Search Results

Search found 15535 results on 622 pages for 'index buffer'.

Page 556/622 | < Previous Page | 552 553 554 555 556 557 558 559 560 561 562 563  | Next Page >

  • How to support comparisons for QVariant objects containing a custom type?

    - by Tyler McHenry
    According to the Qt documentation, QVariant::operator== does not work as one might expect if the variant contains a custom type: bool QVariant::operator== ( const QVariant & v ) const Compares this QVariant with v and returns true if they are equal; otherwise returns false. In the case of custom types, their equalness operators are not called. Instead the values' addresses are compared. How are you supposed to get this to behave meaningfully for your custom types? In my case, I'm storing an enumerated value in a QVariant, e.g. In a header: enum MyEnum { Foo, Bar }; Q_DECLARE_METATYPE(MyEnum); Somewhere in a function: QVariant var1 = QVariant::fromValue<MyEnum>(Foo); QVariant var2 = QVariant::fromValue<MyEnum>(Foo); assert(var1 == var2); // Fails! What do I need to do differently in order for this assertion to be true? I understand why it's not working -- each variant is storing a separate copy of the enumerated value, so they have different addresses. I want to know how I can change my approach to storing these values in variants so that either this is not an issue, or so that they do both reference the same underlying variable. It don't think it's possible for me to get around needing equality comparisons to work. The context is that I am using this enumeration as the UserData in items in a QComboBox and I want to be able to use QComboBox::findData to locate the item index corresponding to a particular enumerated value.

    Read the article

  • Out-of-memory algorithms for addressing large arrays

    - by reve_etrange
    I am trying to deal with a very large dataset. I have k = ~4200 matrices (varying sizes) which must be compared combinatorially, skipping non-unique and self comparisons. Each of k(k-1)/2 comparisons produces a matrix, which must be indexed against its parents (i.e. can find out where it came from). The convenient way to do this is to (triangularly) fill a k-by-k cell array with the result of each comparison. These are ~100 X ~100 matrices, on average. Using single precision floats, it works out to 400 GB overall. I need to 1) generate the cell array or pieces of it without trying to place the whole thing in memory and 2) access its elements (and their elements) in like fashion. My attempts have been inefficient due to reliance on MATLAB's eval() as well as save and clear occurring in loops. for i=1:k [~,m] = size(data{i}); cur_var = ['H' int2str(i)]; %# if i == 1; save('FileName'); end; %# If using a single MAT file and need to create it. eval([cur_var ' = cell(1,k-i);']); for j=i+1:k [~,n] = size(data{j}); eval([cur_var '{i,j} = zeros(m,n,''single'');']); eval([cur_var '{i,j} = compare(data{i},data{j});']); end save(cur_var,cur_var); %# Add '-append' when using a single MAT file. clear(cur_var); end The other thing I have done is to perform the split when mod((i+j-1)/2,max(factor(k(k-1)/2))) == 0. This divides the result into the largest number of same-size pieces, which seems logical. The indexing is a little more complicated, but not too bad because a linear index could be used. Does anyone know/see a better way?

    Read the article

  • A generic error has occurred in GDI+

    - by sysigy
    I know this has been asked a million times but I think I need to make it a million and one. I am getting "A generic error has occurred in GDI+" when trying to save a new bitmap. I have completely stripped down to the most basic lines of code and I still get the error with the following method: public class HomeController : Controller { public ActionResult Index() { return this.View(); } public void CreatePicture() { try { // THIS WORKS System.IO.File.Copy("C:\\copyTest.bmp", "C:\\test folder\\copyTest2.bmp"); // THIS WORKS System.IO.File.Delete("C:\\test folder\\deleteTest.bmp"); using (Bitmap newBitmap = new Bitmap(120, 120)) { // THIS FAILS newBitmap.Save("C:\\test folder\\test.bmp", ImageFormat.Bmp); } } catch (Exception ex) { throw ex; } } } The code is called from an html link on a blank page within an MVC 3.0 website using anonymous login. View: @Html.ActionLink("Create Picture", "CreatePicture", "Home", new { }) I have checked the folder permissions of "test folder" and have given full access to the following: ASPNET NETWORK SERVICE IUSR I still get the error... what have I missed / done wrong ?

    Read the article

  • OCaml delimiters and scopes

    - by Jack
    Hello! I'm learning OCaml and although I have years of experience with imperative programming languages (C, C++, Java) I'm getting some problems with delimiters between declarations or expressions in OCaml syntax. Basically I understood that I have to use ; to concatenate expressions and the value returned by the sequence will be the one of last expression used, so for example if I have exp1; exp2; exp3 it will be considered as an expression that returns the value of exp3. Starting from this I could use let t = something in exp1; exp2; exp3 and it should be ok, right? When am I supposed to use the double semicol ;;? What does it exactly mean? Are there other delimiters that I must use to avoid syntax errors? I'll give you an example: let rec satisfy dtmc state pformula = match (state, pformula) with (state, `Next sformula) -> let s = satisfy_each dtmc sformula and adder a state = let p = 0.; for i = 0 to dtmc.matrix.rows do p <- p +. get dtmc.matrix i state.index done; a +. p in List.fold_left adder 0. s | _ -> [] It gives me syntax error on | but I don't get why.. what am I missing? This is a problem that occurs often and I have to try many different solutions until it suddently works :/ A side question: declaring with let instead that let .. in will define a var binding that lasts whenever after it has been defined? What I basically ask is: what are the delimiters I have to use and when I have to use them. In addition are there differences I should consider while using the interpreter ocaml instead that the compiler ocamlc? Thanks in advance!

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Why doesn't this PHP execute?

    - by cam
    I copied the code from this site exactly: http://davidwalsh.name/web-service-php-mysql-xml-json as follows, /* require the user as the parameter */ if(isset($_GET['user']) && intval($_GET['user'])) { /* soak in the passed variable or set our own */ $number_of_posts = isset($_GET['num']) ? intval($_GET['num']) : 10; //10 is the default $format = strtolower($_GET['format']) == 'json' ? 'json' : 'xml'; //xml is the default $user_id = intval($_GET['user']); //no default /* connect to the db */ $link = mysql_connect('localhost','username','password') or die('Cannot connect to the DB'); mysql_select_db('db_name',$link) or die('Cannot select the DB'); /* grab the posts from the db */ $query = "SELECT post_title, guid FROM wp_posts WHERE post_author = $user_id AND post_status = 'publish' ORDER BY ID DESC LIMIT $number_of_posts"; $result = mysql_query($query,$link) or die('Errant query: '.$query); /* create one master array of the records */ $posts = array(); if(mysql_num_rows($result)) { while($post = mysql_fetch_assoc($result)) { $posts[] = array('post'=>$post); } } /* output in necessary format */ if($format == 'json') { header('Content-type: application/json'); echo json_encode(array('posts'=>$posts)); } else { header('Content-type: text/xml'); echo '<posts>'; foreach($posts as $index => $post) { if(is_array($post)) { foreach($post as $key => $value) { echo '<',$key,'>'; if(is_array($value)) { foreach($value as $tag => $val) { echo '<',$tag,'>',htmlentities($val),'</',$tag,'>'; } } echo '</',$key,'>'; } } } echo '</posts>'; } /* disconnect from the db */ @mysql_close($link); } And the php doesn't execute, it just displays as plain text. What's the dealio? The host supports PHP, I use it to run a Wordpress blog and other things.

    Read the article

  • A little confused about MVC and where to put a database query

    - by jax
    OK, so my Joomla app is in MVC format. I am still a little confused about where to put certain operations, in the Controller or in the Model. This function below is in the controller, it gets called when &task=remove. Should the database stuff be in the Model? It does not seem to fit there because I have two models editapp (display a single application) and allapps (display all the applications), now which one would I put the delete operation in? /** * Delete an application */ function remove() { global $mainframe; $cid = JRequest::getVar( 'cid', array(), '', 'array' ); $db =& JFactory::getDBO(); //if there are items to delete if(count($cid)){ $cids = implode( ',', $cid ); $query = "DELETE FROM #__myapp_apps WHERE id IN ( $cids )"; $db->setQuery( $query ); if (!$db->query()){ echo "<script> alert('".$db->getErrorMsg()."');window.history.go(-1); </script>\n"; } } $mainframe->redirect( 'index.php?option=' . $option . '&c=apps'); } I am also confused about how the flow works. For example, there is a display() function in the controller that gets called by default. If I pass a task, does the display() function still run or does it go directly to the function name passed by $task?

    Read the article

  • Why does my floating div push around other divs?

    - by Meke
    I have a div which has a table which has a google map. I want to place a info box within the google map external to the map, just floating on top But I can't seem to get it right, the info div just pushes around the google map despite being on top of the map... CSS .google_map { height: 270px; width: 100%; } #flightMapInfo { position: relative; float: left; z-index: 100; color: #FFFFFF; top: 30px; left: 50px; background:#5a85a5; padding: 5px; -moz-border-radius: 10px; -webkit-border-radius: 10px; } div.tabContent { border: 1px solid #c9c3ba; padding: 0.5em; background-color: #f1f0ee; min-height: 300px; } .tableLeft { width: 75%; float: left; border-right: dotted 2px black; } HTML <div class="mapBlock tabContent"> <div id="flightMapInfo">WHARGL</div> <table class="tableLeft"> <tr><td><div id="flightMap" class="google_map"></div> </table></td></tr></div>

    Read the article

  • using facelet1.1.15 (external facelet) in JSF2

    - by Odelya
    Hi! I have upgrated to JSF2 but still running with facelet1.1.15. I have these parameters in web.xml: <context-param> <param-name>org.ajax4jsf.VIEW_HANDLERS</param-name> <param-value>com.sun.facelets.FaceletViewHandler</param-value> </context-param> <context-param> <param-name>javax.faces.DISABLE_FACELET_JSF_VIEWHANDLER</param-name> <param-value>true</param-value> </context-param> I am trying to create my own componet step by step of this example : http://www.ibm.com/developerworks/java/library/j-jsf2fu2/index.html#tip3 everything looks fine but i get an error that it doesn't recognize the tag. Has it got to do with the facelet 1.1.15? and it works only with VDL? it there a way to use 1.1.15 and custom components in JSF2? As well - I use tomcat 6

    Read the article

  • Programmatically change the icon of the executable

    - by Dennis Delimarsky
    I am developing an application called WeatherBar. Its main functionality is based on its interaction with the Windows 7 taskbar — it changes the icon depending on the weather conditions in a specific location. The icons I am using in the application are all stored in a compiled native resource file (.res) — I am using it instead of the embedded resource manifest for icons only. By default, I modify the Icon property of the main form to change the icons accordingly and it works fine, as long as the icon is not pinned to the taskbar. When it gets pinned, the icon in the taskbar automatically switches to the default one for the executable (with index 0 in the resource file). After doing a little bit of research, I figured that a way to change the icon would be changing the shortcut icon (as all pinned applications are actually shortcuts stored in the user folder). But it didn't work. I assume that I need to change the icon for the executable, and therefore use UpdateResource, but I am not entirely sure about this. My executable is not digitally signed, so it shouldn't be an issue modifying it. What would be the way to solve this issue?

    Read the article

  • Why my http POST request doesn't go well?

    - by 0x90
    I am trying to make this POST request in ruby. but get back #<Net::HTTPUnsupportedMediaType:0x007f94d396bb98> what I tried is: require 'rubygems' require 'net/http' require 'uri' require 'json' auto_index_nodes =URI('http://localhost:7474/db/data/index/node/') request_nodes = Net::HTTP::Post.new(auto_index_nodes.request_uri) http = Net::HTTP.new(auto_index_nodes.host, auto_index_nodes.port) request_nodes.add_field("Accept", "application/json") request_nodes.set_form_data({"name"=>"node_auto_index", "config" => { "type" => "fulltext", "provider" =>"lucene"} , "Content-Type" => "application/json" }) response = http.request(request_nodes) Tried to write this part: "config" => { "type" => "fulltext", provider" =>"lucene"} , "Content-Type" => "application/json" } like that: "config" => '{ "type" => "fulltext",\ "provider" =>"lucene"},\ "Content-Type" => "application/json"\ }' this try didn't help either: request_nodes.set_form_data({"name"=>"node_auto_index", "config" => '{ \ "type" : "fulltext",\ "provider" : "lucene"}' , "Content-Type" => "application/json" })

    Read the article

  • MySQL Casting in C#

    - by user798080
    Okay, so I'm attempting to print out the contents of a table in a comma-separated file. using (OdbcCommand com = new OdbcCommand("SELECT * FROM pie_data WHERE Pie_ID = ?", con)) { com.Parameters.AddWithValue("", Request.Form["pie_id"]); com.ExecuteNonQuery(); using (OdbcDataReader reader = com.ExecuteReader()) { string finalstring = ""; while (reader.Read()) { finalstring = reader.GetString(9) + ","; for (int i = 0; i <= 8; i = i + 1) { finalstring = finalstring + reader.GetString(i) + ","; } } } Response.Write(finalstring); noredirect = 1; } My table layout is: CREATE TABLE `rent_data` ( `Pies` INT(10) UNSIGNED NOT NULL, `Name` VARCHAR(85) NOT NULL, `Email` VARCHAR(85) NOT NULL, `Pie_Rent` DATE NOT NULL, `Rent_To` DATE NOT NULL, `Returned_Date` DATE NULL DEFAULT NULL, `Place` VARCHAR(100) NOT NULL, `Purpose` MEDIUMTEXT NOT NULL, `Comments` MEDIUMTEXT NULL, `Pie_ID` SMALLINT(5) UNSIGNED ZEROFILL NOT NULL, INDEX `Pie_ID` (`Equipment_ID`) ) The error I'm getting is this: Exception Details: System.InvalidCastException: Unable to cast object of type 'System.Int64' to type 'System.String'. On the line: finalstring = finalstring + reader.GetString(i) + ",";

    Read the article

  • multiple form submission with one submit

    - by skylab
    I've been trying to think this through and figure out if it is possible or not. I'm using zen-cart as shopping cart software, but what I'd like to do, is hard code a page that is basically a list of 7-9 products, next to each product is a checkbox, so I'd like to figure out a way, via html,javascript or jquery to submit whichever forms(products) are checked to the cart. The typical form submission for a product looks something like this(sometimes there may be one or two additional hidden fields): <form name="cart_quantity" action="index.php?action=add_product" method="post" enctype="multipart/form-data"> <input type="hidden" name="cart_quantity" value="1"> <input type="hidden" name="products_id" value="7"> <input type="hidden" name="id[6]" value="9" id="attrib-6-9"> <input type="image" src="buy_button.png" alt="Add to Cart" title="Instructional Video Part 1: Add to Cart"> </form> There would be 7-9 of these on the page, each with a checkbox, so I'm assuming a script would need to figure out which ones where checked and submit them via the form action? Maybe there is a better way of going about this that I'm not thinking of because a)it's over my head or b)just haven't figured it out yet. Anyway is something like this possible?

    Read the article

  • ASP.Net MVC TDD using Moq

    - by Nicholas Murray
    I am trying to learn TDD/BDD using NUnit and Moq. The design that I have been following passes a DataService class to my controller to provide access to repositories. I would like to Mock the DataService class to allow testing of the controllers. There are lots of examples of mocking a repository passed to the controller but I can't work out how to mock a DataService class in this scenerio. Could someone please explain how to implement this? Here's a sample of the relevant code: [Test] public void Can_View_A_Single_Page_Of_Lists() { var dataService = new Mock<DataService>(); var controller = new ListsController(dataService); ... } namespace Services { public class DataService { private readonly IKeyedRepository<int, FavList> FavListRepository; private readonly IUnitOfWork unitOfWork; public FavListService FavLists { get; private set; } public DataService(IKeyedRepository<int, FavList> FavListRepository, IUnitOfWork unitOfWork) { this.FavListRepository = FavListRepository; this.unitOfWork = unitOfWork; FavLists = new FavListService(FavListRepository); } public void Commit() { unitOfWork.Commit(); } } } namespace MyListsWebsite.Controllers { public class ListsController : Controller { private readonly DataService dataService; public ListsController(DataService dataService) { this.dataService = dataService; } public ActionResult Index() { var myLists = dataService.FavLists.All().ToList(); return View(myLists); } } }

    Read the article

  • Show iPad keyboard on select, focus or always (jQuery)

    - by Ryan
    I have a web app that is using jQuery to replace the RETURN key with TAB so that when I user presses return the form is not submitted but rather the cursor moves to the next text field. This works in all browsers but only 1/2 works on the iPad. On the iPad the next field is highlighted but the keyboard is hidden. How can I keep the keyboard visible or force it somehow? Here's my code (thanks to http://thinksimply.com/blog/jquery-enter-tab): function checkForEnter (event) { if (event.keyCode == 13) { currentBoxNumber = textboxes.index(this); if (textboxes[currentBoxNumber + 1] != null) { nextBox = textboxes[currentBoxNumber + 1] nextBox.focus(); nextBox.select(); event.preventDefault(); return false; } } } Drupal.behaviors.formFields = function(context) { $('input[type="text"]').focus(function() { $(this).removeClass("idleField").addClass("focusField"); }); $('input[type="text"]').blur(function() { $(this).removeClass("focusField").addClass("idleField"); }); // replaces the enter/return key function with tab textboxes = $("input.form-text"); if ($.browser.mozilla) { $(textboxes).keypress (checkForEnter); } else { $(textboxes).keydown (checkForEnter); } };

    Read the article

  • grails question (sample 1 of Grails To Action book) problem with Controller and Service

    - by fegloff
    Hi, I'm doing Grails To Action sample for chapter one. Every was just fine until I started to work with Services. When I run the app I have the following error: groovy.lang.MissingPropertyException: No such property: quoteService for class: qotd.QuoteController at qotd.QuoteController$_closure3.doCall(QuoteController.groovy:14) at qotd.QuoteController$_closure3.doCall(QuoteController.groovy) at java.lang.Thread.run(Thread.java:619) Here is my groovie QuoteService class, which has an error within the definition of GetStaticQuote (ERROR: Groovy:unable to resolve class Quote) package qotd class QuoteService { boolean transactional = false def getRandomQuote() { def allQuotes = Quote.list() def randomQuote = null if (allQuotes.size() > 0) { def randomIdx = new Random().nextInt(allQuotes.size()) randomQuote = allQuotes[randomIdx] } else { randomQuote = getStaticQuote() } return randomQuote } def getStaticQuote() { return new Quote(author: "Anonymous",content: "Real Programmers Don't eat quiche") } } Controller groovie class package qotd class QuoteController { def index = { redirect(action: random) } def home = { render "<h1>Real Programmers do not each quiche!</h1>" } def random = { def randomQuote = quoteService.getRandomQuote() [ quote : randomQuote ] } def ajaxRandom = { def randomQuote = quoteService.getRandomQuote() render "<q>${randomQuote.content}</q>" + "<p>${randomQuote.author}</p>" } } Quote Class: package qotd class Quote { String content String author Date created = new Date() static constraints = { author(blank:false) content(maxSize:1000, blank:false) } } I'm doing the samples using Eclipse with grails addin. Any advice? Regards, Francisco

    Read the article

  • Rails routing of a controller's functions query

    - by Jty.tan
    So I've got a Users controller, and it has (amongst others) a function called details. The idea is that a user can go to localhost:3000/user/:user_id/details and be able to view the details of :user_id. For example, I have a user called "tester". When I go to the uri: http://localhost:3000/users/tester/details I'd want the details function to be called up, to render the details view, and to display the information for the user tester. But instead I get an error saying that No action responded to tester. Actions: change_password, create, current_user, details, forgot_password, index, login_required, new, redirect_to_stored, show, and update_attributes And I understand that to basically mean that if I wanted to access details, I should really be using http://localhost:3000/users/details Except that that isn't really working either... .< That is instead bringing me to http://localhost:3000/users/details/registries (which is the default path that I'd stipulated for anybody trying to view users/:user_id, so again, that's working the way I wanted it to) Point is: Can anybody help and tell me how I can go about getting users/:user_id/details to work the way I want it to and display the details of :user_id? Thanks!

    Read the article

  • qTip pop ups come in from top left of screen (on first load)

    - by franko75
    Hi, not sure if i'm set things up incorrectly - I don't seem to see anyone else with this problem, but my qTip popups (all ajax loaded content) are loading quite erratically, in that they are often animating in from off screen before appearing in the correct position. Is there a simple solution to this which I may have missed? Thanks again for your help. HTML markup: <span class="formInfo"> <a href="http://localhost/httpdocs/index.php/help/kc_dob" class="jTip" name="" id="dob_help">?</a> </span> qTip initialisation.. //set up for qtip function initQtip() { $('a.jTip').each(function() { $(this).qtip( { content: { // Set the text to an image HTML string with the correct src URL to the loading image you want to use text: '<img src="/media/images/wait.gif" alt="Loading..." />', url: $(this).attr('href') // Use the rel attribute of each element for the url to load }, position: { adjust: { screen: true // Keep the tooltip on-screen at all times } }, show: { when: 'click', solo: true // Only show one tooltip at a time }, hide: 'unfocus', style: { tip: true, // Apply a speech bubble tip to the tooltip at the designated tooltip corner border: { width: 10, radius: 10 }, width: { min: 200, max: 500 }, name: 'light' // Use the default light style } }); //prevent default event on click }).bind('click', function(event){ event.preventDefault(); return false; }); }

    Read the article

  • Trying to edit an entity with data from dropdowns in MVC...

    - by user598352
    Hello! I'm having trouble getting my head around sending multiple models to a view in mvc. My problem is the following. Using EF4 I have a table with attributes organised by category. Couldn't post an image :-( [Have a table called attributes (AttributeTitle, AttributeName, CategoryID) connected to a table called Category (CategoryTitle).] What I want to do is be able to edit an attribute entity and have a dropdown of categories to choose from. I tried to make a custom viewmodel public class AttributeViewModel { public AttributeViewModel() { } public Attribute Attribute { get; set; } public IQueryable<Category> AllCategories { get; set; } } But it just ended up being a mess. <div class="editor-field"> <%: Html.DropDownList("Category", new SelectList((IEnumerable)Model.AllCategories, "CategoryID", "CategoryName")) %> </div> I was getting it back to the controller... [HttpPost] public ActionResult Edit(int AttributeID, FormCollection formcollection) { var _attribute = ProfileDB.GetAttribute(AttributeID); int _selcategory = Convert.ToInt32(formcollection["Category"]); _attribute.CategoryID = (int)_selcategory; try { UpdateModel(_attribute); (<---Error here) ProfileDB.SaveChanges(); return RedirectToAction("Index"); } catch (Exception e) { return View(_attribute); } } I've debugged the code and my _attribute looks correct and _attribute.CategoryID = (int)_selcategory updates the model, but then I get the error. Somewhere here I thought that there should be a cleaner way to do this, and that if I could only send two models to the view instead of having to make a custom viewmodel. To sum it up: I want to edit my attribute and have a dropdown of all of the available categories. Any help much appreciated!

    Read the article

  • PHP Multiple navigation highlights

    - by Blackbird
    I'm using this piece of code below to highlight the "active" menu item on my global navigation. <?php $path = $_SERVER['PHP_SELF']; $page = basename($path); $page = basename($path, '.php'); ?> <ul id="nav"> <li class="home"><a href="index.php">Home</a></li> <li <?php if ($page == 'search') { ?>class="active"<?php } ?>><a href="#">Search</a></li> <li <?php if ($page == 'help') { ?>class="active"<?php } ?>><a href="help.php">Help</a></li> </ul> All works great but, on a couple of pages, I have a second sub menu (sidebar menu) within a global page. I basically need to add a OR type statement into the php somehow, but I haven't a clue a how. Example of what i mean: <li <?php if ($page == 'help') OR ($page == 'help-overview') OR ($page == 'help-cat-1') { ?>class="active"<?php } ?>><a href="#">Search</a></li> Thanks!

    Read the article

  • structDelete doesn't effect the shallow copy?

    - by Travis
    I was playing around onError so I tried to create an error using a large xml document object. <cfset variables.XMLByRef = variables.parsedXML.XMLRootElement.XMLChildElement> <cfset structDelete(variables.parsedXML, "XMLRootElement")> <cfset variables.startXMLShortLoop = getTickCount()> <cfloop from = "1" to = "#arrayLen(variables.XMLByRef)#" index = "variables.i"> <cfoutput>#variables.XMLByRef[variables.i].id.xmltext#</cfoutput><br /> </cfloop> <cfset variables.stopXMLShortLoop = getTickCount()> I expected to get an error because I deleted the structure I was referencing. From LiveDocs: Variable Assignment - Creates an additional reference, or alias, to the structure. Any change to the data using one variable name changes the structure that you access using the other variable name. This technique is useful when you want to add a local variable to another scope or otherwise change a variable's scope without deleting the variable from the original scope. instead I got 580df1de-3362-ca9b-b287-47795b6cdc17 25a00498-0f68-6f04-a981-56853c0844ed ... ... ... db49ed8a-0ba6-8644-124a-6d6ebda3aa52 57e57e28-e044-6119-afe2-aebffb549342 Looped 12805 times in 297 milliseconds <cfdump var = "#variables#"> Shows there's nothing in the structure, just parsedXML.xmlRoot.xmlName with the value of XMLRootElement. I also tried <cfset structDelete(variables.parsedXML.XMLRootElement, "XMLChildElement")> as well as structClear for both. More information on deleting from the xml document object. http://help.adobe.com/en_US/ColdFusion/9.0/Developing/WSc3ff6d0ea77859461172e0811cbec22c24-78e3.html Can someone please explain my faulty logic? Thanks.

    Read the article

  • Have something loaded only when JList item is visibile

    - by elvencode
    Hello, i'm implementing a Jlist populated with a lot of elements. Each element corresponds to a image so i'd like to show a resized preview of them inside each row of the list. I've implemented a custom ImageCellRenderer extending the Jlabel and on getListCellRendererComponent i create the thumbnail if there'snt any for that element. Each row corresponds to a Page class where i store the path of the image and the icon applied to the JLabel. Each Page object is put inside a DefaultListModel to populate the JList. The render code is something like this: public Component getListCellRendererComponent( JList list, Object value, int index, boolean isSelected, boolean cellHasFocus) { Page page = (Page) value; if (page.getImgIcon() == null) { System.out.println(String.format("Creating thumbnail of %s", page.getImgFilename())); ImageIcon icon = new ImageIcon(page.getImgFilename()); int thumb_width = icon.getIconWidth() > icon.getIconHeight() ? 128 : ((icon.getIconWidth() * 128) / icon.getIconHeight()); int thumb_height = icon.getIconHeight() > icon.getIconWidth() ? 128 : ((icon.getIconHeight() * 128) / icon.getIconWidth()); icon.setImage(getScaledImage(icon.getImage(), thumb_width, thumb_height)); page.setImgIcon(icon); } setIcon(page.getImgIcon()); } I was thinking that only a certain item is visibile in the List the cell renderer is called but i'm seeing that all the thumnails are created when i add the Page object to the list model. I've tried to load the items and after set the model in the JList or set the model first and after starting appending the items but the results are the same. Is there any way to load the data only when necessary or do i need to create a custom control like a JScrollPanel with stacked items inside where i check myself the visibility of each elements? Thanks

    Read the article

  • IE7 & IE8 error executing function with ajax

    - by Yahreen
    I am loading an ajax page which executes an HTML5 video player script. The function for the Flash fallback is html5media(); : //Load 1st Case Study $("#splash").live('click', function (e) { $(this).fadeOut('slow', function () { $('#case-studies').load('case-study-1.html', function() { html5media(); //initiate Flash fallback }).fadeIn(); }); e.preventDefault(); }); This initial page load works fine in IE7 & IE8. The problem is once this page is loaded, there are links to 4 more videos which are loaded in again using ajax. I use this function: //Switcher function csClients(url, client) { $("#case-studies").fadeOut('slow', function() { $('#case-studies').load(url, function () { html5media(); //initiate Flash fallback }).fadeIn(); }); } //Page Loader $("#cs-client-list li.client1 a").live('click', function(e) { csClients('case-study-1.html', 'client1'); e.preventDefault(); }); Originally I was using return false; but none of the sub-page Flash videos would load in IE7. When I switched to preventDefault, the videos loaded in IE7 but still not in IE8. I also get a weird error in both IE7 & IE8 with no helpful feedback: Error on Page: Unspecified error. / (Line 49) Code: 0 (Char 5) URI: http://www.mysite.com This is line 49 in my index page: <section id="case-studies" class="main-section"> I have a feeling it has to do with calling html5media(); too many times? At a loss...

    Read the article

  • Determining where in the code an error came from - iPhone

    - by Robert Eisinger
    I'm used to Java programming where an error is thrown and it tells you at what line the error was thrown from which file. But with Objective-C in XCode, I can't ever tell where the error comes from. How can I figure out where the error came from? Here is an example of a crash error: 2011-01-04 10:36:31.645 TestGA[69958:207] *** Terminating app due to uncaught exception 'NSRangeException', reason: '*** -[NSMutableArray objectAtIndex:]: index 0 beyond bounds for empty array' *** Call stack at first throw: ( 0 CoreFoundation 0x01121be9 __exceptionPreprocess + 185 1 libobjc.A.dylib 0x012765c2 objc_exception_throw + 47 2 CoreFoundation 0x011176e5 -[__NSArrayM objectAtIndex:] + 261 3 TestGA 0x000548d8 -[S7GraphView drawRect:] + 5763 4 UIKit 0x003e16eb -[UIView(CALayerDelegate) drawLayer:inContext:] + 426 5 QuartzCore 0x00ec89e9 -[CALayer drawInContext:] + 143 6 QuartzCore 0x00ec85ef _ZL16backing_callbackP9CGContextPv + 85 7 QuartzCore 0x00ec7dea CABackingStoreUpdate + 2246 8 QuartzCore 0x00ec7134 -[CALayer _display] + 1085 9 QuartzCore 0x00ec6be4 CALayerDisplayIfNeeded + 231 10 QuartzCore 0x00eb938b _ZN2CA7Context18commit_transactionEPNS_11TransactionE + 325 11 QuartzCore 0x00eb90d0 _ZN2CA11Transaction6commitEv + 292 12 QuartzCore 0x00ee97d5 _ZN2CA11Transaction17observer_callbackEP19__CFRunLoopObservermPv + 99 13 CoreFoundation 0x01102fbb __CFRUNLOOP_IS_CALLING_OUT_TO_AN_OBSERVER_CALLBACK_FUNCTION__ + 27 14 CoreFoundation 0x010980e7 __CFRunLoopDoObservers + 295 15 CoreFoundation 0x01060bd7 __CFRunLoopRun + 1575 16 CoreFoundation 0x01060240 CFRunLoopRunSpecific + 208 17 CoreFoundation 0x01060161 CFRunLoopRunInMode + 97 18 GraphicsServices 0x01932268 GSEventRunModal + 217 19 GraphicsServices 0x0193232d GSEventRun + 115 20 UIKit 0x003b842e UIApplicationMain + 1160 21 TestGA 0x00001cd8 main + 102 22 TestGA 0x00001c69 start + 53 23 ??? 0x00000001 0x0 + 1 So from looking at this, where is the error coming from and from which class is it coming from?

    Read the article

  • Geohashing - recursively find neighbors of neighbors

    - by itsme
    I am now looking for an elegant algorithm to recursively find neighbors of neighbors with the geohashing algorithm (http://www.geohash.org). Basically take a central geohash, and then get the first 'ring' of same-size hashes around it (8 elements), then, in the next step, get the next ring around the first etc. etc. Have you heard of an elegant way to do so? Brute force could be to take each neighbor and get their neighbors simply ignoring the massive overlap. Neighbors around one central geohash has been solved many times (here e.g. in Ruby: http://github.com/masuidrive/pr_geohash/blob/master/lib/pr_geohash.rb) Edit for clarification: Current solution, with passing in a center key and a direction, like this (with corresponding lookup-tables): def adjacent(geohash, dir) base, lastChr = geohash[0..-2], geohash[-1,1] type = (geohash.length % 2)==1 ? :odd : :even if BORDERS[dir][type].include?(lastChr) base = adjacent(base, dir) end base + BASE32[NEIGHBORS[dir][type].index(lastChr),1] end (extract from Yuichiro MASUI's lib) I say this approach will get ugly soon, because directions gets ugly once we are in ring two or three. The algorithm would ideally simply take two parameters, the center area and the distance from 0 being the center geohash only (["u0m"] and 1 being the first ring made of 8 geohashes of the same size around it (= [["u0t", "u0w"], ["u0q", "u0n"], ["u0j", "u0h"], ["u0k", "u0s"]]). two being the second ring with 16 areas around the first ring etc. Do you see any way to deduce the 'rings' from the bits in an elegant way?

    Read the article

< Previous Page | 552 553 554 555 556 557 558 559 560 561 562 563  | Next Page >