Search Results

Search found 37051 results on 1483 pages for 'string matching'.

Page 56/1483 | < Previous Page | 52 53 54 55 56 57 58 59 60 61 62 63  | Next Page >

  • DataContractSerializer truncated string when used with MemoryStream,but works with StringWriter

    - by Michael Freidgeim
    We've used the following DataContractSerializeToXml method for a long time, but recently noticed, that it doesn't return full XML for a long object, but  truncated it and returns XML string with the length of  multiple-of-1024 , but the reminder is not included. internal static string DataContractSerializeToXml<T>(T obj) { string strXml = ""; Type type= obj.GetType();//typeof(T) DataContractSerializer serializer = new DataContractSerializer(type); System.IO.MemoryStream aMemStr = new System.IO.MemoryStream(); System.Xml.XmlTextWriter writer = new System.Xml.XmlTextWriter(aMemStr, null); serializer.WriteObject(writer, obj); strXml = System.Text.Encoding.UTF8.GetString(aMemStr.ToArray()); return strXml; }   I tried to debug and searched Google for similar problems, but didn't find explanation of the error. The most closed http://forums.codeguru.com/showthread.php?309479-MemoryStream-allocates-size-multiple-of-1024-( talking about incorrect length, but not about truncated string.fortunately replacing MemoryStream to StringWriter according to http://billrob.com/archive/2010/02/09/datacontractserializer-converting-objects-to-xml-string.aspxfixed the issue.   1: var serializer = new DataContractSerializer(tempData.GetType());   2: using (var backing = new System.IO.StringWriter())   3: using (var writer = new System.Xml.XmlTextWriter(backing))   4: {   5:     serializer.WriteObject(writer, tempData);   6:     data.XmlData = backing.ToString();   7: }v

    Read the article

  • How to find the occurrence of particular character in string - CHARINDEX

    - by Vipin
    Many times while writing SQL, we need to find if particular character is present in the column data. SQL server possesses an in-built function to do this job - CHARINDEX(character_to_search, string, [starting_position]) Returns the position of the first occurrence of the character in the string. NOTE - index starts with 1. So, if character is at the starting position, this function would return 1. Returns 0 if character is not found. Returns 0 if 'string' is empty. Returns NULL if string is NULL. A working example of the function is SELECT CHARINDEX('a', fname) a_First_occurence, CHARINDEX('a', fname, CHARINDEX('a', fname)) a_Second_occurrence FROM Users WHERE fname = 'aka unknown' OUTPUT ------- a_First_occurence a_Second_occurrence 1 3

    Read the article

  • Removing ocurrances of characters in a string

    - by DmainEvent
    I am reading this book, programming Interviews exposed by John Wiley and sons and in chapter 6 they are discussing removing all instances of characters in a src string using a removal string... so removeChars(string str, string remove) In there writeup they sey the steps to accomplish this are to have a boolean lookup array with all values initially set to false, then loop through each character in remove setting the corresponding value in the lookup array to true (note: this could also be a hash if the possible character set where huge like Unicode-16 or something like that or if str and remove are both relatively small... < 100 characters I suppose). You then iterate through the str with a source and destination index, copying each character only if its corresponding value in the lookup array is false... Which makes sense... I don't understand the code that they use however... They have for(src = 0; src < len; ++src){ flags[r[src]] == true; } which is turning the flag value at the remove string indexed at src to true... so if you start out with PLEASE HELP as your str and LEA as your remove you will be setting in your flag table at 0,1,2... t|t|t but after that you will get an out of bounds exception because r doesn't have have anything greater than 2 in it... even using there example you get an out of bounds exception... Am is there code example unworkable?

    Read the article

  • Generate GUID from any string using C#

    - by Haitham Khedre
    Some times you need to generate GUID from a string which is not valid for GUID constructor . so what we will do is to get a valid input from string that the GUID constructor will accept it. It is recommended to be sure that the string that you will generate a GUID from it some how unique. The Idea is simple is to convert the string to 16 byte Array which the GUID constructor will accept it. The code will talk : using System; using System.Text; namespace StringToGUID { class Program { static void Main(string[] args) { int tokenLength = 32; int guidByteSize = 16; string token = "BSNAItOawkSl07t77RKnMjYwYyG4bCt0g8DVDBv5m0"; byte[] b = new UTF8Encoding().GetBytes(token.Substring(token.Length - tokenLength, tokenLength).ToCharArray(), 0, guidByteSize); Guid g = new Guid(b); Console.WriteLine(g.ToString()); token = "BSNePf57YwhzeE9QfOyepPfIPao4UD5UohG_fI-#eda7d"; b = new UTF8Encoding().GetBytes(token.Substring(token.Length - tokenLength, tokenLength).ToCharArray(), 0, guidByteSize); g = new Guid(b); Console.WriteLine(g.ToString()); Console.Read(); } } } .csharpcode, .csharpcode pre { font-size: small; color: black; font-family: consolas, "Courier New", courier, monospace; background-color: #ffffff; /*white-space: pre;*/ } .csharpcode pre { margin: 0em; } .csharpcode .rem { color: #008000; } .csharpcode .kwrd { color: #0000ff; } .csharpcode .str { color: #006080; } .csharpcode .op { color: #0000c0; } .csharpcode .preproc { color: #cc6633; } .csharpcode .asp { background-color: #ffff00; } .csharpcode .html { color: #800000; } .csharpcode .attr { color: #ff0000; } .csharpcode .alt { background-color: #f4f4f4; width: 100%; margin: 0em; } .csharpcode .lnum { color: #606060; }   And The output: 37306c53-3774-5237-4b6e-4d6a59775979 66513945-794f-7065-5066-4950616f3455

    Read the article

  • Where are strings more useful than a StringBuilder?

    - by DJay
    Lot of questions has been already asked about the differences between string and string builder and most of the people suggest that string builder is faster than string. I am curious to know if string builder is too good so why string is there? Moreover, can some body give me an example where string will be more usefull than string builder?

    Read the article

  • Find all occurrences of a substring in Python

    - by cru3l
    Python has string.find() and string.rfind() to get the index of a substring in string. I wonder, maybe there is something like string.find_all() which can return all founded indexes (not only first from beginning or first from end)? For example: string = "test test test test" print string.find('test') # 0 print string.rfind('test') # 15 #that's the goal print string.find_all('test') # [0,5,10,15]

    Read the article

  • RegularExpression-esque search matching Objects in List

    - by Pindatjuh
    I'm currently working on an implementation of the following idea, and I was wondering if there is any literature on this subject. Working with Java, but the principle applies on any language with a decent type-system, I like to implement: matching Objects from a List using a RegularExpression-esque search: So let's say I have a List containing List<Object> x = new ArrayList<Object>(); x.add(new Object()); x.add("Hello World"); x.add("Second String"); x.add(5); // Integer (auto-boxing) x.add(6); // Integer Then I create a "Regular Expression" (not working with a stream of characters, but working with a stream of Objects), and instead of character-classes, I use type-system properties: [String][Integer] And this would match one sublist: {Match["Second String", 5]}. The expression: [String:length()<15] Will match two sublist (each of length 1) containing a String which instance is passing the expression instance.length() < 5: {Match["Hello World"],Match["Second String"]}. [Object][Object] Matches any pair in the List: {Match[Object,"Hello World"],Match["Second String", 5]}, in a streamed manner (no overlapping matches). Ofcourse, my implementation will have grouping, lookahead/lookbehinds and is hierarchical (i.e. matching n elements from Lists in Lists), etc. The above merely illustrates the concept. Is there a name for this principle, and is there literature available on it?

    Read the article

  • Matching several items inside one string with preg_match_all() and end characters

    - by nefo_x
    I have the following code: preg_match_all('/(.*) \((\d+)\) - ([\d\.\d]+)[,?]/U', "E-Book What I Didn't Learn At School... (2) - 3525.01, FREE Intro DVD/Vid (1) - 0.15", $match); var_dump($string, $match); and get the following ouput: array(4) { [0]=> array(1) { [0]=> string(54) "E-Book What I Didn't Learn At School... (2) - 3525.01," } [1]=> array(1) { [0]=> string(39) "E-Book What I Didn't Learn At School..." } [2]=> array(1) { [0]=> string(1) "2" } [3]=> array(1) { [0]=> string(7) "3525.01" } } which matches only one items... what i need is to get all items from such strings. when i've added "," sign to the end of the string - it worked fine. but that is non-sense in adding comma to each string. Any advice?

    Read the article

  • How to decrypt a string in C# that was encrypted in Delphi

    - by Simon Linder
    Hi all, we have a project written in Delphi that we want to convert to C#. Problem is that we have some passwords and settings that are encrypted and written into the registry. When we need a specified password we get it from the registry and decrypt it so we can use it. For the conversion into C# we have to do it the same way so that the application can also be used by users that have the old version and want to upgrade it. Here is the code we use to encrypt/decrypt strings in Delphi: unit uCrypt; interface function EncryptString(strPlaintext, strPassword : String) : String; function DecryptString(strEncryptedText, strPassword : String) : String; implementation uses DCPcrypt2, DCPblockciphers, DCPdes, DCPmd5; const CRYPT_KEY = '1q2w3e4r5t6z7u8'; function EncryptString(strPlaintext) : String; var cipher : TDCP_3des; strEncryptedText : String; begin if strPlaintext <> '' then begin try cipher := TDCP_3des.Create(nil); try cipher.InitStr(CRYPT_KEY, TDCP_md5); strEncryptedText := cipher.EncryptString(strPlaintext); finally cipher.Free; end; except strEncryptedText := ''; end; end; Result := strEncryptedText; end; function DecryptString(strEncryptedText) : String; var cipher : TDCP_3des; strDecryptedText : String; begin if strEncryptedText <> '' then begin try cipher := TDCP_3des.Create(nil); try cipher.InitStr(CRYPT_KEY, TDCP_md5); strDecryptedText := cipher.DecryptString(strEncryptedText); finally cipher.Free; end; except strDecryptedText := ''; end; end; Result := strDecryptedText; end; end. So for example when we want to encrypt the string asdf1234 we get the result WcOb/iKo4g8=. We now want to decrypt that string in C#. Here is what we tried to do: public static void Main(string[] args) { string Encrypted = "WcOb/iKo4g8="; string Password = "1q2w3e4r5t6z7u8"; string DecryptedString = DecryptString(Encrypted, Password); } public static string DecryptString(string Message, string Passphrase) { byte[] Results; System.Text.UTF8Encoding UTF8 = new System.Text.UTF8Encoding(); // Step 1. We hash the passphrase using MD5 // We use the MD5 hash generator as the result is a 128 bit byte array // which is a valid length for the TripleDES encoder we use below MD5CryptoServiceProvider HashProvider = new MD5CryptoServiceProvider(); byte[] TDESKey = HashProvider.ComputeHash(UTF8.GetBytes(Passphrase)); // Step 2. Create a new TripleDESCryptoServiceProvider object TripleDESCryptoServiceProvider TDESAlgorithm = new TripleDESCryptoServiceProvider(); // Step 3. Setup the decoder TDESAlgorithm.Key = TDESKey; TDESAlgorithm.Mode = CipherMode.ECB; TDESAlgorithm.Padding = PaddingMode.None; // Step 4. Convert the input string to a byte[] byte[] DataToDecrypt = Convert.FromBase64String(Message); // Step 5. Attempt to decrypt the string try { ICryptoTransform Decryptor = TDESAlgorithm.CreateDecryptor(); Results = Decryptor.TransformFinalBlock(DataToDecrypt, 0, DataToDecrypt.Length); } finally { // Clear the TripleDes and Hashprovider services of any sensitive information TDESAlgorithm.Clear(); HashProvider.Clear(); } // Step 6. Return the decrypted string in UTF8 format return UTF8.GetString(Results); } Well the result differs from the expected result. After we call DecryptString() we expect to get asdf1234but we get something else. Does anyone have an idea of how to decrypt that correctly? Thanks in advance Simon

    Read the article

  • getting base64 content string of an image from a mimepart in Java

    - by Bas van den Broek
    Hello, I am trying to get the base64 content of a MimePart in a MimeMultiPart, but I'm struggling with the Javamail package. I simply want the base64 encoded String of a certain inline image, there doesn't seem to be an easy way to do this though. I wrote a method that will take the mime content (as a string) and an image name as a parameter, and searches for the part that contains the base64 content of that image name, and in the end returns this base64 string (as well as the content type but that is irrelevant for this question) Here is the relevant code: private static String[] getBase64Content(String imageName, String mimeString) throws MessagingException, IOException { System.out.println("image name: " + imageName + "\n\n"); System.out.println("mime string: " + mimeString); String[] base64Content = new String[2]; base64Content[0] = ""; base64Content[1] = "image/jpeg"; //some default value DataSource source = new ByteArrayDataSource(new ByteArrayInputStream(mimeString.getBytes()), "multipart/mixed"); MimeMultipart mp = new MimeMultipart(source); for (int i = 0; i < mp.getCount(); i++) { MimePart part = (MimePart) mp.getBodyPart(i); String disposition = part.getDisposition(); if (disposition != null && disposition.equals(Part.INLINE)) { if (part.getContentID() != null && part.getContentID().indexOf(imageName) > -1) //check if this is the right part { if (part.getContent() instanceof BASE64DecoderStream) { BASE64DecoderStream base64DecoderStream = (BASE64DecoderStream) part.getContent(); StringWriter writer = new StringWriter(); IOUtils.copy(base64DecoderStream, writer); String base64decodedString = writer.toString(); byte[] encodedMimeByteArray = Base64.encodeBase64(base64decodedString.getBytes()); String encodedMimeString = new String(encodedMimeByteArray); System.out.println("encoded mime string: " + encodedMimeString); base64Content[0] = encodedMimeString; base64Content[1] = getContentTypeString(part); } } } } return base64Content; } I cannot paste all of the output as the post would be too long, but this is some of it: image name: [email protected] This is a part of the mimeString input, it does find this (correct) part with the image name: --_004_225726A14AF9134CB538EE7BD44373A04D9E3F3940menexch2007ex_ Content-Type: image/gif; name="image001.gif" Content-Description: image001.gif Content-Disposition: inline; filename="image001.gif"; size=1070; creation-date="Fri, 02 Apr 2010 16:19:43 GMT"; modification-date="Fri, 02 Apr 2010 16:19:43 GMT" Content-ID: <[email protected]> Content-Transfer-Encoding: base64 R0lGODlhEAAQAPcAABxuHJzSlDymHGy2XHTKbITCdNTu1FyqTHTCXJTKhLTarCSKHEy2JHy6bJza lITKfFzCPEyWPHS+XHzCbJzSjFS+NLTirBx6HHzKdOz27GzCZJTOjCyWHKzWpHy2ZJTGhHS+VLzi (more base64 string here that I'm not going to paste) But when it finally prints the encoded mime string, this is a different string than I was expecting: encoded mime string: R0lGODlhEAAQAO+/vQAAHG4c77+90pQ877+9HGzvv71cdO+/vWzvv73vv71077+977+977+9XO+/vUx077+9XO+/vcqE77+92qwk77+9HEzvv70kfO+/vWzvv73alO+ Clearly different from the one that has its output in the part above. I'm not even sure what I'm looking at here, but when I try to load this as an image in a html page, it won't work. This is fairly frustrating for me, since all I want is a piece of the text that I'm already printing, but I'd rather not have to search through the mime string myself for the correct part, introducing all kinds of bugs.So I'd really prefer to use the Javamail library but could use some help on how to actually get that correct mime string.

    Read the article

  • I'm trying to pass a string from my first ViewController to my second ViewController but it returns NULL

    - by Dashony
    In my first view controller I have 3 input fields each of them take the user input into and saves it into a string such as: address, username and password as NSUserDefaults. This part works fine. In my second view controller I'm trying to take the 3 strings from first controller (address, username and password) create a html link based on the 3 strings. I've tried many ways to access the 3 strings with no luck, the result I get is NULL. Here is my code: //.h file - first view controller with the 3 input fields CamSetup.h #import <UIKit/UIKit.h> @interface CamSetup : UIViewController <UITextFieldDelegate> { NSString * address; NSString * username; NSString * password; IBOutlet UITextField * addressField; IBOutlet UITextField * usernameField; IBOutlet UITextField * passwordField; } -(IBAction) saveAddress: (id) sender; -(IBAction) saveUsername: (id) sender; -(IBAction) savePassword: (id) sender; @property(nonatomic, retain) UITextField *addressField; @property(nonatomic, retain) UITextField *usernameField; @property(nonatomic, retain) UITextField *passwordField; @property(nonatomic, retain) NSString *address; @property(nonatomic, retain) NSString *username; @property(nonatomic, retain) NSString *password; @end //.m file - first view controller CamSetup.m #import "CamSetup.h" @interface CamSetup () @end @implementation CamSetup @synthesize addressField, usernameField, passwordField, address, username, password; -(IBAction) saveAddress: (id) sender { address = [[NSString alloc] initWithFormat:addressField.text]; [addressField setText:address]; NSUserDefaults *stringDefaultAddress = [NSUserDefaults standardUserDefaults]; [stringDefaultAddress setObject:address forKey:@"stringKey1"]; NSLog(@"String [%@]", address); } -(IBAction) saveUsername: (id) sender { username = [[NSString alloc] initWithFormat:usernameField.text]; [usernameField setText:username]; NSUserDefaults *stringDefaultUsername = [NSUserDefaults standardUserDefaults]; [stringDefaultUsername setObject:username forKey:@"stringKey2"]; NSLog(@"String [%@]", username); } -(IBAction) savePassword: (id) sender { password = [[NSString alloc] initWithFormat:passwordField.text]; [passwordField setText:password]; NSUserDefaults *stringDefaultPassword = [NSUserDefaults standardUserDefaults]; [stringDefaultPassword setObject:password forKey:@"stringKey3"]; NSLog(@"String [%@]", password); } - (void)viewDidLoad { [addressField setText:[[NSUserDefaults standardUserDefaults] objectForKey:@"stringKey1"]]; [usernameField setText:[[NSUserDefaults standardUserDefaults] objectForKey:@"stringKey2"]]; [passwordField setText:[[NSUserDefaults standardUserDefaults] objectForKey:@"stringKey3"]]; [super viewDidLoad]; } @end //.h second view controller LiveView.h #import <UIKit/UIKit.h> #import "CamSetup.h" @interface LiveView : UIViewController { NSString *theAddress; NSString *theUsername; NSString *thePassword; CamSetup *camsetup; //here is an instance of the first class } @property (nonatomic, retain) NSString *theAddress; @property (nonatomic, retain) NSString *theUsername; @property (nonatomic, retain) NSString *thePassword; @end //.m second view LiveView.m file #import "LiveView.h" @interface LiveView () @end @implementation LiveView @synthesize theAddress, theUsername, thePassword; - (void)viewDidLoad { [super viewDidLoad]; theUsername = camsetup.username; //this is probably not right? NSLog(@"String [%@]", theUsername); //resut here is NULL NSLog(@"String [%@]", camsetup.username); //and here NULL as well } @end

    Read the article

  • Nothing else but Regex for matching the string.

    - by Harikrishna
    I want to check whether there is string starting from number and then optional character with the help of the regex.So what should be the regex for matching the string which must be started with number and then character might be there or not.Like there is string "30a" or "30" it should be matched.But if there is "a" or some else character or sereis of characters, string should not be matched.

    Read the article

  • Matching math expression with regular expression?

    - by Ethan
    For example, these are valid math expressions: a * b + c -a * (b / 1.50) (apple + (-0.5)) * (boy - 1) And these are invalid math expressions: --a *+ b @ 1.5.0 // two consecutive signs, two consecutive operators, invalid operator, invalid number -a * b + 1) // unmatched parentheses a) * (b + c) / (d // unmatched parentheses I have no problem with matching float numbers, but have difficulty with parentheses matching. Any idea? If there is better solution than regular expression, I'll accept as well. But regex is preferred.

    Read the article

  • Simple string pattern matching

    - by Joonas Trussmann
    What's the easiest way of doing simple pattern matching a la .something.com something.com/ something.com/somefolder/*.jpg in the iPhone SDK? At this point it looks like I'm going to have to use a regular expression library of some sort, which is really overkill when all I need is simple wildcard matching. None of the standard NSString methods seem to be available on the iPhone.

    Read the article

  • Unicode replacement characters for text matching

    - by Christian Harms
    I have some fun with unicode text sources (all correct encodet) and I want to match names. The classic problem, one source comes correctly, an other has more flatten names: "Elblag" vs. "Elblag" (see the character a) How can I "flatten" a, á, â or à to a for better matching? Are there unicode to ascii- matching tables?

    Read the article

  • Only replace first matching element using PHP's mb_ereg_replace

    - by Mark L
    Hello, I want to replace only the first matching element in a string instead of replacing every matching element in a string $str = 'abc abc abc'; $find = 'abc'; $replace = 'def'; echo mb_ereg_replace( $find, $replace, $str ); This will return "def def def". What would I need to change in the $find or $replace parameter in order to get it to return "def abc abc"?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Modelling interiors with Google Sketchup PhotoMatching

    - by rzlines
    I have come across multiple tutorials explaining how to model structures with Google SketchUp. Are there any tutorial series explaining how to do interiors using Photo Matching and multiple photos. The tutorial should ideally cover the entire process, including the right way to take the photos of the place to modelling the furniture and the walls. Does anyone know of any video series or any literature on the same. Please direct me to the right place

    Read the article

  • Pros/cons of reading connection string from physical file vs Application object (ASP.NET)?

    - by HaterTot
    my ASP.NET application reads an xml file to determine which environment it's currently in (e.g. local, development, production). It checks this file every single time it opens a connection to the database, in order to know which connection string to grab from the Application Settings. I'm entering a phase of development where efficiency is becoming a concern. I don't think it's a good idea to have to read a file on a physical disk ever single time I wish to access the database (very often). I was considering storing the connection string in Application["ConnectionString"]. So the code would be public static string GetConnectionString { if (Application["ConnectionString"] == null) { XmlDocument doc = new XmlDocument(); doc.Load(HttpContext.Current.Request.PhysicalApplicationPath + "bin/ServerEnvironment.xml"); XmlElement xe = (XmlElement) xnl[0]; switch (xe.InnerText.ToString().ToLower()) { case "local": connString = Settings.Default.ConnectionStringLocal; break; case "development": connString = Settings.Default.ConnectionStringDevelopment; break; case "production": connString = Settings.Default.ConnectionStringProduction; break; default: throw new Exception("no connection string defined"); } Application["ConnectionString"] = connString; } return Application["ConnectionString"].ToString(); } I didn't design the application so I figure there must have been a reason for reading the xml file every time (to change settings while the application runs?) I have very little concept of the inner workings here. What are the pros and cons? Do you think I'd see a small performance gain by implementing the function above? THANKS

    Read the article

  • How to asynchronously read to std::string using Boost::asio?

    - by SpyBot
    Hello. I'm learning Boost::asio and all that async stuff. How can I asynchronously read to variable user_ of type std::string? Boost::asio::buffer(user_) works only with async_write(), but not with async_read(). It works with vector, so what is the reason for it not to work with string? Is there another way to do that besides declaring char user_[max_len] and using Boost::asio::buffer(user_, max_len)? Also, what's the point of inheriting from boost::enable_shared_from_this<Connection> and using shared_from_this() instead of this in async_read() and async_write()? I've seen that a lot in the examples. Here is a part of my code: class Connection { public: Connection(tcp::acceptor &acceptor) : acceptor_(acceptor), socket_(acceptor.get_io_service(), tcp::v4()) { } void start() { acceptor_.get_io_service().post( boost::bind(&Connection::start_accept, this)); } private: void start_accept() { acceptor_.async_accept(socket_, boost::bind(&Connection::handle_accept, this, placeholders::error)); } void handle_accept(const boost::system::error_code& err) { if (err) { disconnect(); } else { async_read(socket_, boost::asio::buffer(user_), boost::bind(&Connection::handle_user_read, this, placeholders::error, placeholders::bytes_transferred)); } } void handle_user_read(const boost::system::error_code& err, std::size_t bytes_transferred) { if ( err or (bytes_transferred != sizeof(user_)) ) { disconnect(); } else { ... } } ... void disconnect() { socket_.shutdown(tcp::socket::shutdown_both); socket_.close(); socket_.open(tcp::v4()); start_accept(); } tcp::acceptor &acceptor_; tcp::socket socket_; std::string user_; std::string pass_; ... };

    Read the article

  • What's so bad about building XML with string concatenation?

    - by wsanville
    In the thread What’s your favorite “programmer ignorance” pet peeve?, the following answer appears, with a large amount of upvotes: Programmers who build XML using string concatenation. My question is, why is building XML via string concatenation (such as a StringBuilder in C#) bad? I've done this several times in the past, as it's sometimes the quickest way for me to get from point A to point B when to comes to the data structures/objects I'm working with. So far, I have come up with a few reasons why this isn't the greatest approach, but is there something I'm overlooking? Why should this be avoided? Probably the biggest reason I can think of is you need to escape your strings manually, and most programmers will forget this. It will work great for them when they test it, but then "randomly" their apps will fail when someone throws an & symbol in their input somewhere. Ok, I'll buy this, but it's really easy to prevent the problem (SecurityElement.Escape to name one). When I do this, I usually omit the XML declaration (i.e. <?xml version="1.0"?>). Is this harmful? Performance penalties? If you stick with proper string concatenation (i.e. StringBuilder), is this anything to be concerned about? Presumably, a class like XmlWriter will also need to do a bit of string manipulation... There are more elegant ways of generating XML, such as using XmlSerializer to automatically serialize/deserialize your classes. Ok sure, I agree. C# has a ton of useful classes for this, but sometimes I don't want to make a class for something really quick, like writing out a log file or something. Is this just me being lazy? If I am doing something "real" this is my preferred approach for dealing w/ XML.

    Read the article

  • How to check if a position inside a std string exists ?? (c++)

    - by yox
    Hello, i have a long string variable and i want to search in it for specific words and limit text according to thoses words. Say i have the following text : "This amazing new wearable audio solution features a working speaker embedded into the front of the shirt and can play music or sound effects appropriate for any situation. It's just like starring in your own movie" and the words : "solution" , "movie". I want to substract from the big string (like google in results page): "...new wearable audio solution features a working speaker embedded..." and "...just like starring in your own movie" for that i'm using the code : for (std::vector<string>::iterator it = words.begin(); it != words.end(); ++it) { int loc1 = (int)desc.find( *it, 0 ); if( loc1 != string::npos ) { while(desc.at(loc1-i) && i<=80){ i++; from=loc1-i; if(i==80) fromdots=true; } i=0; while(desc.at(loc1+(int)(*it).size()+i) && i<=80){ i++; to=loc1+(int)(*it).size()+i; if(i==80) todots=true; } for(int i=from;i<=to;i++){ if(fromdots) mini+="..."; mini+=desc.at(i); if(todots) mini+="..."; } } but desc.at(loc1-i) causes OutOfRange exception... I don't know how to check if that position exists without causing an exception ! Help please!

    Read the article

  • Search files for text matching format of a Unix directory

    - by BrandonKowalski
    I am attempting to search through all the files in a directory for text matching the pattern of any arbitrary directory. The output of this I hope to use to make a list of all directories referenced in the files (this part I think I can figure out on my own). I have looked at various regex resources and made my own expression that seems to work in the browser based tool but not with grep in the command line. /\w+[(/\w+)]+ My understanding so far is the above expression will look for the beginning / of a directory then look for an indeterminate number of characters before looking for a repeating block of the same thing. Any guidance would be greatly appreciated.

    Read the article

< Previous Page | 52 53 54 55 56 57 58 59 60 61 62 63  | Next Page >