Search Results

Search found 21728 results on 870 pages for 'download location'.

Page 57/870 | < Previous Page | 53 54 55 56 57 58 59 60 61 62 63 64  | Next Page >

  • Kickstart installation from USB -- Kickstart location

    - by dooffas
    After managing to get a Fedora ISO to rebuild successfully (for a USB stick) after adding a kickstart file (http://serverfault.com/questions/548405/), I now have an issue with locating the kickstart file on the USB media. When this is done from a CDROM you can simply kickckstart by adding this parameter to boot: linux ks=cdrom This will kickstart (providing the kickstart file is named ks.cfg and is in the root of the disk). Now, obviously this will be different for the USB drive, so from my research, I assumed that this line would do the job: linux ks=hd:sdb1:/ks.cfg Evidently this does not work. I get an error informing me this drive is already mounted and cannot be remounted. EDIT: Actual error message: mount: /dev/sdb1 is already mounted or /run/install/tmpmnt0 busy Warning: Can't get kickstart from /dev/sdb1:/ks.cfg To test that the syntax was correct I placed the kickstart file on another USB stick and loaded the same command to grab ks.cfg from the new location: linux ks=hd:sdc1:/ks.cfg This does work (providing USB sticks are mounted in order, boot - sdb1, kickstart - sdc1). The install will kickstart and complete the install with no issue. Obviously having to use 2 pen drives is somewhat frustrating and unreliable. Is there a way around this?

    Read the article

  • samba4 dc "network location cannot be reached"

    - by mitchell babies peters
    to clear the air centos 6.4? (maybe 6.3) as the server, running samba 4.0.10, trying to add a windows 7 client that has connectivity to the server. this is what windows shouts as me as it mocks my dependence on network infrastructure. "the network location cannot be reached." i have access to the domain contoller (dc) im using the dc as the domain name server (dns) already, and the name is correctly resolving, and it is correctly forwarding outbound traffic. i have nothing but self taught experience with active directory(ad) so if i am missing something obvious, please shout it out, but keep the verbal abuse to a minimum. i checked samba4DC + my error and found nothing relevant to my issue, if i missed something please point me in that direction. the weekend is just starting as i write this so i probably wont be back on to check this post for a day or three, but i might because this mystery is killing me. i followed the samba4 as a dc guide here and i supplimented gaps with this i have tested kerberos, ntp, and set my DC as the clock to sync to in my windows client and it appears to be a very small fraction of a second off so that shouldn't be it. also, firewall and selinux are both off for testing. i have also tried disabling ipv6, and cleared the registry of ipv6 records (allegedly the default samba4 as a DC runs as windows server 2003 which allegedly does not support or tolerate the existence of ipv6, fair warning, i heard this on the internet so it is probably a lie) i have tried a few other things that i have forgotten because i have been doing this for a day and a half now. ideas welcome. suggestions for alternatives are also welcome, as long as they are free. i was given a budget of $0 dollars and told to implement active directory (no prior knowledge of active directory at that point).

    Read the article

  • How can I enable PHP5 for a site? Having problems with every single method.

    - by John Stephens
    I'm working on a client site that is hosted on someone's DIY Debian Linux server [Apache/1.3.33 (Debian GNU/Linux)], and I'm trying to install a script that requires PHP5. By default, the server parses .php files with PHP 4.3.10-22, which is configured at /etc/php4/apache/php.ini, according to phpinfo(). On the server I can see a config directory for PHP5 adjacent to the PHP4 directory: /etc/php5.0/apache2/php.ini. I have tried multiple methods to enable PHP5 for the document root where the site's files are hosted, including all available methods mentioned here. By far, the most common suggestion I've found is to add one or both of the following lines to the site's .htaccess file: AddHandler application/x-httpd-php5 .php AddType application/x-httpd-php5 .php Trouble is, when either or both of those lines are present, the site forces my browser to download any .php files requested, without parsing the PHP at all. All of the other methods mentioned in the above article cause a 500 Internal Server Error. There is no hosting control panel I can access in a browser to enable PHP5 for the site, but I do have shell access. When I asked the server administrator about this issue, he encouraged me to search for the answer on Google. Where could I begin to troubleshoot this issue? Are there ways to test or verify the server's specific PHP5 installation and configuration, using the command line or some other method? Do you have other suggestions to enable PHP5?

    Read the article

  • Moving Farm to co-location hosting - network settings requirements

    - by Saariko
    I am moving my farm (2 Dell's R620) to a co-location hosting service. I am trying to figure out the secure way to have my network settings The requirements are: VM1 is the working HOST, includes: esxi 5.1, vSphere, 4 clients (w2008r2 all) VM2 has esxi 5.1 installed, and a single machine with Veeam Backup and copy 6.5 - keeping a copy of VM1 clients on the VM2 internal storage (this solution is due to a very small budget - in case of failure on Host 1 - can redirect IP's) Only 2 VM clients require network address and access from the WWAN - ISP provides IP's range for them (with Gateway and DNS) I need connection to the iDrac's from my office (option to create a VPN-SSL tunnel) Connection to the vSphere appliances I want to be able to RDP to the VM clients The current configuration is that each host has the iDrac dedicated nic connected , and another (NIC #1) connected - with a static IP on 192.168.3.x The iDrac's have a static IP from the same network range (19.168.3.x) It will look something like this: My thoughts: On NIC#2 of both hosts I will connected a crossed cable I will give each VM clients that needs internet access a 2ndry VM network with the assigned IP from the ISP open only to web - can not access from the My Question: Should I give IP's (external) to the machines who DO NOT require WWAN Access? - I can't see a way to RDP to them directly if not. Should I use the crossed cable? or just plug NIC #2 to the switch? Will this setup even work? What do I need to verify? What Virtual nic's and/or switches should I create on the Hosts?

    Read the article

  • How to start using twill?

    - by brilliant
    How do I start using twill? I have just downloaded it, unpacked it and clicked on the setup .py file in the folder. The black window (terminal) appeared for a moment and vanished. (I do have Python 2.5 installed on my computer - along with SDK from Google App Engine) In the twill documentation section it says: Downloading twill The latest release of twill is twill 0.9, released Thursday, December 27th, 2007; it is available for download at http://darcs.idyll.org/~t/projects/twill-0.9.tar.gz. You can also use Python's easy_install to install or upgrade twill. twill works with Python 2.3 or later. To start using twill, install it and then type twill-sh. At the prompt type: go http://www.slashdot.org/ show showforms showhistory I am not clear from this passage what I am supposed to type (only "twill-sh" or "twill-sh" and all the words under that line) and where (I tried typing it in the command prompt window of my computer - to no avail) Can, anyone, please, help me out here? Thank You in advance.

    Read the article

  • WSUS trying to download all updates again

    - by Tim Alexander
    The server hosting WSUS had a catastrophic failure and we have had to rebuild the system drives. Luckily the DB and content store for WSUS are on a seperate drive so were unaffected. During the rebuild process we thought it was time to update the server to 2008 R2 (from 2003 R2). Have got the server running and installed the WSUS role, detached the DB form SQL Express 2008 R2 and attached the original. Carried out the wsusutil.exe movecontent command with a -skipcopy switch pointing to the original content store. All looked good until I saw the front page stating it is trying to download files for 6,436 updates at around 344,565 MB!!!!!! Oops, I thought, something not right here. The content store I have on disk is only 75GB but I am thinking that some vital step has been missed in the restoration process. Either way is there a way to make WSUS reindex its local content store or something as I am unsure that downloading 344 gigabytes is a viable way forward! EDIT: Never rains but it pours. AM now getting a CLSID: FX {8b6499ed-0241-e032-6508-da4b1c879d7e} error could not create snap in. think a reinstall of WSUS is in order.

    Read the article

  • SkyDrive broken after upgrade to Windows 8.1: "This location can't be found, please try later"

    - by avo
    Upgrading from Windows 8 to Windows 8.1 via the Store upgrade path has screwed my SkyDrive. The C:\Users\<user name>\SkyDrive folder is empty (it only has single file desktop.ini). When I open the native (Store) SkyDrive app, I see "This location can't be found, please try later". I'm glad to still have my files alive online in my SkyDrive account. I tried disconneting from / reconnecting to my Microsoft Account with no luck. Anyone has an idea on how to fix this without reinstalling/refreshing Windows 8.1? From Event Viewer: Faulting application name: skydrive.exe, version: 6.3.9600.16412, time stamp: 0x5243d370 Faulting module name: unknown, version: 0.0.0.0, time stamp: 0x00000000 Exception code: 0x00000000 Fault offset: 0x0000000000000000 Faulting process ID: 0x4e8 Faulting application start time: 0x01cece256589c7ee Faulting application path: C:\Windows\System32\skydrive.exe Faulting module path: unknown Report ID: {...} Faulting package full name: Faulting package-relative application ID: Also: The machine-default permission settings do not grant Local Activation permission for the COM Server application with CLSID {C2F03A33-21F5-47FA-B4BB-156362A2F239} and APPID {316CDED5-E4AE-4B15-9113-7055D84DCC97} to the user NT AUTHORITY\LOCAL SERVICE SID (S-1-5-19) from address LocalHost (Using LRPC) running in the application container Unavailable SID (Unavailable). This security permission can be modified using the Component Services administrative tool. Never was a big fan of in-place upgrade anyway, but this time it was a machine which I use for work, with a lot of stuff already installed on it. Shouldn't have tried to upgrade it in the first place, but was convinced Windows 8.1 is a solid update. Another lesson learnt.

    Read the article

  • Download JDK onto a remote server

    - by itsadok
    I want to get the latest JDK onto a server in a remote location. Downloading the JDK from Sun's website requires jumping through all kinds of hoops until you actually get the file. I'm not sure exactly if they use cookies or my IP address, but simply copying the file URL and trying wget on the server doesn't work. Googling for mirrors of the JDK, I could only find old versions. Right now I'm left with the option of downloading it into my computer, then uploading it to the server. This feels slow and stupid. Anyone got a better idea? EDIT: Thanks for all the replies. Just to clarify, as I'm writing this I'm rsyncing the 78MB file to my server. It should be done in about an hour, so it's not such a big deal. However, since this is not the first time I'm doing this, I was hoping for a better solution for next time. Solution: What I ended up doing was sudo aptitude install lynx-cur www-browser http://java.sun.com/javase/downloads/ From there it's mostly using the arrow and enter keys, and answering "Yes" to a lot of lynx security questions (about cookies and certificates). Thanks to resonator.

    Read the article

  • Default /server-status location not inheriting in Apache

    - by rmalayter
    I'm having a problem getting /server-status to work Apache 2.2.14 on Ubuntu Server 10.04.1. The default symlinks for status.load and status.conf are present in /etc/apache2/mods-enabled. The status.conf does include the location /server-status and appropriate allow/deny directives. However, the only vhost I have in sites-enabled looks like this. The idea is to proxy anything with a Tomcat URL to a cluster of tomcats, and anything else to an IIS box. However, this seems to result in requests to /server-status being sent to IIS. Copying the /server-status in explicitly to the Vhost configuration doesn't seem to help, no matter what order I use. Is it possible to include /server-status do this within a vhost configuration that has a "default" proxy rule?: <VirtualHost *:80> ServerAdmin webmaster@localhost DocumentRoot /var/www Header add Set-Cookie "ROUTEID=.%{BALANCER_WORKER_ROUTE}e; path=/" env=BALANCER_ROUTE_CHANGED <Proxy balancer://tomcatCluster> BalancerMember ajp://qa-app1:8009 route=1 BalancerMember ajp://qa-app2:8009 route=2 ProxySet stickysession=ROUTEID </Proxy> <ProxyMatch "^/(mytomcatappA|mytomcatappB)/(.*)" > ProxyPassMatch balancer://tomcatCluster/$1/$2 </ProxyMatch> #proxy anything that's not a tomcat URL to IIS on port 80 <Proxy /> ProxyPass http://qa-web1/ </Proxy>

    Read the article

  • wget recursively download from pages with lots of links

    - by Shadow
    When using wget with the recursive option turned on I am getting an error message when it is trying to download a file. It thinks the link is a downloadable file when in reality it should just be following it to get to the page that actually contains the files(or more links to follow) that I want. wget -r -l 16 --accept=jpg website.com The error message is: .... since it should be rejected. This usually occurs when the website link it is trying to fetch ends with a sql statement. The problem however doesn't occur when using the very same wget command on that link. I want to know how exactly it is trying to fetch the pages. I guess I could always take a poke around the source although I don't know how messy the project is. I might also be missing exactly what "recursive" means in the context of wget. I thought it would run through and travel in each link getting the files with the extension I have requested. I posted this up over at stackOverFlow but they turned me over here:) Hoping you guys can help.

    Read the article

  • SVG doesn't work on subdomain - some browsers try to download rather than display

    - by John Catterfeld
    I have a site with a 'development' subdomain, which displays my SVG file exactly as intended. However when I copy it across to www, or any other subdomain (e.g. 'test') some browsers try to open the file in an external editor, therefore asking me to download the file rather than displaying it. For example: http://development.mysite.com/test.svg - works http://www.mysite.com/test.svg - doesn't work The SVG file: <?xml version="1.0" standalone="no"?> <!DOCTYPE svg PUBLIC "-//W3C//DTD SVG 1.1//EN" "http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd"> <svg xmlns="http://www.w3.org/2000/svg" version="1.1"> <circle cx="100" cy="50" r="40" stroke="black" stroke-width="2" fill="red" /> </svg> This happens in Firefox, Chrome and Safari, however IE9 and above display the file as intended. It is a Windows hosting, and I have <mimeMap fileExtension=".svg" mimeType="image/svg+xml" /> in my web.config file My hunch is that there must be some setting on the server which I need my hosting company to make. Can anyone suggest what might cause this issue?

    Read the article

  • Slow upload, fast download on Windows 7 64bit system

    - by Malik
    I've got a weird problem in the download speeds on my desktop PC (Windows 7 Home Premium 64bit) are consistently fast (approx. 400kB/s) but uploads are very slow (around 6-10kB/s). This has been going on for the last 3 weeks or so. I am a very competent user and troubleshooter, and have searched online for 2 weeks for a solution, to no avail. Part of the problem is that internet is provided by WiFi by my landlord and I have no access to the router (BT Home Hub router) although I know for sure he wouldn't have the first idea on how to restrict my usage :) (rules that out) Anyway, I've tried: - various drivers (my Wifi 'card' is TP-link TL-WN851N, and I've tried TP-link + Atheros + Qualcomm Atheross drivers, suggested by Microsoft) - various tweaks to network parameters (e.g. as suggested by SpeedOptimser) - various tweaks to Windows 7 services (e.g. disabling/manual-ing unecessary services) - raising and lowering head onto a reasonably firm surface at moderate frequency (jk :D) None of the above have helped, and I'm officialy asking for help now!! Thanks for your time and effort in advance!

    Read the article

  • Download - Upload is too slow on Centos

    - by Mehdi
    My download/upload in server and out of server is too slow (around 50 KB/s !) ! Did I miss some configuration ? Some information: CentOS release 6.3 uptime load average: 0.17, 0.32, 0.37 Memory free -m total used free shared buffers cached Mem: 24009 21988 2021 0 806 18098 -/+ buffers/cache: 3083 20926 Swap: 4095 28 4067 lshw -C network *-network description: Ethernet interface product: 82574L Gigabit Network Connection vendor: Intel Corporation physical id: 0 bus info: pci@0000:02:00.0 logical name: eth0 version: 00 serial: 00:25:90:70:17:4a size: 100MB/s capacity: 1GB/s width: 32 bits clock: 33MHz capabilities: pm msi pciexpress msix bus_master cap_list ethernet physical tp 10bt 10bt-fd 100bt 100bt-fd 1000bt-fd autonegotiation configuration: autonegotiation=off broadcast=yes driver=e1000e driverversion=1.9.5-k duplex=full firmware=2.1-2 ip=108.175.8.123 latency=0 link=yes multicast=yes port=twisted pair speed=100MB/s resources: irq:16 memory:fb900000-fb91ffff ioport:e000(size=32) memory:fb920000-fb923fff ethtool ethtool eth0 Settings for eth0: Supported ports: [ TP ] Supported link modes: 10baseT/Half 10baseT/Full 100baseT/Half 100baseT/Full 1000baseT/Full Supports auto-negotiation: Yes Advertised link modes: Not reported Advertised pause frame use: No Advertised auto-negotiation: No Speed: 100Mb/s Duplex: Full Port: Twisted Pair PHYAD: 1 Transceiver: internal Auto-negotiation: off MDI-X: off Supports Wake-on: pumbg Wake-on: g Current message level: 0x00000001 (1) Link detected: yes dmesg |grep e1000e dmesg |grep e1000e e1000e: Intel(R) PRO/1000 Network Driver - 1.9.5-k e1000e: Copyright(c) 1999 - 2012 Intel Corporation. e1000e 0000:02:00.0: Disabling ASPM L0s e1000e 0000:02:00.0: PCI INT A -> GSI 16 (level, low) -> IRQ 16 e1000e 0000:02:00.0: setting latency timer to 64 e1000e 0000:02:00.0: irq 33 for MSI/MSI-X e1000e 0000:02:00.0: irq 34 for MSI/MSI-X e1000e 0000:02:00.0: irq 35 for MSI/MSI-X e1000e 0000:02:00.0: eth0: (PCI Express:2.5GT/s:Width x1) 00:25:90:70:17:4a e1000e 0000:02:00.0: eth0: Intel(R) PRO/1000 Network Connection e1000e 0000:02:00.0: eth0: MAC: 3, PHY: 8, PBA No: FFFFFF-0FF e1000e: eth0 NIC Link is Up 100 Mbps Full Duplex, Flow Control: None e1000e 0000:02:00.0: eth0: 10/100 speed: disabling TSO e1000e: eth0 NIC Link is Up 100 Mbps Full Duplex, Flow Control: None e1000e 0000:02:00.0: eth0: 10/100 speed: disabling TSO e1000e: eth0 NIC Link is Up 100 Mbps Full Duplex, Flow Control: None e1000e 0000:02:00.0: eth0: 10/100 speed: disabling TSO e1000e: eth0 NIC Link is Up 100 Mbps Full Duplex, Flow Control: None e1000e: eth0 NIC Link is Up 100 Mbps Full Duplex, Flow Control: None e1000e 0000:02:00.0: eth0: 10/100 speed: disabling TSO e1000e 0000:02:00.0: eth0: 10/100 speed: disabling TSO e1000e 0000:02:00.0: eth0: Unsupported Speed/Duplex configuration e1000e: eth0 NIC Link is Up 10 Mbps Full Duplex, Flow Control: None e1000e 0000:02:00.0: eth0: 10/100 speed: disabling TSO e1000e: eth0 NIC Link is Up 100 Mbps Full Duplex, Flow Control: None e1000e 0000:02:00.0: eth0: 10/100 speed: disabling TSO e1000e: eth0 NIC Link is Up 100 Mbps Full Duplex, Flow Control: None e1000e 0000:02:00.0: eth0: 10/100 speed: disabling TSO e1000e 0000:02:00.0: Disabling ASPM L1 e1000e 0000:02:00.0: eth0: changing MTU from 1500 to 9000 e1000e: eth0 NIC Link is Up 100 Mbps Full Duplex, Flow Control: None e1000e 0000:02:00.0: eth0: 10/100 speed: disabling TSO e1000e: eth0 NIC Link is Up 100 Mbps Full Duplex, Flow Control: None e1000e 0000:02:00.0: eth0: 10/100 speed: disabling TSO e1000e: eth0 NIC Link is Up 100 Mbps Full Duplex, Flow Control: None e1000e 0000:02:00.0: eth0: 10/100 speed: disabling TSO

    Read the article

  • Skyrim: Heavy Performance Issues after a couple of location changes

    - by Derija
    Okay, I've tried different solutions: ENB Series, removing certain mods, checking my FPS Rate, monitoring my resources, .ini tweaks. It's all just fine, I don't see what I'm missing. A couple of days ago, I bought Skyrim. Before I bought the game, I admit I had a pirated copy because my girlfriend actually wanted to buy me the game as a present, then said she didn't have enough money. Sick of waiting, I decided to buy the game by myself. The ridiculous part is, it worked better cracked than it does now uncracked. As the title suggests, after entering and leaving houses a couple of times, my performance obviously drops extremely. My build is just fine, Intel i5 quad core processor, NVIDIA GTX 560 Ti from Gigabyte, actually stock-OC, but manually downclocked to usual settings using appropriate Gigabyte software. This fixed the CTD issues I had before with both Skyrim and BF3. I have 4GB RAM. A website about Game Tweaks suggested that my HDD may be too slow. A screenshot of a Windows Performance Index sample with the subscription "This is likely to cause issues" showed the HDD with a performance index of 5.9, the exact same mine has, so I was playing with the thought to purchase an SSD instead, load games onto it that really need it like Skyrim, and hope it'd do the trick. Unfortunately, SSDs are likewise expensive, compared to "normal" HDDs... I'm really getting desperate about it. My save is gone because the patches made it impossible to load saves of the unpatched version and I already saved more than 80 times despite being only level 8, just because every time I interact with a door leading me to another location I'm scared the game will drop again. I can't even play for 30 mins straight anymore, it's just no fun at all. I've researched for a couple of days before I decided to post my question here. Any help is appreciated, I don't want to regret having bought the game... Since it actually is the best game I've played possibly for ever. Sincerely. P.S.: I don't think it's necessary to say, but still, of course I'm playing on PC. P.P.S.: After monitoring both my PC resources including CPU usage and HDD usage as well as the GPU usage, I don't see any changes even after the said event. P.P.P.S.: Original question posted here where I've been advised to ask here.

    Read the article

  • filtering itunes library items by file location

    - by Cawas
    3 answers and unfortunately no solution yet. The Problem I've got way more than 1000 duplicated items in my iTunes Library pointing to a non-existant place (the "where" under "get info" window), along with other duplicated items and other MIAs (Missing In Action). Is there any simple way to just delete all of them and only them? From the library, of course. By that I mean some MIAs are pointing to /Volumes while some are pointing to .../music/Music/... or just .../music/.... I want to delete all pointing to /Volumes as to later I'll recover the rest. Check the image below. Some Background I tried searching for a specific key word on the path and creating smart play list, but with no result. Being able to just sort all library by path would be a perfect solution! I believe old iTunes could do that. PowerTunes can do it (sort by path) but I can't do anything with its list. I would also welcome any program able to handle this, then import and properly export back the iTunes library. Since this seems to just not be clear enough... AppleScript doesn't work That's because AppleScript just can't gather the missing info anywhere in iTunes Library. Maybe we could use AppleScript by opening the XML file, but that's a whole nother issue. Here's a quote from my conversation with Doug the man himself Adams last december: I don't think you do understand. There is no way to get the path to the file of a dead track because iTunes has "forgotten" it. That is, by definition, what a dead track is. Doug On Dec 21, 2010, at 7:08 AM, Caue Rego wrote: yes I understand that and have seem the script. but I'm not looking for the file. just the old broken path reference to it. Sent from my iPhone On 21/12/2010, at 10:00, Doug Adams wrote: You cannot locate missing files of dead tracks because, by definition, a dead track is one that doesn't have any file information. If you look at "Super Remove Dead Tracks", you will notice it looks for tracks that have "missing value" for the location property.

    Read the article

  • How to control the download url for dotNetFx35setup.exe without using the Visual Studio bootstrapper

    - by tronda
    Previously I've used to Visual Studio 2008 setup.bin to generate a bootstrapper. I had some issues with it which were difficult to resolve and turned to dotNetInstaller. One great thing with the VS 2008 generated bootstrapper, was that I was able to control the download location for the .NET framework. By using the MSBuild task I could specify the componentsLocation: <GenerateBootstrapper ApplicationFile="$(TargetFileName)" ApplicationName="MyApp" ApplicationUrl="http://$(InstallerHost)$(DownloadUrl)" BootstrapperItems="@(BootstrapperFile)" CopyComponents="True" ComponentsLocation="Relative" OutputPath="$(OutputPath)" Path="C:\Program Files\Microsoft SDKs\Windows\v6.0A\Bootstrapper\" /> Here I'm able to use the ComponentsLocation="Relative" and the bootstrapper would download from our own web server - which is what I want. When I no longer have the VS 2008 bootstrapper, I would like to have the same feature. The new boostrapper downloads the dotNetFx35setup.exe from a defined server, but the problem is that this ".NET bootstrapper" connects to Microsoft's servers for downloading the needed packages. Trying to run the following command: dotNetFx35setup.exe /? did not show any options to control the download location. The web server will contain the package structure which the Windows SDK (v6.0A) has within the Bootstrapper\Packages directory. The structure looks like this: Packages DotNetFX DotNetFX30 DotNetFX35 DotNetFx35Client DotNetFx35SP1 ..... When I state a dependency to the .NET Framework 3.5, the DotNetFX35 directory structure gets copied into the bin/Debug directory. I've copied this directory onto the web server and it looks like this: DotNetFX35 dotNetFX20 dotNetFX30 dotNetFX35 x64 netfx35_x64.exe x86 netfx35_x86.exe dotNetMSP dotNetFx35setup.exe The other directories contains mainly MSI, MSP and MSU files. So any pointers on how to control downloading of the .NET framework. Shouldn't I use the dotNetFx35setup.exe file? If not - which should I use?

    Read the article

  • Webclient using download file to grab file from server - handling exceptions

    - by baron
    Hello everyone, I have a web service in which I am manipulating POST and GET methods to facilitate upload / download functionality for some files in a client/server style architecture. Basically the user is able to click a button to download a specific file, make some changes in the app, then click upload button to send it back. Problem I am having is with the download. Say the user expects 3 files 1.txt, 2.txt and 3.txt. Except 2.txt does not exist on the server. So I have code like (on server side): public class HttpHandler : IHttpHandler { public void ProcessRequest { if (context.Request.HttpMethod == "GET") { GoGetIt(context) } } private static void GoGetIt(HttpContext context) { var fileInfoOfWhereTheFileShouldBe = new FileInfo(......); if (!fileInfoOfWhereTheFileShouldBe.RefreshExists()) { throw new Exception("Oh dear the file doesn't exist"); } ... So the problem I have is that when I run the application, and I use a WebClient on client side to use DownloadFile method which then uses the code I have above, I get: WebException was unhandled: The remote server returned an error: (500) Internal Server Error. (While debugging) If I attach to the browser and use http://localhost:xxx/1.txt I can step through server side code and throw the exception as intended. So I guess I'm wondering how I can handle the internal server error on the client side properly so I can return something meaningful like "File doesn't exist". One thought was to use a try catch around the WebClient.DownloadFile(address, filename) method but i'm not sure thats the only error that will occur i.e. the file doesn't exist.

    Read the article

  • PHP File Downloading Questions

    - by nsearle
    Hey All! I am currently running into some problems with user's downloading a file stored on my server. I have code set up to auto download a file once the user hits the download button. It is working for all files, but when the size get's larger than 30 MB it is having issues. Is there a limit on user download? Also, I have supplied my example code and am wondering if there is a better practice than using the PHP function 'file_get_contents'. Thank You all for the help! $path = $_SERVER['DOCUMENT_ROOT'] . '../path/to/file/'; $filename = 'filename.zip'; $filesize = filesize($path . $filename); @header("Content-type: application/zip"); @header("Content-Disposition: attachment; filename=$filename"); @header("Content-Length: $filesize") echo file_get_contents($path . $filename);

    Read the article

  • Different location of assemblies stoped the type casting.

    - by smwikipedia
    I am writing a custom Control class in C# for my main project. There're 2 projects, one for my Control and one for my main project. These 2 projects are in the same solution. I add a reference from my main project to my Control project. I notice that the first time after I drag my Control from the Tool Panel onto my main winform, an assembly folder was generated at the C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and the folder name is something like "jlebh-py01". The first build is always OK, but after I rebuild my Control class or whole solution, a new assembly folder will be generated at C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and then problem arises, my Control fails to behave well because Visual Studio says that the two types "originates from different location". The error message is as below: [A]MyControl.TypeXXX cannot be cast to [B]MyControl.TypeXXX. Type A orginates from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\jlebh-py01\MyControl.dll' Type B originats from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\ue4i-z3j01\MyControl.dll' If I reference the Control DLL directly instead of through project reference, or never rebuild the Control project after use my Control in the main project, things seem to be OK. Does anyone knows why? Is it the proper way to develop a control and a main project within the same solution? Many thanks...

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • longitude and latitude for current location returned from CLLocationManager in UK region is not corr

    - by bond
    Hi I am getting latitude and longitude of current location from CLLocationManager delegate method. It works fine for some region but its giving problem in UK region. When it is used in UK region, the current location longitude and latitude returned from CLLocationManager is not proper. Thanks heres a part of the logic i am using. -(void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; self.locationManager = [[CLLocationManager alloc] init]; if(self.locationManager.locationServicesEnabled) { self.locationManager.delegate = self; self.locationManager.distanceFilter = kCLDistanceFilterNone; self.locationManager.desiredAccuracy = kCLLocationAccuracyBest; } } -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { NSLog(@"Updating"); //if the time interval returned from core location is more than 15 seconds //we ignore it because it might be from an old session if ( abs([newLocation.timestamp timeIntervalSinceDate: [NSDate date]]) < 15) { self.latitude = newLocation.coordinate.latitude; self.longitude = newLocation.coordinate.longitude; NSLog(@"longitude=%f-- latitude=%f--",self.longitude,self.latitude); [self.locationManager stopUpdatingLocation]; [self removeActivityIndicator]; [[self locationSaved] setHidden:NO]; [[self viewLocationInMap] setEnabled:YES]; }}

    Read the article

  • when updating location.hash in Chrome the jQuery animation "freezes" for a second

    - by ubunut
    I'm trying to create a sort of "virtual gallery". I'm using Coda Slider 2.0 & jQuery v1.4.2 It behaves perfectly in IE, FF & Safari, but Chrome seems to reload/hang for a second when setting location.hash. This causes the jQuery animation to freeze for a second :S Example: http://hardyernst.dk/gallery.html try clicking on the navigation links above the pictures. The jQuery code that is being executed when clicking a navigation link: $('#coda-nav-' + sliderCount + ' a').each(function(z) { // What happens when a nav link is clicked $(this).bind("click", function() { offset = -(panelWidth*z); navClicks++; $(this).addClass('current').parents('ul').find('a').not($(this)).removeClass('current'); alterPanelHeight(z); currentPanel = z + 1; $('.panel-container', slider).stop().animate({ left: offset }, settings.slideEaseDuration, settings.slideEaseFunction, function(){ if (!settings.crossLinking) { return false; } // Don't change the URL hash unless cross-linking is specified }); }); }); if I add return false; at the end of the function. The animation will slide smoothly :)... BUT as you might have guessed the location.hash value remains unchanged :( I have tried setting the location.hash earlier in the function alas it did not change the behavior in Chrome Would be immensely grateful for any help :) Regards Ubunut

    Read the article

  • Using Javascript to generate and save a file

    - by Toji
    I've been fiddling with WebGL lately, and have gotten a Collada reader working. Problem is it's pretty slow (Collada is a very verbose format), so I'm going to start converting files to a easier to use format (probably JSON). Thing is, I already have the code to parse the file in Javascript, so I may as well use it as my exporter too! The problem is saving. Now, I know that I can parse the file, send the result to the server, and have the browser request the file back from the server as a download. But in reality the server has nothing to do with this particular process, so why get it involved? I already have the contents of the desired file in memory. Is there any way that I could present the user with a download using pure javascript? (I doubt it, but might as well ask...) And to be clear: I am not trying to access the filesystem without the users knowledge! The user will provide a file (probably via drag and drop), the script will transform the file in memory, and the user will be prompted to download the result. All of which should be "safe" activities as far as the browser is concerned.

    Read the article

  • Where to prompt for required file location at start of Win Forms application

    - by Murph
    I have an application that uses a file to store its data. I store the location of the file in the app settings so have two tests at startup: Do I have a setting for the file and Does the file (if I have a setting) exist If I fail either test I want to prompt the user for the file location - the mechanics of the are not the problem, I can read and write the app settings, fire off dialogs and otherwise request the data. If the user refuses to choose a file (or at least a file location) I want to exit the app. My problem is where to do this i.e. at what point in the flow of code. In an ideal world you start the app, show a splash screen, load the main form and run from there... I'm looking for a general pattern that allows me to slot the test for parameters into the right place so that I can prompt the user for whatever (and allowing that I have to worry about the fact that my splash screen is currently topmost for my app). I appreciate that this is a bit vague so will update this with code as we go along.

    Read the article

  • Android Development-cannot download an image outside of onCreate

    - by murad
    hi everyone...... im new to android development........and i am stuck with a problem...... i am trying to develop an android application that shows the user the location of atms,hotels etc on a google map....i havent started working on the gps yet.as of now the app works something like this....first of all a map loads on which i intend to show the users current location......on clicking on the menu button there are 3 options..... -services -about us -quit on selecting services option the following options are available...... -atm -hospital -hotel etc on selecting the atm option we will be shown a screen displaying some text........ on using the menu for this screen we get the following menu items..... -sbi -canara -hdfc -icici etc my intention is that when the user selects the sbi option a map should load showing the various places where there are sbi atms near where the user is currently...... ......i started out with the google map api but i had to quit because when i select one of the menu options, such as "sbi",the map doesnt load......instead i am getting the error "application failed to load"...basically i was trying to load a map activity from my first map activity......after googling a bit without any results i tried another approach.......i tried to download and view the static map of the location i wanted..it worked.......but when i tried to download the static map when i select an option like before i get the same error..."application failed to load"...then i tried downloading 2 images from inside onCreate....that worked.......i cannot do the same thing outside the onCreate.....for eg.inside the function for the selected option... i have given the link to my code below..... if someone can please look into this it would be of great help to me.........i have been sitting with this problem for days now......and its urgent too.......i have done the project in eclipse....... httpDownload.java --- http://dpaste.com/195981/

    Read the article

< Previous Page | 53 54 55 56 57 58 59 60 61 62 63 64  | Next Page >