Search Results

Search found 17356 results on 695 pages for 'document ready'.

Page 568/695 | < Previous Page | 564 565 566 567 568 569 570 571 572 573 574 575  | Next Page >

  • How to setup a virtual host in Ubuntu?

    - by Rade
    I have an app that's accessible via 1.2.3.4/myapp. The app is installed in /var/www/myapp. I've set up a subdomain(apps.mydomain.com) that points to 1.2.3.4. I want the server to point to var/www/myapp if I type apps.mydomain.com/myapp, how do I do that? I have experience creating virtual hosts(lots of them) locally but I'm lost because it's now in production and it's a little different. Here's my virtual host config: <VirtualHost *:80> ServerAdmin webmaster@localhost ServerName apps.mydomain.com/myapp DocumentRoot /var/www/myapp/public <Directory /> Options FollowSymLinks AllowOverride All </Directory> <Directory /var/www/> Options Indexes FollowSymLinks MultiViews AllowOverride All Order allow,deny allow from all </Directory> ScriptAlias /cgi-bin/ /usr/lib/cgi-bin/ <Directory "/usr/lib/cgi-bin"> AllowOverride All Options +ExecCGI -MultiViews +SymLinksIfOwnerMatch Order allow,deny Allow from all </Directory> ErrorLog ${APACHE_LOG_DIR}/error.log # Possible values include: debug, info, notice, warn, error, crit, # alert, emerg. LogLevel warn CustomLog ${APACHE_LOG_DIR}/access.log combined </VirtualHost> Any idea why I still see the files instead of pointing me to the document root? Just in case someone might ask, the app is based on Laravel 4 framework. It's really bad right now because anyone can access the files from the browser.

    Read the article

  • likewise-open and samba as pdc

    - by Knight Samar
    Hi, We have successfully implemented a Samba Primary Domain Controller for a hybrid Windows-Linux environment. So now I am setting up dual-boot clients with Windows XP and Ubuntu 9.10. Windows XP can be easily added to the Samba Domain. Everything is manageable. No worries. But when I try using likewise-open 4.1 to add the Ubuntu 9.10 to the samba domain, it cannot locate the domain controller. domainjoin-cli --loglevel verbose join MYDOMAIN root Error: Unable to resolve DC name [code 0x00080026] Resolving 'MYDOMAIN' failed. Check that the domain name is correctly entered. Also check that your DNS server is reachable, and that your system is configured to use DNS in nsswitch. I even tried mydomain.com variations but to no avail. What am I missing ? I read up a document on MSDN wherein it says that the Domain Controller creates some SRV records in the DNS server. I guess, I don't have them on my BIND. Do you think that is the problem ? If yes, can anyone please point out how and what SRV records need to be added. Thanks.

    Read the article

  • Netscaler - Involving Response Body Replacement with GeoIP Implementation

    - by MrGoodbyte
    I have a Netscaler (10000) NS9.3: Build 52.3.cl There is a document contains a short tutorial about GeoIP database implementation at http://support.citrix.com/article/CTX130701 I have added location database by following this tutorial successfully but instead of dropping connections I need to replace a string in content body. To do that, I created a rewrite action with those parameters. * Name: ns_country_replacement_action * Type: REPLACE_ALL * Target Expression: HTTP.RES.BODY(50000) * Replacement Text: HTTP.RES.HEADER("international") * Pattern: \{\/\*COUNTRY_NAME\*\/\} To insert header called "international", I try to create another rewrite action with those parameters. I'll add this one's policy prior. * Name: ns_country_injection_action * Type: INSERT_HTTP_HEADER * Header Name: international * Header Value: CLIENT.IP.SRC.MATCHES_LOCATION("*.US.*.*.*.*").NOT When I click on create button, it says; Compound expression syntax error, [.*.*").NOT^, 50] I'm not sure but I think that two things might cause this error. The expression I use for MATCHES_LOCATION is wrong but I use same expression in the tutorial. MATCHES_LOCATION().NOT returns BOOLEAN but the field expects STRING. How can I get this work? Do I use right tools to accomplish what I need to do? Thank you. -Umut

    Read the article

  • Atlassian Crucible very slow on large repository

    - by Mitch Lindgren
    Hi everyone, My company has been running a trial of Atlassian Crucible for some months now. For repositories where it's working properly, users have given very positive feedback about the tool. The problem I'm having is that we have several different projects, each with its own repository, and some of those repositories are very large. One repository in particular has a large number of branches and probably around 9,000 files per branch. Browsing that repository in Crucible is extremely slow. Crucible is running on a CentOS VM. The VM has 4GB of RAM, and I've set Crucible's maximum at 3GB, of which it is currently using 2GB. I've brought this up in a support ticket with Atlassian, and they suggested the following: In particular because you have a rather large SVN repository you will likely find that Fisheye will be creating a large index file on disk. To help improve performance a few things you can try are: Increasing the available memory available to Fisheye (see the document above). Migrating to an external database: confluence.atlassian.com/display/FISHEYE/Migrating+to+an+External+Database Excluding files and directories from your index that aren't needed: confluence.atlassian.com/display/FISHEYE/Allow+(Process) (Sorry for not hyperlinking; don't have the rep.) I've tried all of these things to an extent, but so far none have helped greatly. I was originally running Crucible on a Windows box with 2GB of RAM using the built in HSQL DB. Moving to MySQL on CentOS saw a performance increase for some repositories, and made Crucible much more stable, but did not seem to help much with our biggest repository. There are only so many files/branches I can exclude from indexing while maintaining the tool's usefulness. That being the case, does anyone have any tips on how to speed up Crucible on large repositories, without investing in insanely powerful hardware? Thanks! Edit: To clarify, since I didn't mention it explicitly above, I am using FishEye.

    Read the article

  • Interpreting Inkscape SVG path coordinates for HTML map

    - by tovare
    I needed some coordinates for a HTML MAP and tried to use inkskape by opening the image and just draw a path with my polygon coordinates. My document properties are set to 256 x 256 pixels and units: px When opening the svg file i get coordinates which are not immediately apparent. <path style="fill:none;stroke:#000000;stroke-width:1px;stroke-linecap:butt; stroke-linejoin:miter;stroke-opacity:1" d="m 23.864407,126.91525 3.254237, 44.47458 35.79661, 44.47458 71.593216, 19.52542 71.59322, -37.9661 22.77967, -72.67797 L 218.0339, 64 192,49.898305 l -32.54237, 8.677966 -18.44068, -35.79661 1.08474, -17.3559322 -71.593215,0 L 45.559322,34.711864 35. 79661,57.491525 5.4237288, 74.847458 6.5084746,101.9661 23.864407,126.91525 z" id="path2840" /> How can I get coordinates I can use ? The original image The SVG file from inkscape Link to SVG Progress: I tried a tool called InkscapeMap which looks promising and simple, but unfortunately it looks like it didn't work with this particular svn file. Solved! Saving the file as a Plain SVG solved the problem and InkscapeMap worked perfectly. (Btw. saving as an optimized svg caused a parsing error) Update 13.11 Using inkscapeMap 0.6 and Inkscape 0.48 i needed to uncheck relative coordinates in SVG output preferences. Also if you get a C error message, hunt down the polygon with a C in it, and redraw the polygon using the XML editor in inkscape. Update 25.11.2011 I modified the source to improve parsing. http://tovare.com/articles/createhtmlimagemapsusinginkscape/

    Read the article

  • Using Virtualbox Bridge Networking fails connection from Guest OS to Oracle XE running on Host

    - by Licheng
    I am trying to make a JDBC connection from a VirtualBox Ubuntu Guest OS to an Oracle XE database running o Host. However, the connection is refused. Here are the details of my environment: VirtualBox: 4.1.4 Host OS: Windows 7 Guest OS: Ubuntu server 11.4 Networking mode: Bridged network Oracle XE database running on Host Issue: WebLogic server runs on the Ubuntu virtualbox. It attempts to connect to an Oracle XE database running on the Host OS (windows 7) with listening port 1521. On the Guest OS (Ubuntu), I am able to ping the Host computer from the Guest OS. However, when I configured a JDBC data source on the WebLogic server on the Guest OS to connect to the Oracle XE, connection took a long time, and eventually I received an "IO Exception: The Network Adapter could not establish the connection". When I tried "telnet host-ip 1521", no connection was established. With Bridge networking, I can make bi-directional connections between the host and the guest OS (e.g. connection through ssh and ftp). Is there anything I missed in the setup of Bridge networking and the guest/host OS? Note that I was able to make the same connection within a normal networking environment (i.e. not using virtual box). I am not sure whether Bridge networking is a good option for the work described above. Should I use host-only networking mode? If so, any specific configurations I need to perform? I read through the Virtual box document on setting up the host-only network, however, it lacks of details. I followed the procedures described in the manual, and couldn't even connect to the host. Could some experts here enlighten me on this issue? Much appreciated. Licheng

    Read the article

  • How to restrict file system when logged into terminal services

    - by pghcpa
    What I need to accomplish: With one login, when user is physically in the building I need them to see everything. When they are using terminal services with same login they should not be able to see the file system on the network. I can lock down the PC running terminal services as that is its only use. Details: Windows/2003 Server with terminal services. One login for a user (e.g., johndoe). When johndoe logs into the network at his desk in the office, he can see the network files according to group policy. When johndoe logs into terminal services from outside the building, we do not want to allow him see the network. Using 2x to do a published app, but that app has a "feature" that allows user to see network. Published application on termina services (only) is a document management system that is tied to windows login, so I can't give them two logins. With one login, when they are in the building I need them to see everything. When they are using terminal services they should not be able to see the network. I can lock down the PC running terminal services as that is its only use.

    Read the article

  • Google Chrome mouse wheel takes keyboard focus

    - by Steve Crane
    I recently switched the default browser on all my machines from Firefox to Google Chrome. In general I’m loving Chrome but there is one behaviour that is driving me nuts. Scrolling with the mouse wheel takes keyboard focus away from the document. Here’s what happens. I’ve just opened a page or switched to a new tab and the page has keyboard focus as I can use the keyboard up/down and PgUp/PgDn keys to scroll it; no problem there. But if I then use the wheel on my mouse to scroll the page, it loses the keyboard focus and no longer responds to up/down, PgUp/PgDn, or in fact any other keyboard keys. I have to click on the page background to restore the keyboard focus. This is a minor inconvenience for scrolling but where it really drives me nuts is in Google Reader and Gmail where I use keyboard shortcuts a lot. Here I find that I scroll the article or e-mail I’m reading with the mouse wheel then get no response when I press j/k to move to the next or previous article or e-mail. I am using Windows 7 and the Chrome dev channel (version 4.0.249.43).

    Read the article

  • Can't make virtual host working

    - by sica07
    I have to create a virtual host on a server which, previously hosted a single website (domain name). Now I'm trying to add a second domain on this server (using the same nameserver). What I've done so far: Initially there was no virtual host so I've made one for the second domain: NameVirtualHost *:80 <VirtualHost *:80> DocumentRoot /var/www/bla ServerName www.blabla.com ServerAlias blabla.com <Directory /var/www/blabla> Order deny,allow Allow from all AllowOverride All </Directory> </VirtualHost *:80> Because nothing happend, I changed the DocumentRoot of the apache server to /var/www (initially was the root document of the first website -/var/www/html) and created a virtual host for the first domain too: <VirtualHost *:80> DocumentRoot /var/www/html ServerName www.first.com ServerAlias first.com <Directory /var/www/html> Order deny,allow Allow from all AllowOverride All </Directory> </VirtualHost *:80> In this case, first.com is working ok, but bla.com not. When I ping blabla.com I get the "unkown host" response. What am I doing wrong? Do I have to modify something in the DNS settings too? Thank you.

    Read the article

  • Getting Error while running RED5 server - class path resource [red5.xml] cannot be opened because it does not exist

    - by sunil221
    HI , I have installed java version "1.6.0_14" and Ant version 1.8.2 for red5 Server. when i am trying to run red5 server i am getting the following error please help Root: /usr/local/red5 Deploy type: bootstrap Logback selector: org.red5.logging.LoggingContextSelector Setting default logging context: default 11:27:39.838 [main] INFO org.red5.server.Launcher - Red5 Server 1.0.0 RC1 $Rev: 4171 $ (http://code.google.com/p/red5/) Red5 Server 1.0.0 RC1 $Rev: 4171 $ (http://code.google.com/p/red5/) SLF4J: Class path contains multiple SLF4J bindings. SLF4J: Found binding in [jar:file:/usr/local/red5/red5.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: Found binding in [jar:file:/usr/local/red5/lib/logback-classic-0.9.26.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: See http://www.slf4j.org/codes.html#multiple_bindings for an explanation. 11:27:39.994 [main] INFO o.s.c.s.FileSystemXmlApplicationContext - Refreshing org.springframework.context.support.FileSystemXmlApplicationContext@39d85f79: startup date [Mon Dec 21 11:27:39 EST 2009]; root of context hierarchy 11:27:40.149 [main] INFO o.s.b.f.xml.XmlBeanDefinitionReader - Loading XML bean definitions from class path resource [red5.xml] Exception org.springframework.beans.factory.BeanDefinitionStoreException: IOException parsing XML document from class path resource [red5.xml]; nested exception is java.io.FileNotFoundException: class path resource [red5.xml] cannot be opened because it does not exist Bootstrap complete

    Read the article

  • o3d javascript uncaught referenceerror

    - by David
    hey, im new to javascript and am intersted in creating a small o3d script: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Test Game Website</title> </head> <body> <script type="text/javascript" src="o3djs/base.js"></script> <script type = "text/javascript" id="myscript"> o3djs.require('o3djs.camera'); window.onload = init; function init(){ document.write("jkjewfjnwle"); } </script> <div align="background"> <div id="game_container" style="margin: 0px auto; clear: both; background-image: url('./tmp.png'); width: 800px; height:600px; padding: 0px; background-repeat: no-repeat; padding-top: 1px;"></div> </div> </body> </html> the browser cant seem to find o3djs/base.js in this line <script type="text/javascript" src="o3djs/base.js"></script> and gives me an uncaught referenceerror at this line o3djs.require('o3djs.camera'); Obviously, because it can't find the o3djs/base.js... I have installed the o3d pluggin from google and they say that should be IT ive tried on firefox, ie and chrome thanks

    Read the article

  • Integration of SharePoint 2010 with TFS2010

    - by Kabir Rao
    We have performed following steps as of now- Install TFS2010 10.0.30319.1 (RTM) on Windows Server 2008 R2 Enterprise(app tier) SQL 2008 SP1 with Cumulative update 2 on Windows Server 2008 R2 Enterprise(data tier) Reporting Service is installed on app tier. After this installation worked fine we installed SharePoint 2010 on app tier. After installation we followed http://blogs.msdn.com/b/team_foundation/archive/2010/03/06/configuring-sharepoint-server-2010-beta-for-dashboard-compatibility-with-tfs-2010-beta2-rc.aspx for configuration. We are not able to perform the last step described in the link as following error occured- TF249063: The following Web service is not available: http://apptier:31254/_vti_bin/TeamFoundationIntegrationService.asmx. This Web service is used for the Team Foundation Server Extensions for SharePoint Products. The underlying error is: The remote server returned an error: (404) Not Found.. Verify that the following URL points to a valid SharePoint Web application and that the application is available: http://apptier:31254. If the URL is correct and the Web application is operating normally, verify that a firewall is not blocking access to the Web application. We have also noticed that Document Folder in Team project also have red x. Please help. Thanks upfront.

    Read the article

  • Persistent static routes fail on MacOS 10.6.5 startup!

    - by verbalicious
    I'm unable to get static routes to persist a reboot on Mac OS 10.6.5. I've tried all of the methods prescribed in Google search results, and previous posts on this site. I've tried manually creating a launchd daemon, and used RouteSplit's launchd daemon to no avail. It's clear that the interface is not ready when these methods attempt to apply the route. This workstation in question is getting its IP from DHCP and probably hasn't gotten its DHCP lease when the command runs. We're able to apply the route by hand when logged in, but not through startup methods. Is there another way to apply this route by sneaking the command into something later, but before the login window appears to the user? Here is some relevant log info from system.log. You can see the "route: writing to routing socket: Network is unreachable" errors where my launchd script fires off. I've tried adding extra "sleep" and "ipconfig waitall" statements later in the script but this doesn't fly. Dec 15 19:30:41 localhost com.apple.launchd[1]: *** launchd[1] has started up. *** Dec 15 19:30:45 localhost mDNSResponder[18]: mDNSResponder mDNSResponder-258.13 (Oct 8 2010 17:10:30) starting Dec 15 19:30:47 localhost configd[15]: bootp_session_transmit: bpf_write(en1) failed: Network is down (50) Dec 15 19:30:47 localhost configd[15]: DHCP en1: INIT transmit failed Dec 15 19:30:47 localhost configd[15]: network configuration changed. Dec 15 19:30:47 Administrators-MacBook-Pro configd[15]: setting hostname to "Administrators-MacBook-Pro.local" Dec 15 19:30:47 Administrators-MacBook-Pro blued[16]: Apple Bluetooth daemon started Dec 15 19:30:52 Administrators-MacBook-Pro syslog[67]: routes.sh: Starting RouteSplit Dec 15 19:30:53 Administrators-MacBook-Pro com.apple.usbmuxd[41]: usbmuxd-207 built for iTunesTenOne on Oct 19 2010 at 13:50:35, running 64 bit Dec 15 19:30:54 Administrators-MacBook-Pro /System/Library/CoreServices/loginwindow.app/Contents/MacOS/loginwindow[50]: Login Window Application Started Dec 15 19:30:55 Administrators-MacBook-Pro bootlog[61]: BOOT_TIME: 1292459441 0 Dec 15 19:30:55 Administrators-MacBook-Pro syslog[86]: routes.sh: static route 192.168.0.0/23 192.168.2.2 Dec 15 19:30:55 Administrators-MacBook-Pro net.routes.static[65]: route: writing to routing socket: Network is unreachable Dec 15 19:30:55 Administrators-MacBook-Pro net.routes.static[65]: add net 192.168.0.0: gateway 192.168.2.2: Network is unreachable Dec 15 19:30:57 Administrators-MacBook-Pro org.apache.httpd[38]: httpd: Could not reliably determine the server's fully qualified domain name, using Administrators-MacBook-Pro.local for ServerName Dec 15 19:30:58 Administrators-MacBook-Pro loginwindow[50]: Login Window Started Security Agent Dec 15 19:30:58 Administrators-MacBook-Pro WindowServer[89]: kCGErrorFailure: Set a breakpoint @ CGErrorBreakpoint() to catch errors as they are logged. Dec 15 19:30:58 Administrators-MacBook-Pro com.apple.WindowServer[89]: Wed Dec 15 19:30:58 Administrators-MacBook-Pro.local WindowServer[89] <Error>: kCGErrorFailure: Set a breakpoint @ CGErrorBreakpoint() to catch errors as they are logged. Dec 15 19:31:18 Administrators-MacBook-Pro configd[15]: network configuration changed. Dec 15 19:31:19 administrators-macbook-pro configd[15]: setting hostname to "administrators-macbook-pro.local" Dec 15 19:31:25 administrators-macbook-pro _mdnsresponder[121]: /usr/libexec/ntpd-wrapper: scutil key State:/Network/Global/DNS not present after 30 seconds Dec 15 19:31:25 administrators-macbook-pro _mdnsresponder[124]: sntp options: a=2 v=1 e=0.100 E=5.000 P=2147483647.000 Dec 15 19:31:25 administrators-macbook-pro _mdnsresponder[124]: d=15 c=5 x=0 op=1 l=/var/run/sntp.pid f= time.apple.com Dec 15 19:31:25 administrators-macbook-pro _mdnsresponder[124]: sntp: getaddrinfo(hostname, ntp) failed with nodename nor servname provided, or not known Dec 15 19:31:27 administrators-macbook-pro configd[15]: network configuration changed. Dec 15 19:31:27 Administrators-MacBook-Pro configd[15]: setting hostname to "Administrators-MacBook-Pro.local" Dec 15 19:31:27 Administrators-MacBook-Pro ntpd[37]: Cannot find existing interface for address 17.151.16.20 Dec 15 19:31:27 Administrators-MacBook-Pro ntpd_initres[125]: ntpd indicates no data available! Dec 15 19:31:31 Administrators-MacBook-Pro sshd[128]: USER_PROCESS: 133 ttys000 Dec 15 19:31:37 Administrators-MacBook-Pro sudo[138]: administrator : TTY=ttys000 ; PWD=/Users/administrator ; USER=root ; COMMAND=/usr/bin/less /var/log/system.log ``You can see the following line in /var/log/kernel.log that shows the en0 interface coming up: Dec 15 19:30:51 Administrators-MacBook-Pro kernel[0]: Ethernet [AppleBCM5701Ethernet]: Link up on en0, 1-Gigabit, Full-duplex, No flow-control, Debug [796d,0f01,0de1,0300,c1e1,3800]

    Read the article

  • Nginx + PHP-FPM = "Random" 502 Bad Gateway

    - by david
    I am running Nginx and proxying php requests via FastCGI to PHP-FPM for processing. I will randomly receive 502 Bad Gateway error pages - I can reproduce this issue by clicking around my PHP websites very rapidly/refreshing a page for a minute or two. When I get the 502 error page all I have to do is refresh the browser and the page refreshes properly. Here is my setup: nginx/0.7.64 PHP 5.3.2 (fpm-fcgi) (built: Apr 1 2010 06:42:04) Ubuntu 9.10 (Latest 2.6 Paravirt) I compiled PHP-FPM using this ./configure directive ./configure --enable-fpm --sysconfdir=/etc/php5/conf.d --with-config-file-path=/etc/php5/conf.d/php.ini --with-zlib --with-openssl --enable-zip --enable-exif --enable-ftp --enable-mbstring --enable-mbregex --enable-soap --enable-sockets --disable-cgi --with-curl --with-curlwrappers --with-gd --with-mcrypt --enable-memcache --with-mhash --with-jpeg-dir=/usr/local/lib --with-mysql=/usr/bin/mysql --with-mysqli=/usr/bin/mysql_config --enable-pdo --with-pdo-mysql=/usr/bin/mysql --with-pdo-sqlite --with-pspell --with-snmp --with-sqlite --with-tidy --with-xmlrpc --with-xsl My php-fpm.conf looks like this (the relevant parts): ... <value name="pm"> <value name="max_children">3</value> ... <value name="request_terminate_timeout">60s</value> <value name="request_slowlog_timeout">30s</value> <value name="slowlog">/var/log/php-fpm.log.slow</value> <value name="rlimit_files">1024</value> <value name="rlimit_core">0</value> <value name="chroot"></value> <value name="chdir"></value> <value name="catch_workers_output">yes</value> <value name="max_requests">500</value> ... I've tried increasing the max_children to 10 and it makes no difference. I've also tried setting it to 'dynamic' and setting max_children to 50, and start_server to '5' without any difference. I have tried using both 1 and 5 nginx worker processes. My fastcgi_params conf looks like: fastcgi_connect_timeout 60; fastcgi_send_timeout 180; fastcgi_read_timeout 180; fastcgi_buffer_size 128k; fastcgi_buffers 4 256k; fastcgi_busy_buffers_size 256k; fastcgi_temp_file_write_size 256k; fastcgi_intercept_errors on; fastcgi_param QUERY_STRING $query_string; fastcgi_param REQUEST_METHOD $request_method; fastcgi_param CONTENT_TYPE $content_type; fastcgi_param CONTENT_LENGTH $content_length; fastcgi_param SCRIPT_NAME $fastcgi_script_name; fastcgi_param REQUEST_URI $request_uri; fastcgi_param DOCUMENT_URI $document_uri; fastcgi_param DOCUMENT_ROOT $document_root; fastcgi_param SERVER_PROTOCOL $server_protocol; fastcgi_param GATEWAY_INTERFACE CGI/1.1; fastcgi_param SERVER_SOFTWARE nginx/$nginx_version; fastcgi_param REMOTE_ADDR $remote_addr; fastcgi_param REMOTE_PORT $remote_port; fastcgi_param SERVER_ADDR $server_addr; fastcgi_param SERVER_PORT $server_port; fastcgi_param SERVER_NAME $server_name; fastcgi_param REDIRECT_STATUS 200; Nginx logs the error as: [error] 3947#0: *10530 connect() failed (111: Connection refused) while connecting to upstream, client: 68.40.xxx.xxx, server: www.domain.com, request: "GET /favicon.ico HTTP/1.1", upstream: "fastcgi://127.0.0.1:9000", host: "www.domain.com" PHP-FPM logs the follow at the time of the error: [NOTICE] pid 17161, fpm_unix_init_main(), line 255: getrlimit(nofile): max:1024, cur:1024 [NOTICE] pid 17161, fpm_event_init_main(), line 93: libevent: using epoll [NOTICE] pid 17161, fpm_init(), line 50: fpm is running, pid 17161 [DEBUG] pid 17161, fpm_children_make(), line 403: [pool default] child 17162 started [DEBUG] pid 17161, fpm_children_make(), line 403: [pool default] child 17163 started [DEBUG] pid 17161, fpm_children_make(), line 403: [pool default] child 17164 started [NOTICE] pid 17161, fpm_event_loop(), line 111: ready to handle connections My CPU usage maxes out around 10-15% when I recreate the issue. My Free mem (free -m) is 130MB I had this intermittent 502 Bad Gateway issue when in was using php5-cgi to service my php requests as well. Does anyone know how to fix this?

    Read the article

  • PHP 5.3 on IIS gives 404 error in CGI mode

    - by reinier
    Slowly losing my mind here. I had PHP 5.2 working fine (ISAPI) under IIS, but for some extension I needed 5.3. So no worries, I installed this but it turns out ISAPI is not supplied anymore. I followed the install tutorials for fastcgi and ended up with a 500 internal server error for every PHP page served. So my current situation is: I have fastcgi removed. In my websites I have added PHP (head, get, post) and routed them to c:\php\php-cgi.exe. Result: every PHP page I try (even the ones with just text) gives 404 not found error. Any HTML file I put in the same folder, serves without a hitch. Who can help me please... How hard can something like this be right? For me apparently very hard. Extra information: ran the installer as suggested below. Set it to use fastcgi. my fcgiext.ini file looks like this now: [types] php=c:\php\php-cgi.exe [c:\php\php-cgi.exe] exepath=c:\php\php-cgi.exe from the command-line a 3 line PHP file with just phpinfo(); works fine from the server the same PHP file with just phpinfo(); results in the internal server 500 error. from the server a PHP file with just text works fine when changing the document types in IIS management console and point the PHP extension directly to c:\php\php-cgi.exe results in 404 for every PHP file the php.ini is the php.ini.production file which came in the distribution. No edits were made. Setting the IIS PHP handler directly to PHP (not via fastcgi) c:\php\php-cgi.exe results in the following: display a PHP page with only text....works fine display a page with only phpinfo(); results in 404 not found

    Read the article

  • Getting Error while running RED5 server - class path resource [red5.xml] cannot be opened because it does not exist

    - by sunil221
    HI , I have installed java version "1.6.0_14" and Ant version 1.8.2 for red5 Server. when i am trying to run red5 server i am getting the following error please help Root: /usr/local/red5 Deploy type: bootstrap Logback selector: org.red5.logging.LoggingContextSelector Setting default logging context: default 11:27:39.838 [main] INFO org.red5.server.Launcher - Red5 Server 1.0.0 RC1 $Rev: 4171 $ (http://code.google.com/p/red5/) Red5 Server 1.0.0 RC1 $Rev: 4171 $ (http://code.google.com/p/red5/) SLF4J: Class path contains multiple SLF4J bindings. SLF4J: Found binding in [jar:file:/usr/local/red5/red5.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: Found binding in [jar:file:/usr/local/red5/lib/logback-classic-0.9.26.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: See http://www.slf4j.org/codes.html#multiple_bindings for an explanation. 11:27:39.994 [main] INFO o.s.c.s.FileSystemXmlApplicationContext - Refreshing org.springframework.context.support.FileSystemXmlApplicationContext@39d85f79: startup date [Mon Dec 21 11:27:39 EST 2009]; root of context hierarchy 11:27:40.149 [main] INFO o.s.b.f.xml.XmlBeanDefinitionReader - Loading XML bean definitions from class path resource [red5.xml] Exception org.springframework.beans.factory.BeanDefinitionStoreException: IOException parsing XML document from class path resource [red5.xml]; nested exception is java.io.FileNotFoundException: class path resource [red5.xml] cannot be opened because it does not exist Bootstrap complete

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Windows 2008 Unknown Disks

    - by Ailbe
    I have a BL460c G7 blade server with OS Windows 2008 R2 SP1. This is a brand new C7000 enclosure, with FlexFabric interconnects. I got my FC switches setup and zoned properly to our Clariion CX4, and can see all the hosts that are assigned FCoE HBAs on both paths in both Navisphere and in HP Virtual Connect Manager. So I went ahead and created a storage group for a test server, assigned the appropriate host, assigned the LUN to the server. So far so good, log onto server and I can see 4 unknown disks.... No problem, I install MS MPIO, no luck, can't initialize the disks, and the multiple disks don't go away. Still no problem, I install PowerPath version 5.5 reboot. Now I see 3 disks. One is initialized and ready to go, but I still have 2 disks that I can't initialize, can't offline, can't delete. If I right click in storage manager and go to properties I can see that the MS MPIO tab, but I can't make a path active. I want to get rid of these phantom disks, but so far nothing is working and google searches are showing up some odd results, so obviously I'm not framing my question right. I thought I'd ask here real quick. Does anyone know a quick way to get rid of these unknown disks. Another question, do I need the MPIO feature installed if I have PowerPath installed? This is my first time installing Windows 2008 R2 in this fashion and I'm not sure if that feature is needed or not right now. So some more information to add to this. It seems I'm dealing with more of a Windows issue than anything else. I removed the LUN from the server, uninstalled PowerPath completely, removed the MPIO feature from the server, and rebooted twice. Now I am back to the original 4 Unknown Disks (plus the local Disk 0 containing the OS partition of course, which is working fine) I went to diskpart, I could see all 4 Unknown disks, I selected each disk, ran clean (just in case i'd somehow brought them online previously as GPT and didn't realize it) After a few minutes I was no longer able to see the disks when I ran list disk. However, the disks are still in Disk Management. When I try and offline the disks from Disk Management I get an error: Virtual Disk Manager - The system cannot find the file specified. Accompanied by an error in System Event Logs: Log Name: System Source: Virtual Disk Service Date: 6/25/2012 4:02:01 PM Event ID: 1 Task Category: None Level: Error Keywords: Classic User: N/A Computer: hostname.local Description: Unexpected failure. Error code: 2@02000018 Event Xml: 1 2 0 0x80000000000000 4239 System hostname.local 2@02000018 I feel sure there is a place I can go in the Registry to get rid of these, I just can't recall where and I am loathe to experiement. So to recap, there are currently no LUNS attached at all, I still have the phantom disks, and I'm getting The system cannot find the file specified from Virtual Disk Manager when I try to take them offline. Thanks!

    Read the article

  • IIS 7.5 / Windows 7: Error 500.19, error code 0x800700b7

    - by nikhiljoshi
    I have been trying to resolve this issue. I am using Windows 7 and VS2008 +iis7.5. My project is stuck because of this error. The error says: Error Summary HTTP Error 500.19 - Internal Server Error The requested page cannot be accessed because the related configuration data for the page is invalid. `Detailed Error Information Module IIS Web Core Notification BeginRequest Handler Not yet determined Error Code 0x800700b7 Config Error There is a duplicate 'system.web.extensions/scripting/scriptResourceHandler' section defined Config File \\?\C:\inetpub\wwwroot\test23\web.config Requested URL http://localhost:80/test23 Physical Path C:\inetpub\wwwroot\test23 Logon Method Not yet determined Logon User Not yet determined Config Source 15: <sectionGroup name="scripting" type="System.Web.Configuration.ScriptingSectionGroup, System.Web.Extensions, Version=3.5.0.0, Culture=neutral, PublicKeyToken=31BF3856AD364E35"> 16: <section name="scriptResourceHandler" type="System.Web.Configuration.ScriptingScriptResourceHandlerSection, System.Web.Extensions, Version=3.5.0.0, Culture=neutral, PublicKeyToken=31BF3856AD364E35" requirePermission="false" allowDefinition="MachineToApplication"/> 17: <sectionGroup name="webServices" type="System.Web.Configuration.ScriptingWebServicesSectionGroup, System.Web.Extensions, Version=3.5.0.0, Culture=neutral, PublicKeyToken=31BF3856AD364E35"> ` I followed the instructions in this Microsoft solution document, but it didn't help. http://support.microsoft.com/kb/942055

    Read the article

  • Remote search system for samba shares

    - by fostandy
    I have several shares residing on a samba server in a small business environment that I would like to provide search facilities for. Ideally this would be something like google desktop with some extra features (see below), but lacking this the idea is to take what I can get, or at least get an idea for what is out there. Using google desktop search as a reference model, the principle additional requirement is that it is usable from clients over the network. In addition there are some other notes (note that none of these are hard requirements) The content is always files, residing on a single server, accessible from samba shares. Standard ms office document fare Also a lot of rars and zips which it is necessary to search inside. Permissions support, allowing for user-based control to reflect current permission access in samba shares. The userbase will remain fairly static, so manual management of users is fine. majority of users will be Windows based I know there are plenty of search indexers out there: beagle and tracker seem to be the most popular. Most do not seem to offer access control and web-based/remote search does not seem to be high priority. I've also seen a recent post on the samba mailing list asking for pretty much the exact same thing. (They mention a product called IBM OmniFind Yahoo! Edition and while their initial reception seems positive, I am pretty skeptical. RHEL 4? Firefox 2? Updated much?) What else is out there? Are you in a similar situation? What do you use?

    Read the article

  • Network Restructure Method for Double-NAT network

    - by Adrian
    Due to a series of poor network design decisions (mostly) made many years ago in order to save a few bucks here and there, I have a network that is decidedly sub-optimally architected. I'm looking for suggestions to improve this less-than-pleasant situation. We're a non-profit with a Linux-based IT department and a limited budget. (Note: None of the Windows equipment we have runs does anything that talks to the Internet nor do we have any Windows admins on staff.) Key points: We have a main office and about 12 remote sites that essentially double NAT their subnets with physically-segregated switches. (No VLANing and limited ability to do so with current switches) These locations have a "DMZ" subnet that are NAT'd on an identically assigned 10.0.0/24 subnet at each site. These subnets cannot talk to DMZs at any other location because we don't route them anywhere except between server and adjacent "firewall". Some of these locations have multiple ISP connections (T1, Cable, and/or DSLs) that we manually route using IP Tools in Linux. These firewalls all run on the (10.0.0/24) network and are mostly "pro-sumer" grade firewalls (Linksys, Netgear, etc.) or ISP-provided DSL modems. Connecting these firewalls (via simple unmanaged switches) is one or more servers that must be publically-accessible. Connected to the main office's 10.0.0/24 subnet are servers for email, tele-commuter VPN, remote office VPN server, primary router to the internal 192.168/24 subnets. These have to be access from specific ISP connections based on traffic type and connection source. All our routing is done manually or with OpenVPN route statements Inter-office traffic goes through the OpenVPN service in the main 'Router' server which has it's own NAT'ing involved. Remote sites only have one server installed at each site and cannot afford multiple servers due to budget constraints. These servers are all LTSP servers several 5-20 terminals. The 192.168.2/24 and 192.168.3/24 subnets are mostly but NOT entirely on Cisco 2960 switches that can do VLAN. The remainder are DLink DGS-1248 switches that I am not sure I trust well enough to use with VLANs. There is also some remaining internal concern about VLANs since only the senior networking staff person understands how it works. All regular internet traffic goes through the CentOS 5 router server which in turns NATs the 192.168/24 subnets to the 10.0.0.0/24 subnets according to the manually-configured routing rules that we use to point outbound traffic to the proper internet connection based on '-host' routing statements. I want to simplify this and ready All Of The Things for ESXi virtualization, including these public-facing services. Is there a no- or low-cost solution that would get rid of the Double-NAT and restore a little sanity to this mess so that my future replacement doesn't hunt me down? Basic Diagram for the main office: These are my goals: Public-facing Servers with interfaces on that middle 10.0.0/24 network to be moved in to 192.168.2/24 subnet on ESXi servers. Get rid of the double NAT and get our entire network on one single subnet. My understanding is that this is something we'll need to do under IPv6 anyway, but I think this mess is standing in the way.

    Read the article

  • Change the Default Date setting in Word 2010

    - by Chris
    I am using Word 2010 and Windows 7. You know how when you start typing a date in Word it will automatically suggest what it thinks you want? Like if I start typing “6/29”, a little grey bubble will display “6/29/13 (Press ENTER to Insert)”. How do I get it so the bubble will display the year in a 4 digit format, such as "6/29/2013 (Press Enter to Insert)"? The below picture is how it looks when typing a date into Word. I have already gone to the Date & Time option under the Insert menu and the date format that I want is already selected. I think this is only for using quickparts anyway, so the date automatically updates when you open a document. The Region and Language settings under the Control Panel are correct as well. I thought at one point I found it somewhere under options, but I am sure I looked through everything many times and I can’t find it. I posted this exact question at the Microsoft website and someone replied: Go to the Windows Control Panel and click on Clock, Language and Region and then on Change the date, time, or number format and then modify the Short date format so that it is what you want to be used. So please don't suggest this again, because in my question I did say that I already tried this and it doesn't work, at least not for Word, in this situation. Thanks.

    Read the article

  • Software for handling camera RAW-files

    - by Eikern
    I use a digital SLR as most other photographers do today and have quickly realised that capturing images using camera-RAW files is the way to go. Personally I use Adobe Lightroom to handle my photo library, but I know there are other software available like Apple Aperture. These applications are quite hard to use for a novice, and are quite expensive too. I've often recommended other photographers to switch to camera-raw, but they won't do it because Windows can't handle it natively. Are there any free or cheaper applications out there that can do simple file handling and adjustments? Preferably so simple that my mom can do it. I know Nikon offers a codec that allows you to view NEF-files natively inside Windows, but still limits the uses of the file and slows the system down if the file is big. Does anybody know of a drag-and-drop application that converts camera-raw to JPG on-the-fly? In case I or someone would need to upload an image to the web or use it inside a word-document. Thanks.

    Read the article

  • Pasting formatted Excel range into Outlook message

    - by Steph
    Hi everyone, I am using Office 2007 and I would like to use VBA to paste a range of formatted Excel cells into an Outlook message and then mail the message. In the following code (that I lifted from various sources), it runs without error and then sends an empty message... the paste does not work. Can anyone see the problem and better yet, help with a solution? Thanks, -Steph Sub SendMessage(SubjectText As String, Importance As OlImportance) Dim objOutlook As Outlook.Application Dim objOutlookMsg As Outlook.MailItem Dim objOutlookRecip As Outlook.Recipient Dim objOutlookAttach As Outlook.Attachment Dim iAddr As Integer, Col As Integer, SendLink As Boolean 'Dim Doc As Word.Document, wdRn As Word.Range Dim Doc As Object, wdRn As Object ' Create the Outlook session. Set objOutlook = CreateObject("Outlook.Application") ' Create the message. Set objOutlookMsg = objOutlook.CreateItem(olMailItem) Set Doc = objOutlookMsg.GetInspector.WordEditor 'Set Doc = objOutlookMsg.ActiveInspector.WordEditor Set wdRn = Doc.Range wdRn.Paste Set objOutlookRecip = objOutlookMsg.Recipients.Add("[email protected]") objOutlookRecip.Type = 1 objOutlookMsg.Subject = SubjectText objOutlookMsg.Importance = Importance With objOutlookMsg For Each objOutlookRecip In .Recipients objOutlookRecip.Resolve ' Set the Subject, Body, and Importance of the message. '.Subject = "Coverage Requests" 'objDrafts.GetFromClipboard Next .Send End With Set objOutlookMsg = Nothing Set objOutlook = Nothing End Sub

    Read the article

  • Apache2 with lighttpd as proxy

    - by andrzejp
    Hi, I am using apache2 as web server. I would like to help him lighttpd as a proxy for static content. Unfortunately I can not well set up lighttpd and apache2. (OS: Debian) Important things from lighttpd.config: server.modules = ( "mod_access", "mod_alias", "mod_accesslog", "mod_proxy", "mod_status", ) server.document-root = "/www/" server.port = 82 server.bind = "localhost" $HTTP["remoteip"] =~ "127.0.0.1" { alias.url += ( "/doc/" => "/usr/share/doc/", "/images/" => "/usr/share/images/" ) $HTTP["url"] =~ "^/doc/|^/images/" { dir-listing.activate = "enable" } } I would like to use lighttpd in only one site operating as a virtual directory on apache2. Configuration of this virtual directory: ProxyRequests Off ProxyPreserveHost On ProxyPass /images http://0.0.0.0:82/ ProxyPass /imagehosting http://0.0.0.0:82/ ProxyPass /pictures http://0.0.0.0:82/ ProxyPassReverse / http://0.0.0.0:82/ ServerName MY_VALUES ServerAlias www.MY_VALUES UseCanonicalName Off DocumentRoot /www/MYAPP/forum <Directory "/www/MYAPP/forum"> DirectoryIndex index.htm index.php AllowOverride None ... As you can see (or not;)) my service is physically located at the path: / www / myapp / forum and I would like to support lighttpd dealt with folders: / www / myapp / forum / images / www / myapp / forum / imagehosting / www / myapp / forum / pictures and left the rest (PHP scripts) for apache After running lighttpd and apache2 working party, but did not show up any images of these locations. What is wrong?

    Read the article

< Previous Page | 564 565 566 567 568 569 570 571 572 573 574 575  | Next Page >