Search Results

Search found 14936 results on 598 pages for 'format conversion'.

Page 557/598 | < Previous Page | 553 554 555 556 557 558 559 560 561 562 563 564  | Next Page >

  • Selecting the contents of an ASP.NET TextBox in an UpdatePanel after a partial page postback

    - by Scott Mitchell
    I am having problems selecting the text within a TextBox in an UpdatePanel. Consider a very simple page that contains a single UpdatePanel. Within that UpdatePanel there are two Web controls: A DropDownList with three statically-defined list items, whose AutoPostBack property is set to True, and A TextBox Web control The DropDownList has a server-side event handler for its SelectedIndexChanged event, and in that event handler there's two lines of code: TextBox1.Text = "Whatever"; ScriptManager.RegisterStartupScript(this, this.GetType(), "Select-" + TextBox1.ClientID, string.Format("document.getElementById('{0}').select();", TextBox1.ClientID), true); The idea is that whenever a user chooses and item from the DropDownList there is a partial page postback, at which point the TextBox's Text property is set and selected (via the injected JavaScript). Unfortunately, this doesn't work as-is. (I have also tried putting the script in the pageLoad function with no luck, as in: ScriptManager.RegisterStartupScript(..., "function pageLoad() { ... my script ... }");) What happens is the code runs, but something else on the page receives focus at the conclusion of the partial page postback, causing the TextBox's text to be unselected. I can "fix" this by using JavaScript's setTimeout to delay the execution of my JavaScript code. For instance, if I update the emitted JavaScript to the following: setTimeout("document.getElementById('{0}').select();", 111); It "works." I put works in quotes because it works for this simple page on my computer. In a more complex page on a slower computer with more markup getting passed between the client and server on the partial page postback, I have to up the timeout to over a second to get it to work. I would hope that there is a more foolproof way to achieve this. Rather than saying, "Delay for X milliseconds," it would be ideal to say, "Run this when you're not going to steal the focus." What's perplexing is that the .Focus() method works beautifully. That is, if I scrap my JavaScript and replace it with a call to TextBox1.Focus(); then the TextBox receives focus (although the text is not selected). I've examined the contents of MicrosoftAjaxWebForms.js and see that the focus is set after the registered scripts run, but I'm my JavaScript skills are not strong enough to decode what all is happening here and why the selected text is unselected between the time it is selected and the end of the partial page postback. I've also tried using Firebug's JavaScript debugger and see that when my script runs the TextBox's text is selected. As I continue to step through it the text remains selected, but then after stepping off the last line of script (apparently) it all of the sudden gets unselected. Any ideas? I am pulling my hair out. Thanks in advance...

    Read the article

  • Parallel Task Library WaitAny Design

    - by colithium
    I've just begun to explore the PTL and have a design question. My Scenario: I have a list of URLs that each refer to an image. I want each image to be downloaded in parallel. As soon as at least one image is downloaded, I want to execute a method that does something with the downloaded image. That method should NOT be parallelized -- it should be serial. I think the following will work but I'm not sure if this is the right way to do it. Because I have separate classes for collecting the images and for doing "something" with the collected images, I end up passing around an array of Tasks which seems wrong since it exposes the inner workings of how images are retrieved. But I don't know a way around it. In reality there is more to both of these methods but that's not important for this. Just know that they really shouldn't be lumped into one large method that both retrieves and does something with the image. Task<Image>[] downloadTasks = collector.RetrieveImages(listOfURLs); for (int i = 0; i < listOfURLs.Count; i++) { //Wait for any of the remaining downloads to complete int completedIndex = Task<Image>.WaitAny(downloadTasks); Image completedImage = downloadTasks[completedIndex].Result; //Now do something with the image (this "something" must happen serially) } /////////////////////////////////////////////////// public Task<Image>[] RetrieveImages(List<string> urls) { Task<Image>[] tasks = new Task<Image>[urls.Count]; int index = 0; foreach (string url in urls) { string lambdaVar = url; //Required... Bleh tasks[index] = Task<Image>.Factory.StartNew(() => { using (WebClient client = new WebClient()) { //TODO: Replace with live image locations string fileName = String.Format("{0}.png", i); client.DownloadFile(lambdaVar, Path.Combine(Application.StartupPath, fileName)); } return Image.FromFile(Path.Combine(Application.StartupPath, fileName)); }, TaskCreationOptions.LongRunning | TaskCreationOptions.AttachedToParent); index++; } return tasks; }

    Read the article

  • How to stream semi-live audio over internet

    - by Thomas Tempelmann
    I want to write something like Skype, i.e. I have a constant audio stream on one computer and then recompress it in a format that's suitable for a latent internet connection, receive it on the other end and play it. Let's also assume that the internet connection is fairly modern and fast, i.e. DSL or alike, no slow connections over phone and such. The involved computers will also be rather modern (Dual Core Intel CPUs at 2GHz or more). I know how to handle the audio on the machines. What I don't know is how to transmit the audio in an efficient way. The challenges are: I'd like get good audio quality across the line. The stream should be received without drops. The stream may, however, be received with a little delay (a second delay is acceptable). I imagine that the transport software could first determine the average (and max) latency, then start the stream and tell the receiver to wait for that max latency before starting to play the audio. With that, if the latency doesn't get any higher, the entire stream will be playable on the other side without stutter or drops. If, due to unexpected IP latencies or blockages, the stream does get cut off, I want to be able to notice this so that I can take actions (e.g. abort the stream) and eventually start a new transmission. What are my options if I want do use ready-made software for the compression and tranmission? I have no intention to write my own audio compression engine, really. OTOH, I plan to sell the solution in a vertical market, meaning I can afford a few dollars of license fees per copy, but not $100s. I guess the simplest solution would be to just open a TCP stream, send a few packets back and forth to determine their running time (or even use UDP for that), then use the results as the guide for my max latency value, then simply fire the audio data in its raw form (uncompressed 16 bit stereo), along with a timing code over the TCP connection. The receiver reads the data and plays it with the pre-determined delay. That might just work with the type of fast connection I expect. I just wonder if there are better solutions to reach this goal, with better performance (lower latency) and less data (compressed). BTW, I first try to implement this on OS X, but might want to do it on Windows, too, if it proves successful.

    Read the article

  • clarification on the concept of "web service"

    - by udit
    Im a little confused on the varying definitions and implementations of web services available as implementations. Need some clarification please. Ones I have used till now: If a vendor gives me a specific format of XML that I can send populated with data to request and I make a simple HTTP POST over the internet passing in the XML String as the payload, is this a web service call ? If so, is there a specific name to it, this kind of web service ? Because obviously, it does not use anything like Axis, WSDL or SOAP to establish this connection. A variant of this is If the vendor gives me an XSD, I use JAXB to make a java class out of it and pass in the serialized version of the object, which eventually works out to be the same as option 1. RESTful web service: Vendor gives me a URL like http://restfulservice/products and I can make HTTP Requests to the URL and depending on what HTTP verb I use, the appropropriate action is called and the response sent over the wire. Ones I have only read about\ have a vague idea about SOAP. How does this work?.. Ive read the W3Schools tutorial and I undertsand that there is a very specific form of XML that is standardized according to W3C standards that we use to pass the same kind of messages as we did in option 1. But how does this work in real life? Vendor sends me what? Do I generate classes? Do I serialize some objects and http post them over to an address? Or do the generated objects themselves have connection methods that will do them for me? What about WSDL? When does a vendor send me WSDL and what do I do with it ? I guess I can generate classes from it. If yes, then what do I do with the generated classes ? When do I need that axis jar to generate classes from something that the vendor sends ? As you can see, I have some clear and other mostly vague ideas about the different kinds of web services available. would help if someone ould clarify and\or point to more real-world resources. I've looked a little bit into Java Web Services on the internet and the numerous four letter acronyms that get thrown at me make me dizzy. Thanks

    Read the article

  • Running a graph returns E_FAIL

    - by Manish
    Hi, I have been struggling for a while now to get my filter graph to run .I am trying to crop a .wmv file into smaller duration .wmv files .It looks quite a simple task I dont know why its is getting so complicated.I follow this Source- SampleGrabber-WMA sf writer. Here is my code IBaseFilter* pASFWriter; ICaptureGraphBuilder2 * pBuilder=NULL; CoCreateInstance(CLSID_CaptureGraphBuilder2,NULL,CLSCTX_INPROC_SERVER,IID_ICaptureGraphBuilder2,(LPVOID*)&pBuilder); pBuilder-SetFiltergraph(pGraphBuilder); pBuilder-SetOutputFileName(&MEDIASUBTYPE_Asf,OUTFILE,&pASFWriter,NULL); IConfigAsfWriter *pConfig=NULL; HRESULT hr80 = pASFWriter-QueryInterface(IID_IConfigAsfWriter, (void**)&pConfig); if (SUCCEEDED(hr80)) { // Configure the ASF Writer filter. pConfig-Release(); } IBaseFilter *pSource=NULL; pGraphBuilder->AddSourceFilter(FILENAME,L"Source",&pSource); IBaseFilter *pGrabberF2=NULL; ISampleGrabber *pGrabber2=NULL; CoCreateInstance(CLSID_SampleGrabber,NULL,CLSCTX_INPROC_SERVER,IID_PPV_ARGS(&pGrabberF2)); pGraphBuilder->AddFilter(pGrabberF2,L"Sample Grabber2"); AM_MEDIA_TYPE mt1; ZeroMemory(&mt1,sizeof(mt1)); mt1.majortype=MEDIATYPE_Video; mt1.subtype=MEDIASUBTYPE_RGB24; pGrabberF2->QueryInterface(IID_ISampleGrabber,(void**)(&pGrabber2)); pGrabber2->SetBufferSamples(TRUE); pGrabber2->SetOneShot(FALSE); pGrabber->SetMediaType(&mt1); pSource->EnumPins(&pEnum2); pEnum2->Next(1,&pPin2,NULL); HRESULT hr108=ConnectFilters(pGraphBuilder,pPin2,pGrabberF2);//Source to Grabber pGrabberF2->EnumPins(&pEnum3); IEnumPins *pEnum4=NULL; pASFWriter->EnumPins(&pEnum4); IPin* pPin4=NULL; while (S_OK==pEnum3->Next(1,&pPin3,NULL)&& S_OK==pEnum4->Next(1,&pPin4,NULL)){ pGraphBuilder->Connect(pPin3,pPin4);//Grabber to FileWriter } pGraphBuilder->RenderFile(FILENAME,NULL);//FILENAME=INPUTFILENAME (.wmv format) pMediaPosition->put_CurrentPosition(start); pMediaPosition->put_StopTime(stop); HRESULT test1=pMediaControl->Run(); All of it runs fine(returns S_OK) .But test1 returns E_FAIL and no file is created.Can somebody help?

    Read the article

  • Programmatically created GridView cells don't scale to fit screen

    - by ChrisAshton84
    I've read a ton of other responses about GridView already but almost all deal with the XML format (which I had working). I wanted to learn the programmatic way of designing Android, though, so I'm trying to build most of this app without XML. All I define in XML are the GridView and the first TextView. After that I add the other LinearLayouts in onCreate(). I would like to have a 2 column GridView containing a title and several (4 for now) LinearLayouts. I realize from documentation that the GridView won't scale cells unless they have a gravity set, but no matter how I try to do this I can't get it to work. After adding two cells, my GridView tree would look like: GridView -> TextView (colspan 2) -> LinearLayout (Vertical) -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Vertical) -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView -> LinearLayout (Horizontal) -> TextView -> TextView I've tried about every combination of FILL and FILL_HORIZONTAL I could think of on either the outermost LinearLayouts, or also trying on the TextViews and inner LinearLayouts. No matter what I do, the LinearLayouts I add are always sized as small as possible and pushed to the left of the screen. Meanwhile, the first TextView (the colspan 2 one) with only CENTER_HORIZONTAL set is correctly centered in the screen. Its as if that TextView gets one idea of the column widths and the LinearLayouts get another! (If I add the FILL Gravity for it, it also moves all the way left.) I believe I had this working accidentally with 100% XML, but I would prefer not to switch back unless this is known to not work programatically. Any ideas what I can try to get this working?

    Read the article

  • Need help helping in converting jquery, ajax, json and asp.net

    - by Haja Mohaideen
    I am tying out this tutorial, http://www.ezzylearning.com/tutorial.aspx?tid=5869127. It works perfectly. What I am now trying to do is to host the aspx contents as html file. This html file is hosted on my wampserver which is on my laptop. The asp.net code hosted on my test server. When I try to access, I get the following error, Resource interpreted as Script but transferred with MIME type text/html: "http://201.x.x.x/testAjax/Default.aspx/AddProductToCart?callback=jQuery17103264484549872577_1346923699990&{%20pID:%20%226765%22,%20qty:%20%22100%22,%20lblType:%20%2220%22%20}&_=1346923704482". jquery.min.js:4 Uncaught SyntaxError: Unexpected token < I am not sure how to solve this problem. index.html code $(function () { $('#btnAddToCart').click(function () { var result = $.ajax({ type: "POST", url: "http://202.161.45.124/testAjax/Default.aspx/AddProductToCart", crossDomain: true, data: '{ pID: "6765", qty: "100", lblType: "20" }', contentType: "application/json; charset=utf-8", dataType: "jsonp", success: succeeded, failure: function (msg) { alert(msg); }, error: function (xhr, err) { alert(err); } }); }); }); function succeeded(msg) { alert(msg.d); } function btnAddToCart_onclick() { } </script> </head> <body> <form name="form1" method="post"> <div> <input type="button" id="btnAddToCart" onclick="return btnAddToCart_onclick()" value="Button" /> </div> </form> aspx.vb Imports System.Web.Services Imports System.Web.Script.Services <ScriptService()> Public Class WebForm1 Inherits Page Protected Sub Page_Load(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.Load Session("test") = "" End Sub <WebMethod()> <ScriptMethod(UseHttpGet:=False, ResponseFormat:=ResponseFormat.Json)> Public Shared Function AddProductToCart(pID As String, qty As String, lblType As String) As String Dim selectedProduct As String = String.Format("+ {0} - {1} - {2}", pID, qty, lblType) HttpContext.Current.Session("test") += selectedProduct Return HttpContext.Current.Session("test").ToString() End Function End Class

    Read the article

  • Paging & Sorting grids with ASP.Net MVC

    - by Scott Ivey
    I'm new to MVC, and am not following how you'd do paging and sorting on a grid. I'm used to using the asp.Net GridView control with an ObjectDataSource pointed at objects in our business layer - and in that case the ODS handles all of the paging & sorting using the methods that our ORM generates on the objects. I've looked at using the same ORM with MVC - and things work out fine there - i just loop thru the collections to build the table on the page - but without the ODS to handle the paging & sorting, i'm confused as to how I'd handle that. Would I have a separate controller for the paging and sorting? I'm not sure what the best practices are for this scenario, so if someone can point me in the right direction it would be much appreciated. Edit: Ok, so I understand that I need to roll my own - but where do I start? I've created a CustomerController, and a view that displays a table of customers that looks like below - and I want to sort on FirstName or LastName columns. My Model has a Sort() method on it that'll take a string sort expression in the format that would be used by a GridView/ODS pair. Would I create a new Action on my CustomerController called Sort, and put an ActionLink in my header? <table> <tr> <th> First Name </th> <th> Last Name </th> </tr> <% foreach (var item in Model) { %> <tr> <td> <%= Html.Encode(item.FirstName) %> </td> <td> <%= Html.Encode(item.LastName) %> </td> </tr> <% } %> </table>

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

  • Activity gets killed while executing the camera intent

    - by BlackRider
    In my app I call the system camera to take a picture, and then handle the result in onActivityResult. You know, the usual. It used to work, but now my calling activity gets killed while I'm taking the picture. Specifically, onDestroy() is called on my activity right after I press the camera shutter. The photo does get taken & saved (I've checked that the file gets written on the SD card). After I accept the photo, instead of returning to the calling activity and invoking onActivityResult, the previous activity in the activity stack gets called. I see no exceptions in the logcat. My custom exception handler doesn't get called. If it matters, my app also includes a service that listens to GPS updates, but I unregister all the receivers in onPause(). Here's the call stack for MyCallingActivity.onDestroy(): Thread [<1> main] (Suspended (breakpoint at line 303 in NewPlaceDetailsActivity)) NewPlaceDetailsActivity.onDestroy() line: 303 ActivityThread.performDestroyActivity(IBinder, boolean, int, boolean) line: 2663 ActivityThread.handleDestroyActivity(IBinder, boolean, int, boolean) line: 2694 ActivityThread.access$2100(ActivityThread, IBinder, boolean, int, boolean) line: 117 BinderProxy(ActivityThread$H).handleMessage(Message) line: 968 ActivityThread$H(Handler).dispatchMessage(Message) line: 99 Looper.loop() line: 130 ActivityThread.main(String[]) line: 3687 Method.invokeNative(Object, Object[], Class, Class[], Class, int, boolean) line: not available [native method] Method.invoke(Object, Object...) line: 507 ZygoteInit$MethodAndArgsCaller.run() line: 842 ZygoteInit.main(String[]) line: 600 NativeStart.main(String[]) line: not available [native method] This is how I start the camera activity, in case you're wondering: protected void startCamera() { createPhotoDirsIfNeeded(); String fileName = "temp.jpg"; ContentValues values = new ContentValues(); values.put(MediaStore.Images.Media.TITLE, fileName); m_capturedImageUri = getContentResolver().insert(MediaStore.Images.Media.EXTERNAL_CONTENT_URI, values); m_photoFileName = APP_PHOTO_PATH + "/" + DateFormat.format(DATE_FORMAT, Calendar.getInstance().getTime()) + ".jpg"; File picFile = new File(m_photoFileName); if(picFile.exists()) { picFile.delete(); } // start the camera activity Intent intent = new Intent(MediaStore.ACTION_IMAGE_CAPTURE); intent.putExtra(MediaStore.EXTRA_OUTPUT, Uri.fromFile(picFile)); startActivityForResult(intent, IntentHelper.REQUEST_TAKE_PHOTO); } How can I find out why does my activity get killed, AND removed from the stack instead of being created again?

    Read the article

  • Is "Systems Designer" the job title that best describes what I do? [closed]

    - by ivo-rossi
    After having worked as Java developer for almost 3 years in the same company that I currently work at, I moved to a new position associated with the development of the same application. I’m in this new position for more than 1 year now. My official job title is Systems Designer, but I’m not sure this is a title that expresses well what I do. So my question here is what would be the most appropriate job title for me? I see this question as important for my career development. After all, I should be able to explain in one word what I do. And it’s no longer “Java Developer”. Well, in more than one word, this is what I do: The business analysts gather requirements / business problems to be solved with the clients and then discuss these requirements with me. Given the requirements, I design the high level solutions to be implemented in our system (e.g. a new screen on the client application, modifications to existing reports, extension to the XML export format of some objects, etc). I base my decision on the current capabilities of the system, the overall impact that the solutions would have on the system and the estimated effort to implement them (as I was a developer of this same application for almost 3 years before I moved to this position, I’m confident in my estimates). The solutions are discussed iteratively with the business analysts until we agree that they are good. The outcome of this analysis is what we call the “requirements design” document, which is written by me, shared with clients for approval and then also with the team that is going to implement the solutions and test them. Note that there are a few problems that I need to find a solution for that are non-functional. If the users are unhappy with the performance of a certain tool, I will investigate what can be done to speed it up. I will do some research – often based in the Java code itself - to identify possibilities of optimizations. But in this new position I no longer code, the main outcome of my work is really the “requirements design”. Is “Systems Designer” really the most appropriate job title?

    Read the article

  • Create a timer countdown using hours, minutes & seconds from a future date

    - by Tommy Coffee
    I am using some code I found on the internet that creates a countdown from a certain date. I am trying to edit the code so that it only gives me a countdown from an hour, minute, and second that I specify from a future date. I cannot just have code that counts down from a specified time, I need it to countdown to a specified date in the future. This is important so that if the browser is refreshed the countdown doesn't start over but continues where left off. I will be using cookies so the browser remembers what future date was specified when it was first run. Here is the HTML: <form name="count"> <input type="text" size="69" name="count2"> </form> And here is the javascript: window.onload = function() { //change the text below to reflect your own, var montharray=new Array("Jan","Feb","Mar","Apr","May","Jun","Jul","Aug","Sep","Oct","Nov","Dec") function countdown(yr,m,d){ var theyear=yr; var themonth=m; var theday=d var today=new Date() var todayy=today.getYear() if (todayy < 1000) todayy+=1900; var todaym=today.getMonth() var todayd=today.getDate() var todayh=today.getHours() var todaymin=today.getMinutes() var todaysec=today.getSeconds() var todaystring=montharray[todaym]+" "+todayd+", "+todayy+" "+todayh+":"+todaymin+":"+todaysec futurestring=montharray[m-1]+" "+d+", "+yr var dd=Date.parse(futurestring)-Date.parse(todaystring) var dday=Math.floor(dd/(60*60*1000*24)*1) var dhour=Math.floor((dd%(60*60*1000*24))/(60*60*1000)*1) var dmin=Math.floor(((dd%(60*60*1000*24))%(60*60*1000))/(60*1000)*1) var dsec=Math.floor((((dd%(60*60*1000*24))%(60*60*1000))%(60*1000))/1000*1) if(dday==0&&dhour==0&&dmin==0&&dsec==1){ document.forms.count.count2.value=current return } else document.forms.count.count2.value= dhour+":"+dmin+":"+dsec; setTimeout(function() {countdown(theyear,themonth,theday)},1000) } //enter the count down date using the format year/month/day countdown(2012,12,25) } I am sure there is superfluous code above since I only need an hour, minute, and second that I would like to pass to the countdown() function. The year, month and day is unimportant but as I said this is code I am trying to edit which I found on the internet. Any help would be very appreciated. Thank you!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to make negate_unary work with any type?

    - by Chan
    Hi, Following this question: How to negate a predicate function using operator ! in C++? I want to create an operator ! can work with any functor that inherited from unary_function. I tried: template<typename T> inline std::unary_negate<T> operator !( const T& pred ) { return std::not1( pred ); } The compiler complained: Error 5 error C2955: 'std::unary_function' : use of class template requires template argument list c:\program files\microsoft visual studio 10.0\vc\include\xfunctional 223 1 Graphic Error 7 error C2451: conditional expression of type 'std::unary_negate<_Fn1>' is illegal c:\program files\microsoft visual studio 10.0\vc\include\ostream 529 1 Graphic Error 3 error C2146: syntax error : missing ',' before identifier 'argument_type' c:\program files\microsoft visual studio 10.0\vc\include\xfunctional 222 1 Graphic Error 4 error C2065: 'argument_type' : undeclared identifier c:\program files\microsoft visual studio 10.0\vc\include\xfunctional 222 1 Graphic Error 2 error C2039: 'argument_type' : is not a member of 'std::basic_ostream<_Elem,_Traits>::sentry' c:\program files\microsoft visual studio 10.0\vc\include\xfunctional 222 1 Graphic Error 6 error C2039: 'argument_type' : is not a member of 'std::basic_ostream<_Elem,_Traits>::sentry' c:\program files\microsoft visual studio 10.0\vc\include\xfunctional 230 1 Graphic Any idea? Update Follow "templatetypedef" solution, I got new error: Error 3 error C2831: 'operator !' cannot have default parameters c:\visual studio 2010 projects\graphic\graphic\main.cpp 39 1 Graphic Error 2 error C2808: unary 'operator !' has too many formal parameters c:\visual studio 2010 projects\graphic\graphic\main.cpp 39 1 Graphic Error 4 error C2675: unary '!' : 'is_prime' does not define this operator or a conversion to a type acceptable to the predefined operator c:\visual studio 2010 projects\graphic\graphic\main.cpp 52 1 Graphic Update 1 Complete code: #include <iostream> #include <functional> #include <utility> #include <cmath> #include <algorithm> #include <iterator> #include <string> #include <boost/assign.hpp> #include <boost/assign/std/vector.hpp> #include <boost/assign/std/map.hpp> #include <boost/assign/std/set.hpp> #include <boost/assign/std/list.hpp> #include <boost/assign/std/stack.hpp> #include <boost/assign/std/deque.hpp> struct is_prime : std::unary_function<int, bool> { bool operator()( int n ) const { if( n < 2 ) return 0; if( n == 2 || n == 3 ) return 1; if( n % 2 == 0 || n % 3 == 0 ) return 0; int upper_bound = std::sqrt( static_cast<double>( n ) ); for( int pf = 5, step = 2; pf <= upper_bound; ) { if( n % pf == 0 ) return 0; pf += step; step = 6 - step; } return 1; } }; /* template<typename T> inline std::unary_negate<T> operator !( const T& pred, typename T::argument_type* dummy = 0 ) { return std::not1<T>( pred ); } */ inline std::unary_negate<is_prime> operator !( const is_prime& pred ) { return std::not1( pred ); } template<typename T> inline void print_con( const T& con, const std::string& ms = "", const std::string& sep = ", " ) { std::cout << ms << '\n'; std::copy( con.begin(), con.end(), std::ostream_iterator<typename T::value_type>( std::cout, sep.c_str() ) ); std::cout << "\n\n"; } int main() { using namespace boost::assign; std::vector<int> nums; nums += 1, 3, 5, 7, 9; nums.erase( remove_if( nums.begin(), nums.end(), !is_prime() ), nums.end() ); print_con( nums, "After remove all primes" ); } Thanks, Chan Nguyen

    Read the article

  • How do I do distributed UML development (à la FOSS)?

    - by James A. Rosen
    I have a UML project (built in IBM's Rational System Architect/Modeler, so stored in their XML format) that has grown quite large. Additionally, it now contains several pieces that other groups would like to re-use. I come from a software development (especially FOSS) background, and am trying to understand how to use that as an analogy here. The problem I am grappling with is similar to the Fragile Base Class problem. Let me start with how it works in an object-oriented (say, Java or Ruby) FOSS ecosystem: Group 1 publishes some "core" package, say "net/smtp version 1.0" Group 2 includes Group 1's net/smtp 1.0 package in the vendor library of their software project At some point, Group 1 creates a new 2.0 branch of net/smtp that breaks backwards compatibility (say, it removes an old class or method, or moves a class from one package to another). They tell users of the 1.0 version that it will be deprecated in one year. Group 2, when they have the time, updates to net/smtp 2.0. When they drop in the new package, their compiler (or test suite, for Ruby) tells them about the incompatibility. They do have to make some manual changes, but all of the changes are in the code, in plain text, a medium with which they are quite familiar. Plus, they can often use their IDE's (or text editor's) "global-search-and-replace" function once they figure out what the fixes are. When we try to apply this model to UML in RSA, we run into some problems. RSA supports some fairly powerful refactorings, but they seem to only work if you have write access to all of the pieces. If I rename a class in one package, RSA can rename the references, but only at the same time. It's very difficult to look at the underlying source (the XML) and figure out what's broken. To fix such a problem in the RSA editor itself means tons of clicking on things -- there is no good equivalent of "global-search-and-replace," at least not after an incomplete refactor. They real sticking point seems to be that RSA assumes that you want to do all your editing using their GUI, but that makes certain operations prohibitively difficult. Does anyone have examples of open-source UML projects that have overcome this problem? What strategies do they use for communicating changes?

    Read the article

  • using LoadControl with object initializer to create properties

    - by lloydphillips
    In the past I've used UserControls to create email templates which I can fill properties on and then use LoadControl and then RenderControl to get the html for which to use for the body text of my email. This was within asp.net webforms. I'm in the throws of building an mvc website and wanted to do something similar. I've actually considered putting this functionality in a seperate class library and am looking into how I can do this so that in my web layer I can just call EmailTemplate.SubscriptionEmail() which will then generate the html from my template with properties in relevant places (obviously there needs to be parameters for email address etc in there). I wanted to create a single Render control method for which I can pass a string to the path of the UserControl which is my template. I've come across this on the web that kind of suits my needs: public static string RenderUserControl(string path, string propertyName, object propertyValue) { Page pageHolder = new Page(); UserControl viewControl = (UserControl)pageHolder.LoadControl(path); if (propertyValue != null) { Type viewControlType = viewControl.GetType(); PropertyInfo property = viewControlType.GetProperty(propertyName); if (property != null) property.SetValue(viewControl, propertyValue, null); else { throw new Exception(string.Format( "UserControl: {0} does not have a public {1} property.", path, propertyName)); } } pageHolder.Controls.Add(viewControl); StringWriter output = new StringWriter(); HttpContext.Current.Server.Execute(pageHolder, output, false); return output.ToString(); } My issue is that my UserControl(s) may have multiple and differing properties. So SubscribeEmail may require FirstName and EmailAddress where another email template UserControl (lets call it DummyEmail) would require FirstName, EmailAddress and DateOfBirth. The method above only appears to carry one parameter for propertyName and propertyValue. I considered an array of strings that I could put the varying properties into but then I thought it'd be cool to have an object intialiser so I could call the method like this: RenderUserControl("EmailTemplates/SubscribeEmail.ascs", new object() { Firstname="Lloyd", Email="[email protected]" }) Does that make sense? I was just wondering if this is at all possible in the first place and how I'd implement it? I'm not sure if it would be possible to map the properties set on 'object' to properties on the loaded user control and if it is possible where to start in doing this? Has anyone done something like this before? Can anyone help? Lloyd

    Read the article

  • disable dates using jquery inside gridview control

    - by bladerunner
    Hi there, I have a gridview which contains a textbox control. I need to show the calendar for the user to pick the date and certain dates are to be disabled using jquery. I found a post on stackoverflow that talked about how to disable certain dates. I am done with that part, except not sure how to pass the textbox control to this jquery function. Here is the code. <script type="text/javascript" language="javascript"> function pageLoad(sender, args) { var enabledDays = ['09/21/2011', '10/05/2011', '10/19/2011', '11/02/2011', '11/16/2011']; /* utility functions */ function editDays(date) { for (var i = 0; i < enabledDays.length; i++) { if (new Date(enabledDays[i]).toString() == date.toString()) { return [true]; } } return [false]; } /* create datepicker */ $(document).ready(function() { $('#<%= txtInHomeDate.ClientID %>').datepicker({ beforeShow: springDate, beforeShowDay: editDays, dateFormat: 'mm/dd/yy', buttonImage: 'images/cal.gif', buttonText: 'Choose date', firstDay: 1, buttonImageOnly: true, showOn: 'both', showAnim: 'fadeIn', onSelect: function() { $(this).trigger("onchange", null); } }); function springDate() { var defaultMin = new Date(); var defaultMax = new Date(); var Min = defaultMin; var Max = defaultMax; // make valid date from hiddenfied value format is MM/dd/yyyy dateMin = $('#<%= hfStDate.ClientID %>').val(); dateMin = new Date(dateMin); dateMax = $('#<%= hfEndDate.ClientID %>').val(); dateMax = new Date(dateMax); if (dateMin && dateMax) { Min = new Date(dateMin.getFullYear(), dateMin.getMonth(), dateMin.getDate()); Max = new Date(dateMax.getFullYear(), dateMax.getMonth(), dateMax.getDate()); } return { minDate: Min, maxDate: Max }; } }); } <.... <asp:TemplateField HeaderText="In-Home Date"> <ItemStyle HorizontalAlign="Center" /> <ItemTemplate> <asp:HiddenField ID="hfStDate" runat="server" Value="09/01/2011" /> <asp:HiddenField ID="hfEndDate" runat="server" Value="11/30/2011" /> <asp:TextBox ID="txtInHomeDate" runat="server" /> </ItemTemplate> </asp:TemplateField> Currently, it errors out since the jquery function won't find the txtInHomeDate. Could I get some help as I am pretty close to get this done? Thanks!!

    Read the article

  • basic operations for modifying a source document with XSLT

    - by SpliFF
    All the tutorials and examples I've found of XSLT processing seem to assume your destination will be a significantly different format/structure to your source and that you know the structure of the source in advance. I'm struggling with finding out how to perform simple "in-place" modifications to a HTML document without knowing anything else about its existing structure. Could somebody show me a clear example that, given an arbitrary unknown HTML source will: 1.) delete the classname 'foo' from all divs 2.) delete a node if its empty (ie <p></p>) 3.) delete a <p> node if its first child is <br> 4.) add newattr="newvalue" to all H1 5.) replace 'heading' in text nodes with 'title' 6.) wrap all <u> tags in <b> tags (ie, <u>foo</u> -> <b><u>foo</u></b>) 7.) output the transformed document without changing anything else The above examples are the primary types of transform I wish to accomplish. Understanding how to do the above will go a long way towards helping me build more complex transforms. To help clarify/test the examples here is a sample source and output, however I must reiterate that I want to work with arbitrary samples without rewriting the XSLT for each source: <!doctype html> <html> <body> <h1>heading</h1> <p></p> <p><br>line</p> <div class="foo bar"><u>baz</u></div> <p>untouched</p> </body> </html> output: <!doctype html> <html> <body> <h1 newattr="newvalue">title</h1> <div class="bar"><b><u>baz</u></b></div> <p>untouched</p> </body> </html>

    Read the article

  • How to convert m4a file to aac adts file in Xcode?

    - by Bird Hsuie
    I have a mp4 file copied from iPod lib and saved to my Document for my next step, I need it to convert to .mp3 or .aac(ADTS type) I use this code and failed... -(IBAction)compressFile:(id)sender{ NSLog (@"handleConvertToPCMTapped"); // open an ExtAudioFile NSLog (@"opening %@", exportURL); ExtAudioFileRef inputFile; CheckResult (ExtAudioFileOpenURL((__bridge CFURLRef)exportURL, &inputFile), "ExtAudioFileOpenURL failed"); // prepare to convert to a plain ol' PCM format AudioStreamBasicDescription myPCMFormat; myPCMFormat.mSampleRate = 44100; // todo: or use source rate? myPCMFormat.mFormatID = kAudioFormatMPEGLayer3 ; myPCMFormat.mFormatFlags = kAudioFormatFlagsCanonical; myPCMFormat.mChannelsPerFrame = 2; myPCMFormat.mFramesPerPacket = 1; myPCMFormat.mBitsPerChannel = 16; myPCMFormat.mBytesPerPacket = 4; myPCMFormat.mBytesPerFrame = 4; CheckResult (ExtAudioFileSetProperty(inputFile, kExtAudioFileProperty_ClientDataFormat, sizeof (myPCMFormat), &myPCMFormat), "ExtAudioFileSetProperty failed"); // allocate a big buffer. size can be arbitrary for ExtAudioFile. // you have 64 KB to spare, right? UInt32 outputBufferSize = 0x10000; void* ioBuf = malloc (outputBufferSize); UInt32 sizePerPacket = myPCMFormat.mBytesPerPacket; UInt32 packetsPerBuffer = outputBufferSize / sizePerPacket; // set up output file NSString *outputPath = [myDocumentsDirectory() stringByAppendingPathComponent:@"m_export.mp3"]; NSURL *outputURL = [NSURL fileURLWithPath:outputPath]; NSLog (@"creating output file %@", outputURL); AudioFileID outputFile; CheckResult(AudioFileCreateWithURL((__bridge CFURLRef)outputURL, kAudioFileCAFType, &myPCMFormat, kAudioFileFlags_EraseFile, &outputFile), "AudioFileCreateWithURL failed"); // start convertin' UInt32 outputFilePacketPosition = 0; //in bytes while (true) { // wrap the destination buffer in an AudioBufferList AudioBufferList convertedData; convertedData.mNumberBuffers = 1; convertedData.mBuffers[0].mNumberChannels = myPCMFormat.mChannelsPerFrame; convertedData.mBuffers[0].mDataByteSize = outputBufferSize; convertedData.mBuffers[0].mData = ioBuf; UInt32 frameCount = packetsPerBuffer; // read from the extaudiofile CheckResult (ExtAudioFileRead(inputFile, &frameCount, &convertedData), "Couldn't read from input file"); if (frameCount == 0) { printf ("done reading from file"); break; } // write the converted data to the output file CheckResult (AudioFileWritePackets(outputFile, false, frameCount, NULL, outputFilePacketPosition / myPCMFormat.mBytesPerPacket, &frameCount, convertedData.mBuffers[0].mData), "Couldn't write packets to file"); NSLog (@"Converted %ld bytes", outputFilePacketPosition); // advance the output file write location outputFilePacketPosition += (frameCount * myPCMFormat.mBytesPerPacket); } // clean up ExtAudioFileDispose(inputFile); AudioFileClose(outputFile); // show size in label NSLog (@"checking file at %@", outputPath); [self transMitFile:outputPath]; if ([[NSFileManager defaultManager] fileExistsAtPath:outputPath]) { NSError *fileManagerError = nil; unsigned long long fileSize = [[[NSFileManager defaultManager] attributesOfItemAtPath:outputPath error:&fileManagerError] fileSize]; } any suggestion?.......thanks for your great help!

    Read the article

  • Application error when drawing to SurfaceView

    - by DKDiveDude
    I'm am doing a simple coding attempt trying to draw on a SurfaceView created on my main.xml layout. I can change background color and display an icon fine, but when I try to draw I get an error. I am a newbie so obvious I am missing something, please lent a helping hint, thanks! main.xml <?xml version="1.0" encoding="utf-8"?> <SurfaceView android:id="@+id/Paper" android:layout_height="fill_parent" android:layout_width="fill_parent"> </SurfaceView> and code here; package com.example.SurfaceViewTest; import android.app.Activity; import android.graphics.Bitmap; import android.graphics.Canvas; import android.graphics.Color; import android.graphics.Paint; import android.os.Bundle; import android.view.SurfaceHolder; import android.view.SurfaceView; public class SurfaceViewTest extends Activity implements SurfaceHolder.Callback { private SurfaceView mSurfaceView; private SurfaceHolder mSurfaceHolder; private Paint paint; private Canvas canvas; Bitmap mDrawing; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); mSurfaceView = (SurfaceView) this.findViewById(R.id.Paper); mSurfaceHolder = mSurfaceView.getHolder(); mSurfaceHolder.addCallback(this); mSurfaceHolder.setType(SurfaceHolder.SURFACE_TYPE_PUSH_BUFFERS); } @Override public void surfaceChanged(SurfaceHolder holder, int format, int width, int height) { // TODO Auto-generated method stub } @Override public void surfaceCreated(SurfaceHolder holder) { mSurfaceView.setBackgroundColor(Color.rgb(0, 255, 0)); //mSurfaceView.setBackgroundResource(R.drawable.icon); canvas = holder.lockCanvas(null); mDrawing = Bitmap.createBitmap(100, 100, Bitmap.Config.RGB_565); canvas.setBitmap(mDrawing); paint = new Paint(); paint.setColor(Color.rgb(255, 255,255)); canvas.drawLine(1,1,200,300, paint); holder.unlockCanvasAndPost(canvas); } @Override public void surfaceDestroyed(SurfaceHolder holder) { // TODO Auto-generated method stub } }

    Read the article

  • Optimize slow ranking query

    - by Juan Pablo Califano
    I need to optimize a query for a ranking that is taking forever (the query itself works, but I know it's awful and I've just tried it with a good number of records and it gives a timeout). I'll briefly explain the model. I have 3 tables: player, team and player_team. I have players, that can belong to a team. Obvious as it sounds, players are stored in the player table and teams in team. In my app, each player can switch teams at any time, and a log has to be mantained. However, a player is considered to belong to only one team at a given time. The current team of a player is the last one he's joined. The structure of player and team is not relevant, I think. I have an id column PK in each. In player_team I have: id (PK) player_id (FK -> player.id) team_id (FK -> team.id) Now, each team is assigned a point for each player that has joined. So, now, I want to get a ranking of the first N teams with the biggest number of players. My first idea was to get first the current players from player_team (that is one record top for each player; this record must be the player's current team). I failed to find a simple way to do it (tried GROUP BY player_team.player_id HAVING player_team.id = MAX(player_team.id), but that didn't cut it. I tried a number of querys that didn't work, but managed to get this working. SELECT COUNT(*) AS total, pt.team_id, p.facebook_uid AS owner_uid, t.color FROM player_team pt JOIN player p ON (p.id = pt.player_id) JOIN team t ON (t.id = pt.team_id) WHERE pt.id IN ( SELECT max(J.id) FROM player_team J GROUP BY J.player_id ) GROUP BY pt.team_id ORDER BY total DESC LIMIT 50 As I said, it works but looks very bad and performs worse, so I'm sure there must be a better way to go. Anyone has any ideas for optimizing this? I'm using mysql, by the way. Thanks in advance Adding the explain. (Sorry, not sure how to format it properly) id select_type table type possible_keys key key_len ref rows Extra 1 PRIMARY t ALL PRIMARY NULL NULL NULL 5000 Using temporary; Using filesort 1 PRIMARY pt ref FKplayer_pt77082,FKplayer_pt265938,new_index FKplayer_pt77082 4 t.id 30 Using where 1 PRIMARY p eq_ref PRIMARY PRIMARY 4 pt.player_id 1 2 DEPENDENT SUBQUERY J index NULL new_index 8 NULL 150000 Using index

    Read the article

  • j2me bluetooth client. Function startInquiry nothing found.

    - by Hugi
    I develop simple j2me bluetooth client and have problem with bluetooth device search. Function startInquiry nothing found. Client : nokia 5220 Server : my pc with bluetooth adapter All bluetooth devices is on. /* * To change this template, choose Tools | Templates * and open the template in the editor. */ import javax.microedition.midlet.*; import javax.bluetooth.*; import java.util.Vector; import javax.microedition.lcdui.*; /** * @author ????????????? */ public class Midlet extends MIDlet implements DiscoveryListener { private static Vector vecDevices=new Vector(); private static String connectionURL=null; private LocalDevice localDevice; private DiscoveryAgent agent; private RemoteDevice remoteDevice; private RemoteDevice[] devList; private Display display; private Form form; public void startApp() { display = Display.getDisplay(this); form = new Form( "Client" ); try { localDevice = LocalDevice.getLocalDevice(); } catch( BluetoothStateException e ) { e.printStackTrace(); } form.append("Address: "+localDevice.getBluetoothAddress()+"\n\n"); form.append("Name: "+localDevice.getFriendlyName()+"\n\n"); try { agent = localDevice.getLocalDevice().getDiscoveryAgent(); form.append("Starting device inquiry... \n\n"); boolean si = agent.startInquiry(DiscoveryAgent.GIAC, this); if ( si ) { form.append("true"); } else { form.append("false"); } } catch( BluetoothStateException e ) { } int deviceCount = vecDevices.size(); if(deviceCount <= 0){ form.append("No Devices Found ."); } else{ //print bluetooth device addresses and names in the format [ No. address (name) ] form.append("Bluetooth Devices: "); for (int i = 0; i < deviceCount; i++) { remoteDevice=(RemoteDevice)vecDevices.elementAt(i); form.append( remoteDevice.getBluetoothAddress() ); } } display.setCurrent(form); } public void pauseApp() { } public void destroyApp(boolean unconditional) { } public void deviceDiscovered(RemoteDevice btDevice, DeviceClass cod) { //add the device to the vector if(!vecDevices.contains(btDevice)){ vecDevices.addElement(btDevice); } } public void inquiryCompleted(int discType) { } //implement this method since services are not being discovered public void servicesDiscovered(int transID, ServiceRecord[] servRecord) { if(servRecord!=null && servRecord.length>0){ connectionURL=servRecord[0].getConnectionURL(0,false); } } //implement this method since services are not being discovered public void serviceSearchCompleted(int transID, int respCode) { } }

    Read the article

  • Generating Unordered List with PHP + CodeIgniter from a MySQL Database

    - by Tim
    Hello Everyone, I am trying to build a dynamically generated unordered list in the following format using PHP. I am using CodeIgniter but it can just be normal php. This is the end output I need to achieve. <ul id="categories" class="menu"> <li rel="1"> Arts &amp; Humanities <ul> <li rel="2"> Photography <ul> <li rel="3"> 3D </li> <li rel="4"> Digital </li> </ul> </li> <li rel="5"> History </li> <li rel="6"> Literature </li> </ul> </li> <li rel="7"> Business &amp; Economy </li> <li rel="8"> Computers &amp; Internet </li> <li rel="9"> Education </li> <li rel="11"> Entertainment <ul> <li rel="12"> Movies </li> <li rel="13"> TV Shows </li> <li rel="14"> Music </li> <li rel="15"> Humor </li> </ul> </li> <li rel="10"> Health </li> And here is my SQL that I have to work with. -- -- Table structure for table `categories` -- CREATE TABLE IF NOT EXISTS `categories` ( `id` mediumint(8) NOT NULL auto_increment, `dd_id` mediumint(8) NOT NULL, `parent_id` mediumint(8) NOT NULL, `cat_name` varchar(256) NOT NULL, `cat_order` smallint(4) NOT NULL, PRIMARY KEY (`id`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=1 ; So I know that I am going to need at least 1 foreach loop to generate the first level of categories. What I don't know is how to iterate inside each loop and check for parents and do that in a dynamic way so that there could be an endless tree of children. Thanks for any help you can offer. Tim

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • Why do I get a WCF timeout even though my service call and callback are successful?

    - by KallDrexx
    I'm playing around with hooking up an in-game console to a WCF interface, so an external application can send console commands and receive console output. To accomplish this I created the following service contracts: public interface IConsoleNetworkCallbacks { [OperationContract(IsOneWay = true)] void NewOutput(IEnumerable<string> text, string category); } [ServiceContract(SessionMode = SessionMode.Required, CallbackContract = typeof(IConsoleNetworkCallbacks))] public interface IConsoleInterface { [OperationContract] void ProcessInput(string input); [OperationContract] void ChangeCategory(string category); } On the server I implemented it with: public class ConsoleNetworkInterface : IConsoleInterface, IDisposable { public ConsoleNetworkInterface() { ConsoleManager.Instance.RegisterOutputUpdateHandler(OutputHandler); } public void Dispose() { ConsoleManager.Instance.UnregisterOutputHandler(OutputHandler); } public void ProcessInput(string input) { ConsoleManager.Instance.ProcessInput(input); } public void ChangeCategory(string category) { ConsoleManager.Instance.UnregisterOutputHandler(OutputHandler); ConsoleManager.Instance.RegisterOutputUpdateHandler(OutputHandler, category); } protected void OutputHandler(IEnumerable<string> text, string category) { var callbacks = OperationContext.Current.GetCallbackChannel<IConsoleNetworkCallbacks>(); callbacks.NewOutput(text, category); } } On the client I implemented the callback with: public class Callbacks : IConsoleNetworkCallbacks { public void NewOutput(IEnumerable<string> text, string category) { MessageBox.Show(string.Format("{0} lines received for '{1}' category", text.Count(), category)); } } Finally, I establish the service host with the following class: public class ConsoleServiceHost : IDisposable { protected ServiceHost _host; public ConsoleServiceHost() { _host = new ServiceHost(typeof(ConsoleNetworkInterface), new Uri[] { new Uri("net.pipe://localhost") }); _host.AddServiceEndpoint(typeof(IConsoleInterface), new NetNamedPipeBinding(), "FrbConsolePipe"); _host.Open(); } public void Dispose() { _host.Close(); } } and use the following code on my client to establish the connection: protected Callbacks _callbacks; protected IConsoleInterface _proxy; protected void ConnectToConsoleServer() { _callbacks = new Callbacks(); var factory = new DuplexChannelFactory<IConsoleInterface>(_callbacks, new NetNamedPipeBinding(), new EndpointAddress("net.pipe://localhost/FrbConsolePipe")); _proxy = factory.CreateChannel(); _proxy.ProcessInput("Connected"); } So what happens is that my ConnectToConsoleServer() is called and then it gets all the way to _proxy.ProcessInput("Connected");. In my game (on the server) I immediately see the output caused by the ProcessInput call, but the client is still stalled on the _proxy.ProcessInput() call. After a minute my client gets a JIT TimeoutException however at the same time my MessageBox message appears. So obviously not only is my command being sent immediately, my callback is being correctly called. So why am I getting a timeout exception? Note: Even removing the MessageBox call, I still have this issue, so it's not an issue of the GUI blocking the callback response.

    Read the article

< Previous Page | 553 554 555 556 557 558 559 560 561 562 563 564  | Next Page >