Search Results

Search found 39207 results on 1569 pages for 'foreign function interfac'.

Page 570/1569 | < Previous Page | 566 567 568 569 570 571 572 573 574 575 576 577  | Next Page >

  • Javascript FAQ drop down

    - by kdipaolo
    Im trying to create a simple FAQ drop down but for some reason it is not working. Would you mind taking a look? Thanks guys! CSS #faqs h3 { cursor:pointer; } #faqs h3.active { color:#d74646; } #faqs div { height:0; overflow:hidden; position:relative; } #faqs div p { padding:0; margin-bottom:15px; } JavaScript: $(document).ready(function() { $('#faqs h3').each(function() { var tis = $(this), state = false, answer = tis.next('div') .hide() .css('height','auto') .slideUp(); tis.click(function() { state = !state; answer.slideToggle(state); tis.toggleClass('active',state); }); }); }); HTML <div id="faqs"> <h3>This is question 1?</h3> <div> <p>This is the answer to question #1.</p> </div> <h3>This is question 2?</h3> <div> <p>This is the answer to question #2.</p> </div> </div>

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • drupal hook_menu_alter9) for adding tabs

    - by EricP
    I want to add some tabs in the "node/%/edit" page from my module called "cssswitch". When I click "Rebuild Menus", the two new tabs are displayed, but they are displayed for ALL nodes when editing them, not just for the node "cssswitch". I want these new tabs to be displayed only when editing node of type "cssswitch". The other problem is when I clear all cache, the tabs completely dissapear from all edit pages. Below is the code I wrote. function cssswitch_menu_alter(&$items) { $node = menu_get_object(); //print_r($node); //echo $node->type; //exit(); if ($node->type == 'cssswitch') { $items['node/%/edit/schedulenew'] = array( 'title' => 'Schedule1', 'access callback'=>'user_access', 'access arguments'=>array('view cssswitch'), 'page callback' => 'cssswitch_schedule', 'page arguments' => array(1), 'type' => MENU_LOCAL_TASK, 'weight'=>4, ); $items['node/%/edit/schedulenew2'] = array( 'title' => 'Schedule2', 'access callback'=>'user_access', 'access arguments'=>array('view cssswitch'), 'page callback' => 'cssswitch_test2', 'page arguments' => array(1), 'type' => MENU_LOCAL_TASK, 'weight'=>3, ); } } function cssswitch_test(){ return 'test'; } function cssswitch_test2(){ return 'test2'; } Thanks for any help.

    Read the article

  • Translate Prototype code into Jquery version

    - by user1055495
    I everybody, I'm working on a SaaS application and I need to use Jquery instead of Prototype due to some extra plugins integration. My code that was wotking a charm with Prototype is not running anymore with Jquery and I'm not used to write in this framework... Is there someone to help me in "translating" this one: Thanks a lot for your help. var rates = new Array(); <% for tva_rate in @tva_rates -%> rates.push(new Array(<%= tva_rate.id %>, '<%=h tva_rate.taux %>', '<%=h tva_rate.compte_id %>' )); <% end -%> function tvaSelected() { tva_id = $('journal_tva_id').getValue(); show = 1; if (tva_id > 0){ rates.each(function(rate) { if (rate[0] == tva_id) { $('journal_taux').setValue(rate[1]); $('journal_compte_tva').setValue(rate[2]); show = 2; } }); } if (show == 1) { $('tva_taux_field').hide(); } else { $('tva_taux_field').show(); } } document.observe('dom:loaded', function() { tvaSelected(); $('journal_tva_id').observe('change', tvaSelected); });

    Read the article

  • How do I avoid killing the native controls on a html5-video when i've started it programmaticly?

    - by Nils
    OK, so the deal is I've started making a little videoplayer, that works by clicking a div with an image, expanding the div and the image, and then exchanges the image with a html5-videotag. the code is as below. (It's very early on, so i know theres a lot that need improving, as in not using javascript to set styles and so on, but nevertheless, any insigts and tips are welcome, besides the answer to the main question) /*Begin Expander*/ var $videoplayer = $('<video width="640" height="360" preload="none" controls="" tabindex="0" style="position: relative;"><source type="video/mp4" src="/restalive/movies/big_buck_bunny.mp4"></source><source type="video/ogg" src="/restalive/movies/big_buck_bunny.ogv"></source></video>').appendTo('body'); $videoplayer.hide(); $(".ExpandVideo").each(function(i){ var $trigger = $(this); var $image = $trigger.find("img"); $image.css({ "width" : "100%" ,"height" : "auto" }) $trigger.css({ "display" : "block" ,"overflow" : "hidden" ,"width" : "200px" ,"float" : "left" }); $trigger.bind("click", function(e){ $trigger.animate({"width" : "640px"}, "fast", function(){ $image.replaceWith($videoplayer); $videoplayer.show(); $videoplayer.attr("id", "video" + i); var video = document.getElementById("video" + i); video.play(); }) }) }); However, the main problem is that when i've fired of the video like this (video.play()), the native controls stop working, i can no longer pause the video, even though the controls are there, and clickable, the video just starts playing immidiatley again when i trie to pause it. Which is a shame, because i want to use the native controls for simplicity.

    Read the article

  • Iteration over a linq to sql query is very slow.

    - by devzero
    I have a view, AdvertView in my database, this view is a simple join between some tables (advert, customer, properties). Then I have a simple linq query to fetch all adverts for a customer: public IEnumerable<AdvertView> GetAdvertForCustomerID(int customerID) { var advertList = from advert in _dbContext.AdvertViews where advert.Customer_ID.Equals(customerID) select advert; return advertList; } I then wish to map this to modelItems for my MVC application: public List<AdvertModelItem> GetAdvertsByCustomer(int customerId) { List<AdvertModelItem> lstAdverts = new List<AdvertModelItem>(); List<AdvertView> adViews = _dataHandler.GetAdvertForCustomerID(customerId).ToList(); foreach(AdvertView adView in adViews) { lstAdverts.Add(_advertMapper.MapToModelClass(adView)); } return lstAdverts; } I was expecting to have some performance issues with the SQL, but the problem seems to be with the .ToList() function. I'm using ANTS performance profiler and it reports that the total runtime of the function is 1.400ms, and 850 of those is with the ToList(). So my question is, why does the tolist function take such a long time here?

    Read the article

  • Jquery Ajax + PHP

    - by Kris.Mitchell
    I am having problems with jQuery Ajax and PHP I have my php file set up to echo the data I am gathering from a mysql database. I have verified that the database is returning something and that the string at the end of the function actually contains data. What is happening though, is that it looks like the php echo is happening before the ajax call, causing the php data to be displayed at the top of the page, and not below in proper div. I think it might have something to do with timing of the ajax and the php call, but I am not sure. So, why is the data not getting caught by the .ajax and thrown into the div? Thanks for the help! jQuery $(document).ready(function() { $.ajax({ url: "../database_functions.php", type: "GET", data: "cat=jw&sub=pi&sort=no", cache: false, success: function (html) { alert("Success!"); $('#product-list').html(html); } }); }); PHP echo "Hello World";

    Read the article

  • Dom Nodes manipulations, how remove tags which wrap my selection?

    - by sanceray3
    Hi, I try to explain you my "problem". I would like to know when I select a part of text, if this text is “wrapped” by html tags, and in function delete them. For example with this sentence : The car is <strong>green</strong>, and the boat is black If I select “green” and click on a button, I would like verify if green is wrapped by <strong>(for that it’s ok), and in function delete <strong> tags without delete containing “green”. I have tried to do it, but when I remove child and recreate one, my new node is empty and if I try to put directly text in document.createTextNode, my new node appears but the <strong> tags stay. // Bouton CLICK $('input[type=button].btn_transform').click(function(){ var selObj = window.getSelection(); var parent=selObj.anchorNode.parentNode; if (parent.nodeName=='STRONG'){ parent.removeChild(selObj.anchorNode); var theText = document.createTextNode(selObj); parent.appendChild(theText); } }); I’m not a DOM manipulation specialist. Could you help me to solve this? Thanks very much for your precious help.

    Read the article

  • password-check directive in angularjs

    - by mpm
    I'm writing a password verify directive : Directives.directive("passwordVerify",function(){ return { require:"ngModel", link: function(scope,element,attrs,ctrl){ ctrl.$parsers.unshift(function(viewValue){ var origin = scope.$eval(attrs["passwordVerify"]); if(origin!==viewValue){ ctrl.$setValidity("passwordVerify",false); return undefined; }else{ ctrl.$setValidity("passwordVerify",true); return viewValue; } }); } }; }); html : <input data-ng-model='user.password' type="password" name='password' placeholder='password' required> <input data-ng-model='user.password_verify' type="password" name='confirm_password' placeholder='confirm password' required data-password-verify="user.password"> Given 2 password fields in a form, if both password values are equal then the field affected by the directive is valid. The issue is that it works one way (i.e. when I type a password in the password-verify field). However, when the original password field is updated, the password-verify doesn't become valid. Any idea how I could have a "two way binding verify?"

    Read the article

  • Is there a more elegant solution than an if-statement with no else clause?

    - by Jay
    In the following code, if Control (the element that trigers Toggle's first OL) is not Visible it should be set Visible and all other Controls (Controls[i]) so be Hidden. .js function Toggle(Control){ var Controls=document.getElementsByTagName("ol",document.getElementById("Quote_App")); var Control=Control.getElementsByTagName("ol")[0]; if(Control.style.visibility!="visible"){ for(var i=0;i<Controls.length;i++){ if(Controls[i]!=Control){ Reveal("hide",20,0.3,Controls[i]); }else{ Reveal("show",20,0.3,Control); }; }; }else{ Reveal("hide",20,0.3,Control); }; }; Although the function [Toggle] works fine, it is actually setting Controls[i] to Hidden even if it is already. This is easily rectified by adding an If statement as in the code below, surely there is a more elegant solution, maybe a complex If condition? .js function Toggle(Control){ var Controls=document.getElementsByTagName("ol",document.getElementById("Quote_App")); var Control=Control.getElementsByTagName("ol")[0]; if(Control.style.visibility!="visible"){ for(var i=0;i<Controls.length;i++){ if(Controls[i]!=Control){ if(Controls[i].style.visibility=="visible"){ Reveal("hide",20,0.3,Controls[i]); }; }else{ Reveal("show",20,0.3,Control); }; }; }else{ Reveal("hide",20,0.3,Control); }; }; Your help is appreciated always.

    Read the article

  • Adding date to multiple fields via datepicker

    - by Andy
    i have a form in drupal with jquery based date module. there are multiple fields with date picker enabled. i want to set the value of all of them (they all have class .date-popup-init) to the value of the first field (#edit-field, the 'from' date) when that field is set. my code so far: <script type="text/javascript"> var DatePicked = function() { var firstdate = $("#edit-field"); var updater = firstdate.datepicker("getDate"); $(".date-popup-init").each(function(){ $(this).datepicker("setDate", updater); }); } $(function() { $("#edit-field").datepicker({ onSelect: DatePicked }); }); </script> this seems to randomly work; it sets the date of some fields to the value of #edit-field, seemingly different fields each time. also, the form adds more datepicker-enabled fields via ajax. is there any way to ensure that all these new fields, when they load, pick up the value of #edit-field as well? disclaimer: last night was my first attempt at javascript of any kind. i have a basic idea now. the above was cobbled through countless google examples.

    Read the article

  • Filtering a select list via input box & jquery

    - by zSysop
    Hi all, I was wondering if i could get some help with filtering a select list using an input box via jquery. Here's what my js looks like, but it doesnt seem to work. I'm guessing this is because options within a select list are not hide-able. <script type="text/javascript"> $(document).ready(function() { $("#inputFilter").change(function() { var filter = $(this).val(); $("#selectList option").each(function() { var match = $(this).text().search(new RegExp(filter, "i")); if (match > 0) { $(this).show(); // Does not work } else $(this).hide(); }); }); }); </script> and here's my html <input id="inputFilter" /> <select id="selectList"> <option value="1111" text="1111 - London" /> <option value="1112" text="1111 - Paris" /> </select>

    Read the article

  • optimize output value using a class and public member

    - by wiso
    Suppose you have a function, and you call it a lot of times, every time the function return a big object. I've optimized the problem using a functor that return void, and store the returning value in a public member: #include <vector> const int N = 100; std::vector<double> fun(const std::vector<double> & v, const int n) { std::vector<double> output = v; output[n] *= output[n]; return output; } class F { public: F() : output(N) {}; std::vector<double> output; void operator()(const std::vector<double> & v, const int n) { output = v; output[n] *= n; } }; int main() { std::vector<double> start(N,10.); std::vector<double> end(N); double a; // first solution for (unsigned long int i = 0; i != 10000000; ++i) a = fun(start, 2)[3]; // second solution F f; for (unsigned long int i = 0; i != 10000000; ++i) { f(start, 2); a = f.output[3]; } } Yes, I can use inline or optimize in an other way this problem, but here I want to stress on this problem: with the functor I declare and construct the output variable output only one time, using the function I do that every time it is called. The second solution is two time faster than the first with g++ -O1 or g++ -O2. What do you think about it, is it an ugly optimization?

    Read the article

  • mysql stored funtion usage

    - by shikhar
    I just wrote a stored function to calculate the working days between two dates. This works select CountWeekDays('2010-03-07','2010-04-07') This doesn't work select CountWeekDays(o.order_date,o.created_date) from orders o; Any idea how to make this one work ?? function definition delimiter $$; CREATE FUNCTION CountWeekDays (sdate VARCHAR(50), edate VARCHAR(50)) RETURNS INT BEGIN DECLARE wdays, tdiff, counter, thisday smallint; DECLARE newdate DATE; SET newdate := sdate; SET wdays = 0; if DATEDIFF(edate, sdate) = 0 THEN RETURN 1; END IF; if DATEDIFF(edate, sdate) < 0 THEN RETURN 0; END IF; label1: LOOP SET thisday = DAYOFWEEK(newdate); IF thisday BETWEEN 2 AND 6 THEN SET wdays := wdays + 1; END IF; SET newdate = DATE_ADD(newdate, INTERVAL 1 DAY); IF DATEDIFF(edate, newdate) < 0 THEN LEAVE label1; END IF; END LOOP label1; RETURN wdays; END

    Read the article

  • Determining selected state of jQuery Buttons

    - by lloydphillips
    I've got two radio buttons in a .net page which are being transformed to jQuery buttons a la http://jqueryui.com/demos/button/#radio When the page is loaded I have button 2 as checked. When clicking the buttons I'm firing the postback event. Problem is you can click on that button that is selected by default on the initial load i.e. Button 2, the postback is fired but the event handler isn't called in the .net code behind because the radio button is already classed as selected (and in normal circumstances wouldn't allow the postback to fire). To get around this I've added the e.PreventDefault() method BUT this is causing issues when Button 1 is clicked because before the click handler is called the button is set to selected. Therefore, in every case in the following code e.PreventDefault() is called: $(document).ready(function(){ $("[id*='rbPayable']").click(function(e){ if ($("[id*='rbPayable']").attr("checked")) e.preventDefault(); else setTimeout('__doPostBack(\'this.id\',\'\')', 0) }) $("[id*='rbReceivable']").click(function(e){ if ($("[id*='rbReceivable']").attr("checked")) e.preventDefault(); else setTimeout('__doPostBack(\'this.id\',\'\')', 0) }) }); What is the best way for me to load the page and effectively be able to do the following: 'If rbReceivable is checked then don't do anything otherwise do a postback.'

    Read the article

  • Optimizing a "set in a string list" to a "set as a matrix" operation

    - by Eric Fournier
    I have a set of strings which contain space-separated elements. I want to build a matrix which will tell me which elements were part of which strings. For example: "" "A B C" "D" "B D" Should give something like: A B C D 1 2 1 1 1 3 1 4 1 1 Now I've got a solution, but it runs slow as molasse, and I've run out of ideas on how to make it faster: reverseIn <- function(vector, value) { return(value %in% vector) } buildCategoryMatrix <- function(valueVector) { allClasses <- c() for(classVec in unique(valueVector)) { allClasses <- unique(c(allClasses, strsplit(classVec, " ", fixed=TRUE)[[1]])) } resMatrix <- matrix(ncol=0, nrow=length(valueVector)) splitValues <- strsplit(valueVector, " ", fixed=TRUE) for(cat in allClasses) { if(cat=="") { catIsPart <- (valueVector == "") } else { catIsPart <- sapply(splitValues, reverseIn, cat) } resMatrix <- cbind(resMatrix, catIsPart) } colnames(resMatrix) <- allClasses return(resMatrix) } Profiling the function gives me this: $by.self self.time self.pct total.time total.pct "match" 31.20 34.74 31.24 34.79 "FUN" 30.26 33.70 74.30 82.74 "lapply" 13.56 15.10 87.86 97.84 "%in%" 12.92 14.39 44.10 49.11 So my actual questions would be: - Where are the 33% spent in "FUN" coming from? - Would there be any way to speed up the %in% call? I tried turning the strings into factors prior to going into the loop so that I'd be matching numbers instead of strings, but that actually makes R crash. I've also tried going for partial matrix assignment (IE, resMatrix[i,x] <- 1) where i is the number of the string and x is the vector of factors. No dice there either, as it seems to keep on running infinitely.

    Read the article

  • Java reflection appropriateness

    - by jsn
    This may be a fairly subjective question, but maybe not. My application contains a bunch of forms that are displayed to the user at different times. Each form is a class of its own. Typically the user clicks a button, which launches a new form. I have a convenience function that builds these buttons, you call it like this: buildButton( "button text", new SelectionAdapter() { @Override public void widgetSelected( SelectionEvent e ) { showForm( new TasksForm( args... ) ); } } ); I do this dozens of times, and it's really cumbersome having to make a SelectionAdapter every time. Really all I need for the button to know is what class to instantiate when it's clicked and what arguments to give the constructor, so I built a function that I call like this instead: buildButton( "button text", TasksForm.class, args... ); Where args is an arbitrary list of objects that you could use to instantiate TasksForm normally. It uses reflection to get a constructor from the class, match the argument list, and build an instance when it needs to. Most of the time I don't have to pass any arguments to the constructor at all. The downside is obviously that if I'm passing a bad set of arguments, it can't detect that at compilation time, so if it fails, a dialog is displayed at runtime. But it won't normally fail, and it'll be easy to debug if it does. I think this is much cleaner because I come from languages where the use of function and class literals is pretty common. But if you're a normal Java programmer, would seeing this freak you out, or would you appreciate not having to scan a zillion SelectionAdapters?

    Read the article

  • Crystal Reports Cross Tab Conditional Formatting

    - by ltran
    I would like to achieve a simplified result similar to the "Color Scale" function in Excel i.e. gradient colouring based on the lowest value (red) to highest value (green), except in my cross tab using Crystal Reports 2008. My cross tab looks a little like this: HOURS L1 L2 L3 L4 Total 1 hours | 5 | 0 | 1 | 16 | 22 | 2 hours | 0 | 1 | 0 | 10 | 11 | 3 hours | 8 | 2 | 6 | 12 | 28 | TOTAL |13 | 3 | 7 | 38 | 61 | The principle of my function is find the maximum value in the cross table then use 20%, 40%, 60%, 80% values to colour the background. Function is as follows (in the format background section): if currentfieldvalue < ((Maximum (MakeArray (CurrentColumnIndex, CurrentRowIndex, 1)))*0.2) then color(255,0,0) else if (currentfieldvalue >= ((Maximum (MakeArray (CurrentColumnIndex, CurrentRowIndex, 1)))*0.2) and currentfieldvalue < ((Maximum (MakeArray (CurrentColumnIndex, CurrentRowIndex, 1)))*0.4)) then color(255,192,0) else if (currentfieldvalue >= ((Maximum (MakeArray (CurrentColumnIndex, CurrentRowIndex, 1)))*0.4) and currentfieldvalue < ((Maximum (MakeArray (CurrentColumnIndex, CurrentRowIndex, 1)))*0.6)) then color(255,255,0) else if (currentfieldvalue >= ((Maximum (MakeArray (CurrentColumnIndex, CurrentRowIndex, 1)))*0.6) and currentfieldvalue < ((Maximum (MakeArray (CurrentColumnIndex, CurrentRowIndex, 1)))*0.8)) then color(146,208,80) else if (currentfieldvalue >= ((Maximum (MakeArray (CurrentColumnIndex, CurrentRowIndex, 1)))*0.8)) then color(0,176,80) It's not elegant, nor does it work properly, any assistance/suggestions would be much appreciated. I wasn't expecting it to be so complicated as originally I was working with the below assuming it would work, except it tells me that "CurrentFieldValue" is not a field. if CurrentFieldValue < ((Maximum (CurrentFieldValue))*0.2) then color(255,0,0) else if ... etc.

    Read the article

  • This code is not working in IE8 Browser.. but works in Firefox

    - by rockers
    $('#PbtnSubmit').click(function(event) { $('#PricingEditExceptions input[name=PMchk]').each(function() { if ($("#PricingEditExceptions input:checkbox:checked").length > 0) { var checked = $('#PricingEditExceptions input[type=checkbox]:checked'); var PMstrIDs = checked.map(function() { return $(this).val(); }).get().join(','); $('#1_exceptiontypes').attr('value', exceptiontypes) $('#1_PMstrIDs').attr('value', PMstrIDs); } else { alert("Please select atleast one exception"); event.preventDefault(); } }); }); I am sending exceptiondis to the Controler to handle the update.. this is my Begin form.. <script type="text/javascript"> var exceptiontypes = $.cookie("exceptiontype"); </script> <% using (Html.BeginForm("MassUpdate", "Pricing", FormMethod.Post, new { @id = "exc-"})) { %> <input type="hidden" id="exceptiontypes" runat="server" /> <input type="hidden" id="PMstrIDs" value="" runat="server"/> <%= Html.ValidationSummary(true)%> I am retreving the ExceptionId;s controler side is like this.. var exceptionIds = Request.Form[1].Split(','); var exceptiontype = Request.Form[0]; how ever this is working in firefox not in IE8.. Ie8 I am getting only Frist ExcdptionId not all checkbox exceptions ids; thanks

    Read the article

  • Fitting Text into an Image

    - by Abs
    Hello all, I have a function which takes in a font (ttf or otf file) and generates an image of text in different fonts. The problem I have is trying to work out how I can make the text fit in the image regardless of the font-size, type of font, and amount of text. I have tried to make the image rectangle variable so that it contains the text of different fonts without cutting a bit of the text since the image is not long or wide enough. Here is the function that I currently have, I have tried using the number of characters to determine the width of the image, but in some cases for some fonts and sizes, it still gets cut off. function generate_image($save_path, $text, $font_path){ $length = strlen($text) * 15; // Create the image $im = imagecreatetruecolor($length, 40); $white = imagecolorallocate($im, 255, 255, 255); $grey = imagecolorallocate($im, 128, 128, 128); $black = imagecolorallocate($im, 0, 0, 0); imagefilledrectangle($im, 0, 0, $length, 40, $white); $font = $font_path; imagettftext($im, 30, 0, 0, 25, $black, $font, $text); if(imagepng($im, $save_path)){ $status = true; }else{ $status = false; } imagedestroy($im); return $status; } Thank you all for any help

    Read the article

  • Division of text follow the cursor via Javascript/Jquery

    - by webzide
    Dear experts, I wanted have a dynamic division of content follow you with the cursor in the web browser space. I am not a pro at JS so I spent 2 hours to finally debugged a very stupid way to accomplish this. $(document).ready(function () { function func(evt) { var evt = (evt) ? evt : event; var div = document.createElement('div'); div.style.position = "absolute"; div.style.left = evt.clientX + "px"; div.style.top = evt.clientY + "px"; $(div).attr("id", "current") div.innerHTML = "CURSOR FOLLOW TEXT"; $(this).append($(div)); $(this).unbind() $(this).bind('mousemove', function () { $('div').remove("#current"); }); $(this).bind('mousemove', func); } $("body").bind('mousemove', func) }); As you can see this is pretty much Brute force and it slows down the browser quite a bit. I often experience a lag on the browser as a drag my mouse from one place to another. Is there a way to accomplish this easier and faster and more intuitive. I know you can use the cursor image technique but thats something I'm looking to avoid. Thanks in advance.

    Read the article

  • pointer, malloc and char in C

    - by user2534078
    im trying to copy a const char array to some place in the memory and point to it . lets say im defining this var under the main prog : char *p = NULL; and sending it to a function with a string : myFunc(&p, "Hello"); now i want that at the end of this function the pointer will point to the letter H but if i puts() it, it will print Hello . here is what i tried to do : void myFunc(char** ptr , const char strng[] ) { *ptr=(char *) malloc(sizeof(strng)); char * tmp=*ptr; int i=0; while (1) { *ptr[i]=strng[i]; if (strng[i]=='\0') break; i++; } *ptr=tmp; } i know its a rubbish now, but i would like to understand how to do it right, my idea was to allocate the needed memory, copy a char and move forward with the pointer, etc.. also i tried to make the ptr argument byreferenec (like &ptr) but with no success due to a problem with the lvalue and rvalue . the only thing is changeable for me is the function, and i would like not to use strings, but chars as this is and exercise . thanks for any help in advance.

    Read the article

  • c# template member functions

    - by user3730583
    How can I define a template member function in C# For instance I will fill any collection which supports an Add(...) member function, please check out the sample code below public class CInternalCollection { public static void ExternalCollectionTryOne<T<int>>(ref T<int> ext_col, int para_selection = 0) { foreach (int int_value in m_int_col) { if (int_value > para_selection) ext_col.Add(int_value); } } public static void ExternalCollectionTryTwo<T>(ref T ext_col, int para_selection = 0) { foreach (int int_value in m_int_col) { if (int_value > para_selection) ext_col.Add(int_value); } } static int[] m_int_col = { 0, -1, -3, 5, 7, -8 }; } The ExternalCollectionTryOne<...(...) would be the preferred kind, because the int type can be explicit defined, but results in an error: Type parameter declaration must be an identifier not a type The type or namespace name 'T' could not be found (are you missing a using directive or an assembly reference?) The ExternalCollectionTryTwo<...(...) results in an error: 'T' does not contain a definition for 'Add' and no extension method 'Add' accepting a first argument of type 'T' could be found (are you missing a using directive or an assembly reference?)... I hope the problem is clear – any suggestions? ----------------------------- edit -------------------------- The answers with the interface ICollection<.. without a template member works fine and thanks all for this hint, but I still cannot define successfully a member template(generic) function So a more simpler example ... how can I define this public class CAddCollectionValues { public static void AddInt<T>(ref T number, int selection) { T new_T = new T(); //this line is just an easy demonstration to get a compile error with type T foreach (int i_value in m_int_col) { if (i_value > selection) number += i_value; //again the type T cannot be used } } static int[] m_int_col = { 0, -1, -3, 5, 7, -8 }; }

    Read the article

  • Why does my JQuery Image swap not work in firefox or chrome, but fine in IE?

    - by Cognize
    Hi, Relatively new to JQuery. I've got some code that does a banner swap with a fade in fade out transition. The images swap as expected in IE8, chrome, and firefox. However, the actual fade, the smooth transition between images only works in IE. Can anyone point me in the right direction for a fix? Javascript: function swapImages() { var $active = $('#transitionImagePlaceHolder .active'); var $next = ($('#transitionImagePlaceHolder .active').next().length > 0) ? $('#transitionImagePlaceHolder .active').next() : $('#transitionImagePlaceHolder img:first'); $active.fadeOut( 'slow', function () { $next.fadeIn('slow').addClass('active'); $active.removeClass('active'); }); } $(document).ready(function () { setInterval('swapImages()', 5000); }); CSS: #transitionImagePlaceHolder { } #transitionImagePlaceHolder { position:relative; left: 26px; } #transitionImagePlaceHolder img { display:none; position:absolute; top:4; left:10; } HTML: <div id="transitionImagePlaceHolder"> <img class="active" src="Images/TransitionImages/Trans_Img_1.jpg" /> <img src="Images/TransitionImages/Trans_Img_2.jpg" /> <img src="Images/TransitionImages/Trans_Img_3.jpg" /> </div>

    Read the article

  • Visual Studio 2008 linker wants all symbols to be resolved, not only used ones

    - by user343011
    We recently upgraded to Visual Studio 2008 from 2005, and I think those error started after that. In our solution, we have a multitude of projects. Many of those are utility projects, or projects containing core functionality used by other projects. The output of those is lib files that are linked to when building the projects generating the final binaries using the "Project dependencies..." option. One of the other projects---Let us call it ResultLib---generates a DLL, and it needs one single function from the core project. This function uses only static function from its own source file, but the project in its entirety uses a lot of low-level Windows functions and also imports a DLL---Let us call it Driver.dll. Our problem is that when building ExtLib, the linker complains about a multitude of unresolved externals, for example all functions exported from Driver.dll, since its lib file is not specified when linking. If we try to fix this by adding all lib files used by other projects that use all of the core project, our resulting ResultLib DLL ends up importing Driver.dll and also exporting all functions defined in it. How do we tell Visual Studio to only try to resolve symbols that are actually used?

    Read the article

< Previous Page | 566 567 568 569 570 571 572 573 574 575 576 577  | Next Page >