Search Results

Search found 35839 results on 1434 pages for 'string utils'.

Page 556/1434 | < Previous Page | 552 553 554 555 556 557 558 559 560 561 562 563  | Next Page >

  • Sinatra / Rack fails with non-ascii characters in url

    - by Piotr Zolnierek
    I am getting Encoding::UndefinedConversionError at /find/Wroclaw "\xC5" from ASCII-8BIT to UTF-8 For some mysterious reason sinatra is passing the string as ASCII instead of UTF-8 as it should. I have found some kind of ugly workaround... I don't know why Rack assumes the encoding is ASCII-8BIT ... anyway, a way is to use string.force_encoding("UTF-8")... but doing this for all params is tedious

    Read the article

  • Question regarding factory pattern

    - by eriks
    I have a factory class to build objects of base class B. The object (D) that uses this factory received a list of strings representing the actual types. What is the correct implementation: the factory receives an Enum (and uses switch inside the Create function) and D is responsible to convert the string to Enum. the factory receives a string and checks for a match to a set of valid strings (using ifs') other implementation i didn't think of.

    Read the article

  • How to get Alfresco login ticket without user password, but with impersonating user with user principal name (UPN)

    - by dok
    I'm writing a DLL that has function for getting Alfresco login ticket without using user password, using only a user principal name (UPN). I’m calling alfresco REST API service /wcservice. I use NTLM in Alfresco. I’m impersonating users using WindowsIdentity constructor as explained here http://msdn.microsoft.com/en-us/library/ms998351.aspx#paght000023_impersonatingbyusingwindowsidentity. I checked and user is properly impersonated (I checked WindowsIdentity.GetCurrent().Name property). After impersonating a user, I try to make HttpWebRequest and set its credentials with CredentialsCache.DefaultNetworkCredentials. I get the error: The remote server returned an error: (401) Unauthorized. at System.Net.HttpWebRequest.GetResponse() When I use new NetworkCredential("username", "P@ssw0rd") to set request credentials, I get Alfresco login ticket (HttpStatusCode.OK, 200). Is there any way that I can get Alfresco login ticket without user password? Here is the code that I'm using: private string GetTicket(string UPN) { WindowsIdentity identity = new WindowsIdentity(UPN); WindowsImpersonationContext context = null; try { context = identity.Impersonate(); MakeWebRequest(); } catch (Exception e) { return e.Message + Environment.NewLine + e.StackTrace; } finally { if (context != null) { context.Undo(); } } } private string MakeWebRequest() { string URI = "http://alfrescoserver/alfresco/wcservice/mg/util/login"; HttpWebRequest request = WebRequest.Create(URI) as HttpWebRequest; request.CookieContainer = new CookieContainer(1); //request.Credentials = new NetworkCredential("username", "p@ssw0rd"); // It works with this request.Credentials = CredentialCache.DefaultNetworkCredentials; // It doesn’t work with this //request.Credentials = CredentialCache.DefaultCredentials; // It doesn’t work with this either try { using (HttpWebResponse response = request.GetResponse() as HttpWebResponse) { StreamReader sr = new StreamReader(response.GetResponseStream()); return sr.ReadToEnd(); } } catch (Exception e) { return (e.Message + Environment.NewLine + e.StackTrace); } } Here are records from Alfresco stdout.log (if it helps in any way): 17:18:04,550 DEBUG [app.servlet.NTLMAuthenticationFilter] Processing request: /alfresco/wcservice/mg/util/login SID:7453F7BD4FD2E6A61AD40A31A37733A5 17:18:04,550 DEBUG [web.scripts.DeclarativeRegistry] Web Script index lookup for uri /mg/util/login took 0.526239ms 17:18:04,550 DEBUG [app.servlet.NTLMAuthenticationFilter] New NTLM auth request from 10.**.**.** (10.**.**.**:1229) 17:18:04,566 DEBUG [app.servlet.NTLMAuthenticationFilter] Processing request: /alfresco/wcservice/mg/util/login SID:7453F7BD4FD2E6A61AD40A31A37733A5 17:18:04,566 DEBUG [web.scripts.DeclarativeRegistry] Web Script index lookup for uri /mg/util/login took 0.400909ms 17:18:04,566 DEBUG [app.servlet.NTLMAuthenticationFilter] Received type1 [Type1:0xe20882b7,Domain:<NotSet>,Wks:<NotSet>] 17:18:04,566 DEBUG [app.servlet.NTLMAuthenticationFilter] Client domain null 17:18:04,675 DEBUG [app.servlet.NTLMAuthenticationFilter] Sending NTLM type2 to client - [Type2:0x80000283,Target:AlfrescoServerA,Ch:197e2631cc3f9e0a]

    Read the article

  • Regex in Python

    - by newToProgramming
    SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

    Read the article

  • Regex to match 0 - 999 but not blank

    - by James Cadd
    I'm working on a regex to match valid integer numbers such as the following: 0 1 99 999 However it should not allow matching an empty string. The closest I can get is: (0)|\\d{1,3} Which to me says a matching string will have either a zero or a series of digits between 1 and 3 characters long. However, empty strings still appear to match this pattern. What's the proper way to exclude empty strings from this regex?

    Read the article

  • usage of try catch

    - by Muhammed Rauf K
    Which is best: Code Snippet 1 or Code Snippet 2 ? And Why? /* Code Snippet 1 * * Write try-catch in function definition */ void Main(string[] args) { AddMe(); } void AddMe() { try { // Do operations... } catch(Exception e) { } } /* Code Snippet 2 * * Write try-catch where we call the function. */ void Main(string[] args) { try { AddMe(); } catch (Exception e) { } } void AddMe() { // Do operations... }

    Read the article

  • Fractional to Decimal Form.

    - by ThePower
    Hi, there probably isn't an answer to this apart from "Create it yourself", but you never know, there might be some string representation for this. Basically, I would like to display number values as fractional instead of decimal when displaying the values as a string. Instead of a value displaying as: 1.1428571428571428571428571428571 I would prefer it to display as 8/7 Is there any way of doing this without writing the functionality myself? Regards Lloyd

    Read the article

  • How to code a keyboard button to switch between 2 modes?

    - by le.shep20
    Hi! i'm doing a project, i'm not going to details but i will simplify my idea, i'm using Morse Code ( dot and dash) and i have 2 methods: convert_MorseToChar() and Convert_MorseTonum() in the convert_MorseToChar() method there is swich to compare the input from a user which will be Morse codes and mapping it to characters: private String convert_MorseToChar(ref string Ch) { switch (Ch) { Case ".-": MorsetoChar = "a" break; Case "-...": MorsetoChar = "b" break; Case "-.-.": MorsetoChar = "c" break; Case "-..": MorsetoChar = "d" break; Case ".": MorsetoChar = "e" break; } } and the other method Convert_MorseToNum(), ues the SAME combinations of Morse codes but mapping them to numbers: private String Convert_MorseToNum(ref string Ch) { switch (Ch) { Case ".-": MorsetoChar = "1" break; Case "-...": MorsetoChar = "2" break; Case "-.-.": MorsetoChar = "3" break; Case "-..": MorsetoChar = "4" break; Case ".": MorsetoChar = "5" break; } } now the senario is: there are 2 Textbox, one the user will write Morse codes in it and the other is for the output. The user will write dot "." and dash "-" from the keyboard and press Enter then the program will go to ONE of the 2 methods to convert the Morse codes. Now what tells the program where to go to convert?? my question is: I want to create mode key to swich between 2 modes: MorseTochar and MorseToNum. i want the down arrow key to act like a mode, when a user press the down arrow then it the program will be in MorseToChar mode, when ever the user input the program directly use the method convert_MorseToChar to convert to characters. and when the user press the down arrow agian, the prohram will swich to MorseToNum mode here when ever the user input as morsecode, the program will directly use the method Convert_MorseToNum() to convert to numbers. HOW I CAN DO THAT Pleaaaas!!! help me! Please excuse my English, English is not my native language :)

    Read the article

  • How to change default conjunction with Lucene MultiFieldQueryParser

    - by Luke H
    I have some code using Lucene that leaves the default conjunction operator as OR, and I want to change it to AND. Some of the code just uses a plain QueryParser, and that's fine - I can just call setDefaultOperator on those instances. Unfortunately, in one place the code uses a MultiFieldQueryParser, and calls the static "parse" method (taking String, String[], BooleanClause.Occur[], Analyzer), so it seems that setDefaultOperator can't help, because it's an instance method. Is there a way to keep using the same parser but have the default conjunction changed?

    Read the article

  • How do I require that an element has either one set of attributes or another in an XSD schema?

    - by Eli Courtwright
    I'm working with an XML document where a tag must either have one set of attributes or another. For example, it needs to either look like <tag foo="hello" bar="kitty" /> or <tag spam="goodbye" eggs="world" /> e.g. <root> <tag foo="hello" bar="kitty" /> <tag spam="goodbye" eggs="world" /> </root> So I have an XSD schema where I use the xs:choice element to choose between two different attribute groups: <xsi:schema xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema" attributeFormDefault="unqualified" elementFormDefault="qualified"> <xs:element name="root"> <xs:complexType> <xs:sequence> <xs:element maxOccurs="unbounded" name="tag"> <xs:choice> <xs:complexType> <xs:attribute name="foo" type="xs:string" use="required" /> <xs:attribute name="bar" type="xs:string" use="required" /> </xs:complexType> <xs:complexType> <xs:attribute name="spam" type="xs:string" use="required" /> <xs:attribute name="eggs" type="xs:string" use="required" /> </xs:complexType> </xs:choice> </xs:element> </xs:sequence> </xs:complexType> </xs:element> </xsi:schema> However, when using lxml to attempt to load this schema, I get the following error: >>> from lxml import etree >>> etree.XMLSchema( etree.parse("schema_choice.xsd") ) Traceback (most recent call last): File "<stdin>", line 1, in <module> File "xmlschema.pxi", line 85, in lxml.etree.XMLSchema.__init__ (src/lxml/lxml.etree.c:118685) lxml.etree.XMLSchemaParseError: Element '{http://www.w3.org/2001/XMLSchema}element': The content is not valid. Expected is (annotation?, ((simpleType | complexType)?, (unique | key | keyref)*))., line 7 Since the error is with the placement of my xs:choice element, I've tried putting it in different places, but no matter what I try, I can't seem to use it to define a tag to have either one set of attributes (foo and bar) or another (spam and eggs). Is this even possible? And if so, then what is the correct syntax?

    Read the article

  • Regex - find only replace occurences not touching some of them

    - by vittore
    Not very good at regex though and maybe that's a stupid question, I'm given string like "bla @a bla @a1 bla " I'm also pairs like {"a", "a2"} , {"a1", "a13"}, and am to replace @a to @a2 for first pair, and @a1 to @a13 for second one. The problem is when i use string.replace and look for @a , it also replaces @a1 but it should not. Help me with regex replace, please. Cheers

    Read the article

  • Error while creating tests in Visual Studio

    - by Benjol
    When I try to generate a unit test for the following method (in a public static class) private static string[] GetFields(string line, char sep) { char[] totrim = { '"', ' ' }; return line.Split(sep).Select(col => col.Trim(totrim)).ToArray(); } The Tests output says: While trying to generate your tests, the following errors occurred: This method or property cannot be called within an event handler. It works if I make the function public - I've tried running Publicize.exe manually, it doesn't complain, but doesn't make any difference either.

    Read the article

  • JSON is used only for JavaScript?

    - by Bob Smith
    I am storing a JSON string in the database that represents a set of properties. In the code behind, I export it and use it for some custom logic. Essentially, I am using it only as a storage mechanism. I understand XML is better suited for this but I read that JSON is faster and preferred. Is it a good practice to use JSON if the intention is not to use the string on the client side?

    Read the article

  • How can we define more than one table,define columns and write data in xml file ?

    - by Harikrishna
    I am writing my xml file manually. And I am writing that for storing data and retrieving data from that. I have written file like for the table PersonalInfo. <?xml version="1.0" standalone="yes"?> <PersonalInfo> <xs:schema id="PersonalInfo" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="PersonalInfo" msdata:IsDataSet="true" msdata:UseCurrentLocale="true"> <xs:complexType> <xs:choice minOccurs="0" maxOccurs="unbounded"> <xs:element name="PesonalInfo."> <xs:complexType> <xs:sequence> <!--Define Column Here....--> <xs:element name="name" type="xs:string" /> <xs:element name="address" type="xs:string" /> </xs:sequence> </xs:complexType> </xs:element> </xs:choice> </xs:complexType> </xs:element> </xs:schema> <!--First Row--> <PersonalInfo.> <name>Harikrishna</name> <address>India</address> </PersonalInfo.> <!--Second Row--> <PersonalInfo.> <name>Jatin</name> <address>India</address> </PersonalInfo.> </PersonalInfo> Please suggest any mistake with writing file here. And now I want define more than table in this file. And here I have to write data for the table like <PersonalInfo.> <name>Harikrishna</name> <address>India</address> </PersonalInfo.> <PersonalInfo.> <name>Jatin</name> <address>India</address> </PersonalInfo.> Is not possible some thing writing data when defining columns EDIT : <xs:element name="name" type="xs:string",Harikrishna,Jatin.... /> <xs:element name="address" type="xs:string",India,India.... /> And how to define more than one table in a single xml file ?

    Read the article

  • Endian check in C

    - by webgenius
    Got this code snippet from some website: int num = 1; if(*(char *)&num == 1) { printf("\nLittle-Endian\n"); } else { printf("Big-Endian\n"); } Can anyone explain this step-by-step? &num - Adress of a (char *)&num - Type-cast address of a into a string *(char *)&num - Points to the first character of the string Am I missing anything here?

    Read the article

  • MD5 hash with salt for keeping password in DB in C#

    - by abatishchev
    Could you please advise me some easy algorithm for hashing user password by MD5, but with salt for increasing reliability. Now I have this one: private static string GenerateHash(string value) { var data = System.Text.Encoding.ASCII.GetBytes(value); data = System.Security.Cryptography.MD5.Create().ComputeHash(data); return Convert.ToBase64String(data); }

    Read the article

  • regex split problem

    - by sunil-mand99
    I have javascript string variable with var sttr="We prefer questions that can be answered --------------------- not just discussed --------------------- Provide details ---------------------------- Write clearly and simply --------------------------answer all the question" please suggest how to split the string into array of sentences on the basis of dashes(-----) using regex result should be array[0]=We prefer questions that can be answered array[1]=not just discussed array[2]=Provide details array[3]=rite clearly and simply array[4]=answer all the question Note: dash(-----) range after each sentence is between 10 to 50

    Read the article

  • Help with storing/accessing user access roles C# Winforms

    - by user222453
    Hello, firstly I would like to thank you in advance for any assistance provided. I am new to software development and have designed several Client/Server applications over the last 12 months or so, I am currently working on a project that involves a user logging in to gain access to the application and I am looking at the most efficient and "simple" method of storing the users permissions once logged in to the application which can be used throughout restricting access to certain tabs on the main form. I have created a static class called "User" detailed below: static class User { public static int _userID; public static string _moduleName; public static string _userName; public static object[] UserData(object[] _dataRow) { _userID = (int)_dataRow[0]; _userName = (string)_dataRow[1]; _moduleName = (string)_dataRow[2]; return _moduleName; } } When the user logs in and they have been authenticated, I wish to store the _moduleName objects in memory so I can control which tabs on the main form tab control they can access, for example; if the user has been assigned the following roles in the database: "Sales Ledger", "Purchase Ledger" they can only see the relevant tabs on the form, by way of using a Switch - Case block once the login form is hidden and the main form is instantiated. I can store the userID and userName variables in the main form once it loads by means of say for example: Here we process the login data from the user: DataAccess _dal = new DataAccess(); switch (_dal.ValidateLogin(txtUserName.Text, txtPassword.Text)) { case DataAccess.ValidationCode.ConnectionFailed: MessageBox.Show("Database Server Connection Failed!"); break; case DataAccess.ValidationCode .LoginFailed: MessageBox.Show("Login Failed!"); _dal.RecordLogin(out errMsg, txtUserName.Text, workstationID, false); break; case DataAccess.ValidationCode .LoginSucceeded: frmMain frmMain = new frmMain(); _dal.GetUserPrivList(out errMsg,2); //< here I access my DB and get the user permissions based on the current login. frmMain.Show(); this.Hide(); break; default: break; } private void frmMain_Load(object sender, EventArgs e) { int UserID = User._userID; } That works fine, however the _modules object contains mutiple permissions/roles depending on what has been set in the database, how can I store the multiple values and access them via a Switch-Case block? Thank you again in advance.

    Read the article

  • Error Galleria IE7

    - by John the horn
    I am using galleria for my site [Minavet.ro][1] [1]: http://minavet.ro and this error comes up is IE7 Line:219079877 Char:2 Error:Expected identifier, string number code:0 url:http://minavet.ro Thx for your time I have given the images width and height and now the error is Line:222704333 Char:2 Error:Expected identifier, string number code:0 url:http://minavet.ro

    Read the article

  • AES decryption in Java - IvParameterSpec to big

    - by user1277269
    Im going to decrypt a plaintext with two keys. As you see in the picture were have one encrypted file wich contains KEY1(128 bytes),KEYIV(128 bytes),key2(128bytes) wich is not used in this case then we have the ciphertext. The error I get here is "Exception in thread "main" java.security.InvalidAlgorithmParameterException: Wrong IV length: must be 16 bytes long. but it is 64 bytes." Picture: http://i264.photobucket.com/albums/ii200/XeniuM05/bg_zps0a523659.png public class AES { public static void main(String[] args) throws Exception { byte[] encKey1 = new byte[128]; byte[] EncIV = new byte[256]; byte[] UnEncIV = new byte[128]; byte[] unCrypKey = new byte[128]; byte[] unCrypText = new byte[1424]; File f = new File("C://ftp//ciphertext.enc"); FileInputStream fis = new FileInputStream(F); byte[] EncText = new byte[(int) f.length()]; fis.read(encKey1); fis.read(EncIV); fis.read(EncText); EncIV = Arrays.copyOfRange(EncIV, 128, 256); EncText = Arrays.copyOfRange(EncText, 384, EncText.length); System.out.println(EncText.length); KeyStore ks = KeyStore.getInstance(KeyStore.getDefaultType()); char[] password = "lab1StorePass".toCharArray(); java.io.FileInputStream fos = new java.io.FileInputStream( "C://ftp//lab1Store"); ks.load(fos, password); char[] passwordkey1 = "lab1KeyPass".toCharArray(); PrivateKey Lab1EncKey = (PrivateKey) ks.getKey("lab1EncKeys", passwordkey1); Cipher rsaDec = Cipher.getInstance("RSA"); // set cipher to RSA decryption rsaDec.init(Cipher.DECRYPT_MODE, Lab1EncKey); // initalize cipher ti lab1key unCrypKey = rsaDec.doFinal(encKey1); // Decryps first key UnEncIV = rsaDec.doFinal(EncIV); //decryps encive byte array to undecrypted bytearray---- OBS! Error this is 64 BYTES big, we want 16? System.out.println("lab1key "+ unCrypKey +" IV " + UnEncIV); //-------CIPHERTEXT decryption--------- Cipher AESDec = Cipher.getInstance("AES/CBC/PKCS5Padding"); //---------convert decrypted bytearrays to acctual keys SecretKeySpec unCrypKey1 = new SecretKeySpec(unCrypKey, "AES"); IvParameterSpec ivSpec = new IvParameterSpec(UnEncIV); AESDec.init(Cipher.DECRYPT_MODE, unCrypKey1, ivSpec ); unCrypText = AESDec.doFinal(EncText); // Convert decrypted cipher bytearray to string String deCryptedString = new String(unCrypKey); System.out.println(deCryptedString); }

    Read the article

  • Can I make Axis2 generate a WSDL with 'unwrapped' types?

    - by Bedwyr Humphreys
    I'm trying to consume a hello world AXIS2 SOAP web service using a PHP client. The Java class is written in Netbeans and the AXIS2 aar file is generated using the Netbeans AXIS2 plugin. You've all seen it before but here's the java class: public class SOAPHello { public String sayHello(String username) { return "Hello, "+username; } } The wsdl genereated by AXIS2 seems to wrap all the parameters so that when I consume the service i have to use a crazy PHP script like this: $client = new SoapClient("http://myhost:8080/axis2/services/SOAPHello?wsdl"); $parameters["username"] = "Dave"; $response = $client->sayHello($parameters)->return; echo $response."!"; When all I really want to do is echo $client->sayHello("Dave")."!"; My question is two-fold: why is this happening? and what can I do to stop it? :) Here's are the types, message and porttype sections of the generated wsdl: <wsdl:types> <xs:schema attributeFormDefault="qualified" elementFormDefault="qualified" targetNamespace="http://soap.axis2.myhost.co.uk"> <xs:element name="sayHello"> <xs:complexType> <xs:sequence> <xs:element minOccurs="0" name="username" nillable="true" type="xs:string"/> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="sayHelloResponse"> <xs:complexType> <xs:sequence> <xs:element minOccurs="0" name="return" nillable="true" type="xs:string"/> </xs:sequence> </xs:complexType> </xs:element> </xs:schema> </wsdl:types> <wsdl:message name="sayHelloRequest"> <wsdl:part name="parameters" element="ns:sayHello"/> </wsdl:message> <wsdl:message name="sayHelloResponse"> <wsdl:part name="parameters" element="ns:sayHelloResponse"/> </wsdl:message> <wsdl:portType name="SOAPHelloPortType"> <wsdl:operation name="sayHello"> <wsdl:input message="ns:sayHelloRequest" wsaw:Action="urn:sayHello"/> <wsdl:output message="ns:sayHelloResponse" wsaw:Action="urn:sayHelloResponse"/> </wsdl:operation> </wsdl:portType>

    Read the article

  • Filter a form using a command button on another form

    - by Shaun
    I have a form with a cmdbutton that at the moment opens another form and shows all records for several types of PartitionStyles and TrimFinishs (486 at present), I need to be able to filter the second form to show only the TrimFinish I need. Private Sub lbl600SeriesS_Click() Dim stDocName As String Dim stLinkCriteria As String stDocName = "frmModules" stLinkCriteria = "Forms!frmModules![TrimFinish] = 1" DoCmd.OpenForm stDocName, , , stLinkCriteria End Sub At the moment it shows only a new record, I know there should be 162 records using 1, what have I missed or done incorrect.

    Read the article

  • Regular expression to extract text between either square or curly brackets

    - by ObiWanKenobi
    Related to my previous question, I have a string on the following format: this {is} a [sample] string with [some] {special} words. [another one] What is the regular expression to extract the words within either square or curly brackets, ie. {is} [sample] [some] {special} [another one] Note: In my use case, brackets cannot be nested. I would also like to keep the enclosing characters, so that I can tell the difference between them when processing the results.

    Read the article

< Previous Page | 552 553 554 555 556 557 558 559 560 561 562 563  | Next Page >