Search Results

Search found 19690 results on 788 pages for 'result partitioning'.

Page 562/788 | < Previous Page | 558 559 560 561 562 563 564 565 566 567 568 569  | Next Page >

  • Entity Framework: Attached Entities not Saving

    - by blog
    Hello: I can't figure out why calling SaveChanges() on the following code results in no changes to the objects I attached: // delete existing user roles before re-attaching if (accountUser.AccountRoles.Count > 0) { foreach (AccountRole role in accountUser.AccountRoles.ToList()) { accountUser.AccountRoles.Remove(role); } } // get roles to add List<int> roleIDs = new List<int>(); foreach (UserRole r in this.AccountRoles) { roleIDs.Add(r.RoleID); } var roleEntities = from roles in db.AccountRoles where roleIDs.Contains(roles.id) select roles; accountUser.AccountRoles.Attach(roleEntities); db.SaveChanges(); In the debugger, I see that the correct roleEntities are being loaded, and that they are valid objects. However, if I use SQL Profiler I see no UPDATE or INSERT queries coming in, and as a result none of my attached objects are being saved.

    Read the article

  • Returning an array from an activity

    - by Boardy
    I am currently working on an android project and I want to be able to startActivityForResult so that I can return an array of. The array is an ArrayList<Spanned> lets say its called myArray. From what I've read I can't return an array directly from the activty using the set result so I was thinking that once the array has added all the data to the array, I can then call the toString function on it, i.e. myArray.toString(). If I do this, I have no idea how I can then convert this back into the original ArrayList<Spanned>. Thanks for any help you can provide.

    Read the article

  • mysql fetch error

    - by Luke
    <? $res = $database->userLatestStatus($u); while($row=mysql_fetch_assoc($res)){ $status=$row['status']; echo "$status"; } ?> This is the code on my page, which is throwing up the following error: Warning: mysql_fetch_assoc(): supplied argument is not a valid MySQL result resource.... The database function: function userLatestStatus($u) { $q = "SELECT status FROM ".TBL_STATUS." WHERE userid = '$u' DESC LIMIT 1"; return mysql_query($q, $this->connection); } Any ideas what the problem is?

    Read the article

  • implementing runat in HtmlTextWriterAttribute

    - by user525116
    Hi dear friends, I have a custom asp.net control. public class Window : WebControl { protected override void RenderContents(HtmlTextWriter wr) { wr.AddAttribute("runat", "server",true); wr.AddAttribute("id", this.UniqueID, false); wr.RenderBeginTag(HtmlTextWriterTag.Div); wr.RenderEndTag(); wr.WriteLine(); base.RenderContents(wr); } } And this is my result after compile and use the control: <cc1:Window ID="Window1" runat="server" /> Use standard definition DIV with standard format: <div runat="server" id="aaaa"></div> After compile my web page to use this web custom control, this is render browser source of my web page: <span id="Window1"><div runat="server" id="Window1"></div></span> <div id="aaaa"></div>

    Read the article

  • Greasemonkey,jquery and elements from links to new link

    - by Bulfen
    Hi all, I'm pretty new to jquery and greasemonkey. So if someone could help me out it would be great. Here is an example url I get values from. Org: http://www.example.com/index.php?value1=blabla1&sid=blabla2&mid=blabla3 Result I want: link://www.example.com/blabla1/data/blabla2/blabla3.ext example: var sid=document.URL.substring(document.URL.indexOf('sid=')+15); // How do I set the lenght of blabla2 ? -7 ? Anyway, Hopefully someone understand what I mean and can help me out alittle.

    Read the article

  • Any idea why this query always returns duplicate items?

    - by Kardo
    I want to get all Images not used by current ItemID. The this subquery but it also always returns duplicate Images: EDITED select Images.ImageID, Images.ItemStatus, Images.UserName, Images.Url, Image_Item.ItemID, Image_Item.ItemID from Images left join (select ImageID, ItemID, MAX(DateCreated) x from Image_Item where ItemID != '5a0077fe-cf86-434d-9f3b-7ff3030a1b6e' group by ImageID, ItemID having count(*) = 1) image_item on Images.imageid = image_item.imageid where ItemID is not null I guess the problem is with the subquery which I can't avoid duplicate rows: select ImageID, ItemID, MAX(DateCreated) x from Image_Item where ItemID != '5a0077fe-cf86-434d-9f3b-7ff3030a1b6e' group by ImageID, ItemID having count(*) = 1 Result: F2EECBDC-963D-42A7-90B1-4F82F89A64C7 0578AC61-3C32-4A1D-812C-60A09A661E71 F2EECBDC-963D-42A7-90B1-4F82F89A64C7 9A4EC913-5AD6-4F9E-AF6D-CF4455D81C10 42BC8B1A-7430-4915-9CDA-C907CBC76D6A CB298EB9-A105-4797-985E-A370013B684F 16371C34-B861-477C-9A7C-DEB27C8F333D 44E6349B-7EBF-4C7E-B3B0-1C6E2F19992C Table: Images ImageID uniqueidentifier UserName nvarchar(100) DateCreated smalldatetime Url nvarchar(250) ItemStatus char(1) Table: Image_Item ImageID uniqueidentifier ItemID uniqueidentifier UserName nvarchar(100) ItemStatus char(1) DateCreated smalldatetime Any kind help is highly appreciated.

    Read the article

  • Class templating std::set key types

    - by TomFLuff
    I have a class to evaluate set algebra but wish to template it. At the minute it looks a bit like this set.h: template<typename T> class SetEvaluation { public: SetEvaluation<T>(); std::set<T> evaluate(std::string in_expression); } set.cpp template<typename T> std::set<T> SetEvaluation<T>::evaluate(std::string expression) { std::set<T> result; etc etc... } But i'm getting undefined reference errors when compiling. Is it possible to declare the return type as std::set<T> and then pass std::string as the class template param. There are no errors in the class but only when I try to instantiate SetEvaluation<std::string> Can anyone shed light on this problem? thanks

    Read the article

  • [JQuery] Edit Css with animation effect

    - by Pennywise83
    Hi, I've a div in a absolute position with a default "top" value set to "-200px". When i click on the div the "top" value is updated to "0". In this way I see the entire Div. This is the js: $(document).ready(function(){ $("#search_bar").click(function () { $(this).css("top","0"); }); }); Is there a way to achieve this result but with an animation? For example, a slide down effect? Also, when i click another time to the div I'd like that the "top" value will be restored to "-200px".

    Read the article

  • jQuery: Load body of page into variable

    - by Nathan G.
    I'm using jQuery to load the result of a PHP script into a variable. The script is passed something that the user typed with a GET request. I want to take just what the script spit out into its <body> tag. Here's what I've tried: JS: function loader() { var typed = $('#i').val(); //get what user typed in $.get("script.php", {i: typed}, function(loaded) {dataloaded = loaded;}); alert($(dataloaded).find('body')) } But it just displays [Objec object]. How can I get a useful value that is just the contents of the body of a loaded page? I know the PHP works, I just need the JS. The script echos something like 1!!2 (two numbers separated by two exclamation points). Thanks!

    Read the article

  • Error about TypeError (wrong argument type Module (expected Class)): app/controllers/player_profiles_controller.rb:1:in `<top (required)>'

    - by edi susanto
    hy guys . . im new at this . . sorry for the word that's not understandable and the easy question . . i'd like to ask about an error that shown below : TypeError (wrong argument type Module (expected Class)): app/controllers/player_profiles_controller.rb:1:in `' i want to test the result by render json in soapUI. does anyone know what's the problem so that the error will show up like above ? thanks before.regards,edy

    Read the article

  • Optimal search queries

    - by Macros
    Following on from my last question http://stackoverflow.com/questions/2788082/sql-server-query-performance, and discovering that my method of allowing optional parameters in a search query is sub optimal, does anyone have guidelines on how to approach this? For example, say I have an application table, a customer table and a contact details table, and I want to create an SP which allows searching on some, none or all of surname, homephone, mobile and app ID, I may use something like the following: select * from application a inner join customer c on a.customerid = a.id left join contact hp on (c.id = hp.customerid and hp.contacttype = 'homephone') left join contact mob on (c.id = mob.customerid and mob.contacttype = 'mobile') where (a.ID = @ID or @ID is null) and (c.Surname = @Surname or @Surname is null) and (HP.phonenumber = @Homphone or @Homephone is null) and (MOB.phonenumber = @Mobile or @Mobile is null) The schema used above isn't real, and I wouldn't be using select * in a real world scenario, it is the construction of the where clause I am interested in. Is there a better approach, either dynamic sql or an alternative which can achieve the same result, without the need for many nested conditionals. Some SPs may have 10 - 15 criteria used in this way

    Read the article

  • RoR: Condition Always False - Why?

    - by Matt Hollingsworth
    Working in RoR 2.3.x. My quiz_results table has a row for user_id (3907) and result (0.1), and two users I'm looking at with no rows in the quiz_results table. This line keeps returining false: -if QuizResult.find_by_user_id(@user_id).present? But if I change it to anything that returns true, the next line reports an error on the * method: ="#{(QuizResult.average('score', :conditions => 'user_id = #{@user.id}') * 100).round}%" The beginning of the code is a loop: [email protected] do |user| Any ideas how to fix? Have tried unsuccessfully all day.

    Read the article

  • MySQL pivot tables - covert rows to columns

    - by user2723490
    This is the structure of my table: Then I run a query SELECT `date`,`index_name`,`results` FROM `mst_ind` WHERE `index_name` IN ('MSCI EAFE Mid NR USD', 'Alerian MLP PR USD') AND `time_period`='M1' and get a table like How can I convert "index_name" rows to columns like: date | MSCI EAFE Mid NR USD | Alerian MLP PR USD etc In other words I need each column to represent an index and rows to represent date-result. I understand that MySQL doesn't have pivot table functions. What is the easiest way of doing this? I've tried this code, but it generates an error: SELECT `date`, MAX(IF(index_name = 'Alerian MLP PR USD' AND `time_period`='M1', results, NULL)) AS res1, MAX(IF(index_name = 'MSCI EAFE Mid NR USD' AND `time_period`='M1', results, NULL)) AS res2 FROM `mst_ind` GROUP BY `date I need to make the conversion on the query level - not PHP. Please suggest a nice and elegant solution. Thanks!

    Read the article

  • What do C# Table Adapters actually return?

    - by Raven Dreamer
    I'm working on an application that manipulates SQL tables in a windows form application. Up until now, I've only been using the pre-generated Fill queries, and self-made update and delete queries (which return nothing). I am interested in storing the value of a single value from a single column (an 'nchar(15)' name), and though I have easily written the SQL code to return that value to the application, I have no idea what it will be returned as. SELECT [Contact First Name] FROM ContactSkillSet WHERE [Contact ID] = @CurrentID Can the result be stored directly as a string? Do I need to cast it? Invoke a toString method?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Send value to servlet with javascript

    - by kawtousse
    hi everyone, In my JavaScript function I do like this in order to redirect parameters to servlet: var ids1=document.getElementById("projet").value; document.location.href("http://localhost:8080/Opc_Web_App/ServletAffectation?ids1="+ids1); and in the servlet I do the following to get Value: String idprojet= request.getParameter("ids1"); System.out.println("le projet selectionné est :" +idprojet); the problem that i didn't have the result of System.out.print in my screen; so in other terms the servlet didn't get the parameter. I can not see the problem until now. Please help. Thank you.

    Read the article

  • [sqlalchemy] subquery in select statement

    - by webjunkie
    Hi guys, I have two tables (albums,pictures) in a one to many relationship and I want to display each albums details with one picture so I have the following query select albums.name,(select pictures.path from pictures where pictures.albumid=albums.id limit 1) as picture from albums where ... Now I'm struggling creating this on Pylons with sqlalchemy I tried to do the following picture = Session.query(model.Picture) sub_q = picture.filter_by(albumid = model.Album.id).limit(1).subquery() album_q = Session.query(model.Album, sub_q) result = album_q.all() but it creates the following statement displaying the incorrect picture beacuse the table albums is included in the subquery select albums.name,(select pictures.path from pictures,albums where pictures.albumid=albums.id) from albums where ... Am I doing it wrong?, is this even possible in sqlalchemy?.

    Read the article

  • How do I pick the most beneficial combination of items from a set of items?

    - by Chu
    I'm designing a piece of a game where the AI needs to determine which combination of armor will give the best overall stat bonus to the character. Each character will have about 10 stats, of which only 3-4 are important, and of those important ones, a few will be more important than the others. Armor will also give a boost to 1 or all stats. For example, a shirt might give +4 to the character's int and +2 stamina while at the same time, a pair of pants may have +7 strength and nothing else. So let's say that a character has a healthy choice of armor to use (5 pairs of pants, 5 pairs of gloves, etc.) We've designated that Int and Perception are the most important stats for this character. How could I write an algorithm that would determine which combination of armor and items would result in the highest of any given stat (say in this example Int and Perception)?

    Read the article

  • How to disable subView in tableViewCell iPhone

    - by user1304842
    every one. I'm a new developer for iphone. I want to not get a event for a subView in a tableCell. It it clear, that how to enable/disable the selected a view. When i use "subView.userInteractionEnabled = NO;" method, the subview send the event to parent view. At the result, when i click the subview, example the buttonView in tableViewCell, The tableViewcell captured the event. I don't allow this. How can i do that? Please help me.

    Read the article

  • Simple HTML form with POST to SQL function encoding problem?

    - by Spoonk
    Hi again, I have a simple html form that submits information with POST function. But when information contains a Cyrillic characters, in table in MySql there becomes азазаза symbols instead of text. The table is on utf-8_general_ci, the site is on UTF-8 encoding. I visualize the result from this table with $query = " SELECT ".$db->nameQuote('ingredients')." FROM ".$db->nameQuote('other')." ORDER by id DESC "; $db->setQuery($query); $ingredients = $db->loadResult(); I cant understand how to tell the form to send chyrillic characters correct. Or where is the problem at all? How to fetch this characters correctly? Or how to send them correctly?

    Read the article

  • (Action<T>).Name does not return expected values

    - by Tomas Lycken
    I have the following method (used to generate friendly error messages in unit tests): protected string MethodName<TTestedType>(Action<TTestedType> call) { return string.Format("{0}.{1}", typeof(TTestedType).FullName, call.Method.Name); } But when I call it as follows, I don't get the expected results: var nm = MethodName<MyController>(ctrl => ctrl.Create()); After running this code, nm contains "<Create_CreateShowsView>b__8", and not (as expected) "Create". How should I change the code to obtain the expected result?

    Read the article

  • Fail to resolve a name when calling ConnMgrEstablishConnectionSync()

    - by Rodriguez
    Hi Guys, I'm trying to setup a GPRS connection with ConnMgrEstablishConnectionSync(), so far so good, the connection is established and if I try to connect to an IP address, everything works fine. Alas, when I try to resolve a name: ConnMgrEstablishConnectionSync(); ... gethostbyname("www.google.com"); The result is always an error: 0x00002af9 (host not found). Therefor I'm not able to resolve any name, but if I try to open a browser, the browser is able to resolve everything. Am I doing something wrong? Thanx for your help.

    Read the article

  • Grails searchable plugin with hasMany

    - by user2624442
    I am using grails searchable plugin to search my domain classes. However, I cannot yet search by my hasMany (skills and interests) fields even though they are of the simple type String. This is my domain class: class EmpactUser { static searchable = [except: ['dateCreated','password','enabled','accountExpired','accountLocked','passwordExpired']] String username String password boolean enabled = true boolean accountExpired boolean accountLocked boolean passwordExpired String email String firstName String lastName String address String phoneNumber String description byte[] avatar byte[] resume Date dateCreated static hasMany = [ skills : String, interests : String, // each user has the ability to list many skills and interests so that they can be matched with a project. ] static constraints = { username blank: false, unique: true password blank: false email email: true, blank: false firstName blank: false lastName blank: false description nullable: true address nullable: true avatar nullable: true, maxSize: 1024 * 1024 * 10 resume nullable: true, maxSize: 1024 * 1024 * 10 phoneNumber nullable: true, matches: "/[(][+]d{3}[)]d+/", maxSize: 30 } } This is the code I am using to search: def empactUserList = EmpactUser.search( searchQuery, [reload: false, result: "every", defaultOperator: "or"]) Am I missing something? Thanks, Alan.

    Read the article

  • How do I search within svn logs

    - by user369311
    I want to be able to search within the commit logs of svn. I know you can do that on tortoise, but couldn't find a way using the command line. We are moving to a two-tiered repository approach, so that the stable branch will only get stories fully completed and tested. To achieve that, we would need a way to search within the commit messages for the story code (eg:#s1322) and get a list of the revisions to be used in a subsequent merge command. Ex: searchsvnapp http://[repo location root] #s1322 result: 4233,4249,4313

    Read the article

  • What is the most efficient approach to fetch category tree, products, brands, counts by subcategory

    - by alex227
    Symfony 1.4 + Doctrine 1.2. What is the best way to minimize the number of queries to retrieve products, subcategories of current category, product counts by subcategory and brand for the result set of the query below? Categories are a nested set. Here is my query: $q = Doctrine_Query::create() ->select('c.*, p.product,p.price, b.brand') ->from('Category c') ->leftJoin('c.Product p') ->leftJoin('p.Brand b') ->where ('c.root_id = ?', $this->category->getRootId()) ->andWhere('c.lft >= ?', $this->category->getLft()) ->andWhere('c.rgt <= ?', $this->category->getRgt()) ->setHydrationMode(Doctrine_Core::HYDRATE_ARRAY); $treeObject = Doctrine::getTable('Category')->getTree(); $treeObject->setBaseQuery($q); $this->treeObject = $treeObject; $treeObject->resetBaseQuery(); $this->products = $q->execute();

    Read the article

< Previous Page | 558 559 560 561 562 563 564 565 566 567 568 569  | Next Page >