click(function() { $(this).next().slideToggle(); }); }); </script> <dl id="faq"> <dt><a href="" id="void">Coffee</a></dt> <dd>- black hot drink</dd> <dt><a href="" id="void">Milk</a></dt> <dd>- white cold drink</dd> </dl> The problem is only the first item is working. My questions are, why is only the first entree working and how do I fix it? I've tried using an each() but I am unsure where to put it.

    Read the article

  • waiting for a signal

    - by Umesha MS
    Hi, I am working on an application which uploads the content of the file to server. To upload the file to server I am using ‘QNetworkAccessManager’ class. Since it works as asynchronous way, I changed it to work as synchronous way by using QEventLoop. Class FileTransfer { Public : QNetworkAccessManager mNetworkManager; Void Upload(QNetworkRequest request, QIODevice *data) { responce = mNetworkManager.put(request, data); EventLoop.exec(); ReadResponce(responce); } Void Stop() { responce ->close(); } } In my sample application I have 2 windows. 1st to select the files and 2nd to show the progress. When user click on upload button in the first window, the 2nd window will be displayed and then I create the FileTransfer object and start uploading. While uploading the file if user closes the form then in the destructor of the window I call the stop of ‘FileTransfer’ after that I delete the ‘FileTransfer’ object. But here the Upload() function is not yet completed so it will crash. Please help me to: How to wait in 'stop()' function until the Upload() function is completed

    Read the article

  • Javascript/Jquery pop-up window in Asp.Net MVC4

    - by Mark
    Below I have a "button" (just a span with an icon) that creates a pop-up view of a div in my application to allow users to compare information in seperate windows. However, I get and Asp.Net Error as follows: **Server Error in '/' Application. The resource cannot be found. Requested URL: /Home/[object Object]** Does anyone have an Idea of why this is happending? Below is my code: <div class="module_actions"> <div class="actions"> <span class="icon-expand2 pop-out"></span> </div> </div> <script> $(document).ajaxSuccess(function () { var Clone = $(".pop-out").click(function () { $(this).parents(".module").clone().appendTo("#NewWindow"); }); $(".pop-out").click(function popitup(url) { LeftPosition = (screen.width) ? (screen.width - 400) / 1 : 0; TopPosition = (screen.height) ? (screen.height - 700) / 1 : 0; var sheight = (screen.height) * 0.5; var swidth = (screen.width) * 0.5; settings = 'height=' + sheight + ',width=' + swidth + ',top=' + TopPosition + ',left=' + LeftPosition + ',scrollbars=yes,resizable=yes,toolbar=no,status=no,menu=no, directories=no,titlebar=no,location=no,addressbar=no' newwindow = window.open(url, '/Index', settings); if (window.focus) { newwindow.focus() } return false; }); });

    Read the article

  • Convert enumeration to string

    - by emptyheaded
    I am trying to build a function that converts an item from an enum to its corresponding string. The enums I use are fairly long, so I didn't want to use a switch-case. I found a method using boost::unordered_map very convenient, but I don't know how to make a default return (when there is no item matching the enum). const boost::unordered_map<enum_type, const std::string> enumToString = boost::assign::map_list_of (data_1, "data_1") (data_2, "data_2"); I tried to create an additional function: std::string convert(enum_type entry) { if (enumToString.find(entry)) // not sure what test to place here, return enumToString.at(entry); //because the find method returns an iter else return "invalid_value"; } I even tried something exceedingly wrong: std::string convert(enum_type entry) { try{ return enumToString.at(entry); } catch(...){ return "invalid_value"; } } Result: evil "Debug" runtime error. Can somebody give me a suggestion on how to either 1) find an easier method to convert enum to a string with the same name as the enum item 2) find a way to use already built boost methods to get a default value from a hash map (best option) 3) find what to place in the test to use a function that returns either the pair of the key-value, or a different string if the key is not found in the map. Thank you very much.

    Read the article

  • Use string to store statement (or part of a statement), and then add it to the code

    - by Dean
    I use multidimensional arrays to store product attributes (well Virtuemart does, to be precise). When I tried to echo the sub-arrays value, if the sub-array did not exist PHP threw: Fatal error: Cannot use string offset as an array To get around this, I attempted to create a function to check on every array level if it is an actual array, and if it is empty (when trying on the whole thing at once such as: is_array($array['level1']['level2']['level3']), I got the same error if level1 or level2 are not actual arrays). This is the function ($array contains the array to check, $array_levels is an array containing the names of the sub-arrays, in the order they should apper): function check_md_array($array,$array_levels){ if(is_array($array)){ $dimension = null; //This will store the dimensions string foreach($array_levels as $level){ $dimension .= "['" . $level . "']"; //Add the current dimension to the dimensions string if(!is_array($array/* THE CONTENT OF $dimension SHOULD BE INSERTED HERE*/)){ return false; } } return true; } } How can I take the string contained in $dimensions, and insert it into the code, to be part of the statement?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • qTip pop ups come in from top left of screen (on first load)

    - by franko75
    Hi, not sure if i'm set things up incorrectly - I don't seem to see anyone else with this problem, but my qTip popups (all ajax loaded content) are loading quite erratically, in that they are often animating in from off screen before appearing in the correct position. Is there a simple solution to this which I may have missed? Thanks again for your help. HTML markup: <span class="formInfo"> <a href="http://localhost/httpdocs/index.php/help/kc_dob" class="jTip" name="" id="dob_help">?</a> </span> qTip initialisation.. //set up for qtip function initQtip() { $('a.jTip').each(function() { $(this).qtip( { content: { // Set the text to an image HTML string with the correct src URL to the loading image you want to use text: '<img src="/media/images/wait.gif" alt="Loading..." />', url: $(this).attr('href') // Use the rel attribute of each element for the url to load }, position: { adjust: { screen: true // Keep the tooltip on-screen at all times } }, show: { when: 'click', solo: true // Only show one tooltip at a time }, hide: 'unfocus', style: { tip: true, // Apply a speech bubble tip to the tooltip at the designated tooltip corner border: { width: 10, radius: 10 }, width: { min: 200, max: 500 }, name: 'light' // Use the default light style } }); //prevent default event on click }).bind('click', function(event){ event.preventDefault(); return false; }); }

    Read the article

  • Ajax return string links not working

    - by Andreas Lympouras
    I have this ajax function: function getSearchResults(e) { var searchString = e.value; /*var x = e.keyCode; var searchString = String.fromCharCode(x);*/ if (searchString == "") { document.getElementById("results").innerHTML = ""; return; } var xmlhttp; if (window.XMLHttpRequest) {// code for IE7+, Firefox, Chrome, Opera, Safari xmlhttp = new XMLHttpRequest(); } else {// code for IE6, IE5 xmlhttp = new ActiveXObject("Microsoft.XMLHTTP"); } xmlhttp.onreadystatechange = function () { if (xmlhttp.readyState == 4 && xmlhttp.status == 200) { document.getElementById("results").innerHTML = xmlhttp.responseText; } } xmlhttp.open("GET", "<%=Page.ResolveUrl("~/template/searchHelper.aspx?searchString=")%>"+searchString, true); xmlhttp.setRequestHeader("If-Modified-Since", "Sat, 1 Jan 2000 00:00:00 GMT"); //solve any AJAX caching problem(not refreshing) xmlhttp.send(); } and here is when I call it: <input class="text-input" value="SEARCH" id="searchbox" onkeyup="javascript:getSearchResults(this);" maxlength="50" runat="server" /> and all my links in the searchHelper.aspx file(which retruns them as a string) are like this: <a class="item" href='../src/actors.aspx?id=77&name=dasdassss&type=a' > <span class="item">dasdassss</span></a> When I click this link I want my website to go to ../src/actors.aspx?id=77&name=dasdassss&type=a but nothing happens. When I hover over the link, it also shows me where the link is about to redirect! any help?

    Read the article

  • Returning JSON from JavaScript to Python

    - by Chris Lacy
    I'm writing a simple App Engine app. I have a simple page that allows a user to move a marker on a Google map instance. Each time the user drops the marker, I want to return the long/lat to my Python app. function initialize() { ... // Init map var marker = new GMarker(center, {draggable: true}); GEvent.addListener(marker, "dragend", function() { // I want to return the marker.x/y to my app when this function is called .. }); } To my (admittedly limited) knowledge, I should be: 1). Returning a JSON structure with my required data in the listener callback above 2). In my webapp.RequestHandler Handler class, trying to retrieve the JSON structure during the post method. I would very much like to pass this JSOn data back to the app without causing a page reload (which is what has happened when I've used various post/form.submit methods so far). Can anyone provide me with some psuedo code or an example on how I might achieve what I'm after? Thanks.

    Read the article

  • How to get <td> value in textbox

    - by Shreeuday Kasat
    I've done some code in html and in JavaScript ... My query is when I click on <td>, whatever the value associated with it, has to be displayed in the corresponding text box ... In front of <td> I've taken the textbox ... for an example I've taken 3 <td> and 3 textboxes <script type="text/javascript"> function click3(x) { x = document.getElementById("name").innerHTML var a = document.getElementById("txt"); a.value = x; } function click1(y) { y = document.getElementById("addr").innerHTML var b = document.getElementById("txt1"); b.value = y; } function click2(z) { z = document.getElementById("email").innerHTML var c = document.getElementById("txt2"); c.value = z; } </script> this is my JavaScript code , I know this is not an adequate way to deal such problem, since its giving static way to deal with this problem does anyone have a better solution for this problem ?? In JavaScript/jQuery

    Read the article

  • Jquery Ajax + PHP

    - by Kris.Mitchell
    I am having problems with jQuery Ajax and PHP I have my php file set up to echo the data I am gathering from a mysql database. I have verified that the database is returning something and that the string at the end of the function actually contains data. What is happening though, is that it looks like the php echo is happening before the ajax call, causing the php data to be displayed at the top of the page, and not below in proper div. I think it might have something to do with timing of the ajax and the php call, but I am not sure. So, why is the data not getting caught by the .ajax and thrown into the div? Thanks for the help! jQuery $(document).ready(function() { $.ajax({ url: "../database_functions.php", type: "GET", data: "cat=jw&sub=pi&sort=no", cache: false, success: function (html) { alert("Success!"); $('#product-list').html(html); } }); }); PHP echo "Hello World";

    Read the article

  • drupal hook_menu_alter9) for adding tabs

    - by EricP
    I want to add some tabs in the "node/%/edit" page from my module called "cssswitch". When I click "Rebuild Menus", the two new tabs are displayed, but they are displayed for ALL nodes when editing them, not just for the node "cssswitch". I want these new tabs to be displayed only when editing node of type "cssswitch". The other problem is when I clear all cache, the tabs completely dissapear from all edit pages. Below is the code I wrote. function cssswitch_menu_alter(&$items) { $node = menu_get_object(); //print_r($node); //echo $node->type; //exit(); if ($node->type == 'cssswitch') { $items['node/%/edit/schedulenew'] = array( 'title' => 'Schedule1', 'access callback'=>'user_access', 'access arguments'=>array('view cssswitch'), 'page callback' => 'cssswitch_schedule', 'page arguments' => array(1), 'type' => MENU_LOCAL_TASK, 'weight'=>4, ); $items['node/%/edit/schedulenew2'] = array( 'title' => 'Schedule2', 'access callback'=>'user_access', 'access arguments'=>array('view cssswitch'), 'page callback' => 'cssswitch_test2', 'page arguments' => array(1), 'type' => MENU_LOCAL_TASK, 'weight'=>3, ); } } function cssswitch_test(){ return 'test'; } function cssswitch_test2(){ return 'test2'; } Thanks for any help.

    Read the article

  • Translate Prototype code into Jquery version

    - by user1055495
    I everybody, I'm working on a SaaS application and I need to use Jquery instead of Prototype due to some extra plugins integration. My code that was wotking a charm with Prototype is not running anymore with Jquery and I'm not used to write in this framework... Is there someone to help me in "translating" this one: Thanks a lot for your help. var rates = new Array(); <% for tva_rate in @tva_rates -%> rates.push(new Array(<%= tva_rate.id %>, '<%=h tva_rate.taux %>', '<%=h tva_rate.compte_id %>' )); <% end -%> function tvaSelected() { tva_id = $('journal_tva_id').getValue(); show = 1; if (tva_id > 0){ rates.each(function(rate) { if (rate[0] == tva_id) { $('journal_taux').setValue(rate[1]); $('journal_compte_tva').setValue(rate[2]); show = 2; } }); } if (show == 1) { $('tva_taux_field').hide(); } else { $('tva_taux_field').show(); } } document.observe('dom:loaded', function() { tvaSelected(); $('journal_tva_id').observe('change', tvaSelected); });

    Read the article

  • Iteration over a linq to sql query is very slow.

    - by devzero
    I have a view, AdvertView in my database, this view is a simple join between some tables (advert, customer, properties). Then I have a simple linq query to fetch all adverts for a customer: public IEnumerable<AdvertView> GetAdvertForCustomerID(int customerID) { var advertList = from advert in _dbContext.AdvertViews where advert.Customer_ID.Equals(customerID) select advert; return advertList; } I then wish to map this to modelItems for my MVC application: public List<AdvertModelItem> GetAdvertsByCustomer(int customerId) { List<AdvertModelItem> lstAdverts = new List<AdvertModelItem>(); List<AdvertView> adViews = _dataHandler.GetAdvertForCustomerID(customerId).ToList(); foreach(AdvertView adView in adViews) { lstAdverts.Add(_advertMapper.MapToModelClass(adView)); } return lstAdverts; } I was expecting to have some performance issues with the SQL, but the problem seems to be with the .ToList() function. I'm using ANTS performance profiler and it reports that the total runtime of the function is 1.400ms, and 850 of those is with the ToList(). So my question is, why does the tolist function take such a long time here?

    Read the article

< Previous Page | 550 551 552 553 554 555 556 557 558 559 560 561  | Next Page >