Search Results

Search found 37051 results on 1483 pages for 'string matching'.

Page 572/1483 | < Previous Page | 568 569 570 571 572 573 574 575 576 577 578 579  | Next Page >

  • Question regarding factory pattern

    - by eriks
    I have a factory class to build objects of base class B. The object (D) that uses this factory received a list of strings representing the actual types. What is the correct implementation: the factory receives an Enum (and uses switch inside the Create function) and D is responsible to convert the string to Enum. the factory receives a string and checks for a match to a set of valid strings (using ifs') other implementation i didn't think of.

    Read the article

  • usage of try catch

    - by Muhammed Rauf K
    Which is best: Code Snippet 1 or Code Snippet 2 ? And Why? /* Code Snippet 1 * * Write try-catch in function definition */ void Main(string[] args) { AddMe(); } void AddMe() { try { // Do operations... } catch(Exception e) { } } /* Code Snippet 2 * * Write try-catch where we call the function. */ void Main(string[] args) { try { AddMe(); } catch (Exception e) { } } void AddMe() { // Do operations... }

    Read the article

  • How to get Alfresco login ticket without user password, but with impersonating user with user principal name (UPN)

    - by dok
    I'm writing a DLL that has function for getting Alfresco login ticket without using user password, using only a user principal name (UPN). I’m calling alfresco REST API service /wcservice. I use NTLM in Alfresco. I’m impersonating users using WindowsIdentity constructor as explained here http://msdn.microsoft.com/en-us/library/ms998351.aspx#paght000023_impersonatingbyusingwindowsidentity. I checked and user is properly impersonated (I checked WindowsIdentity.GetCurrent().Name property). After impersonating a user, I try to make HttpWebRequest and set its credentials with CredentialsCache.DefaultNetworkCredentials. I get the error: The remote server returned an error: (401) Unauthorized. at System.Net.HttpWebRequest.GetResponse() When I use new NetworkCredential("username", "P@ssw0rd") to set request credentials, I get Alfresco login ticket (HttpStatusCode.OK, 200). Is there any way that I can get Alfresco login ticket without user password? Here is the code that I'm using: private string GetTicket(string UPN) { WindowsIdentity identity = new WindowsIdentity(UPN); WindowsImpersonationContext context = null; try { context = identity.Impersonate(); MakeWebRequest(); } catch (Exception e) { return e.Message + Environment.NewLine + e.StackTrace; } finally { if (context != null) { context.Undo(); } } } private string MakeWebRequest() { string URI = "http://alfrescoserver/alfresco/wcservice/mg/util/login"; HttpWebRequest request = WebRequest.Create(URI) as HttpWebRequest; request.CookieContainer = new CookieContainer(1); //request.Credentials = new NetworkCredential("username", "p@ssw0rd"); // It works with this request.Credentials = CredentialCache.DefaultNetworkCredentials; // It doesn’t work with this //request.Credentials = CredentialCache.DefaultCredentials; // It doesn’t work with this either try { using (HttpWebResponse response = request.GetResponse() as HttpWebResponse) { StreamReader sr = new StreamReader(response.GetResponseStream()); return sr.ReadToEnd(); } } catch (Exception e) { return (e.Message + Environment.NewLine + e.StackTrace); } } Here are records from Alfresco stdout.log (if it helps in any way): 17:18:04,550 DEBUG [app.servlet.NTLMAuthenticationFilter] Processing request: /alfresco/wcservice/mg/util/login SID:7453F7BD4FD2E6A61AD40A31A37733A5 17:18:04,550 DEBUG [web.scripts.DeclarativeRegistry] Web Script index lookup for uri /mg/util/login took 0.526239ms 17:18:04,550 DEBUG [app.servlet.NTLMAuthenticationFilter] New NTLM auth request from 10.**.**.** (10.**.**.**:1229) 17:18:04,566 DEBUG [app.servlet.NTLMAuthenticationFilter] Processing request: /alfresco/wcservice/mg/util/login SID:7453F7BD4FD2E6A61AD40A31A37733A5 17:18:04,566 DEBUG [web.scripts.DeclarativeRegistry] Web Script index lookup for uri /mg/util/login took 0.400909ms 17:18:04,566 DEBUG [app.servlet.NTLMAuthenticationFilter] Received type1 [Type1:0xe20882b7,Domain:<NotSet>,Wks:<NotSet>] 17:18:04,566 DEBUG [app.servlet.NTLMAuthenticationFilter] Client domain null 17:18:04,675 DEBUG [app.servlet.NTLMAuthenticationFilter] Sending NTLM type2 to client - [Type2:0x80000283,Target:AlfrescoServerA,Ch:197e2631cc3f9e0a]

    Read the article

  • How to change default conjunction with Lucene MultiFieldQueryParser

    - by Luke H
    I have some code using Lucene that leaves the default conjunction operator as OR, and I want to change it to AND. Some of the code just uses a plain QueryParser, and that's fine - I can just call setDefaultOperator on those instances. Unfortunately, in one place the code uses a MultiFieldQueryParser, and calls the static "parse" method (taking String, String[], BooleanClause.Occur[], Analyzer), so it seems that setDefaultOperator can't help, because it's an instance method. Is there a way to keep using the same parser but have the default conjunction changed?

    Read the article

  • UISearchDisplayController - how to display search result with only by scope button selected but empt

    - by billibala
    The UISearchDisplayController is very handy and implementing search is pretty straightforward. However, I bump into problem when, in my app, I want to display search result with empty search string but selected scope button. It seems like it's a must to enter some search string in order to get the search result table being initialized and displayed. Is there any ways to display search result immediately after user has picked a scope but not entered search word yet? Thanks Bill

    Read the article

  • SQL Server Full Text Search Special character issue

    - by ManojTrek
    Hello, I have Full Text catalog created in SQL Server 2005, when I search the text like "Bolivia's History", it returns all the result matching to that, but if I use "Bolivias History", it does not return anything, I am very new to Full Text Search stuff, any lead how to ignore the special character ("'"), in Full Text Search? Thanks in Advance, Manoj

    Read the article

  • How to code a keyboard button to switch between 2 modes?

    - by le.shep20
    Hi! i'm doing a project, i'm not going to details but i will simplify my idea, i'm using Morse Code ( dot and dash) and i have 2 methods: convert_MorseToChar() and Convert_MorseTonum() in the convert_MorseToChar() method there is swich to compare the input from a user which will be Morse codes and mapping it to characters: private String convert_MorseToChar(ref string Ch) { switch (Ch) { Case ".-": MorsetoChar = "a" break; Case "-...": MorsetoChar = "b" break; Case "-.-.": MorsetoChar = "c" break; Case "-..": MorsetoChar = "d" break; Case ".": MorsetoChar = "e" break; } } and the other method Convert_MorseToNum(), ues the SAME combinations of Morse codes but mapping them to numbers: private String Convert_MorseToNum(ref string Ch) { switch (Ch) { Case ".-": MorsetoChar = "1" break; Case "-...": MorsetoChar = "2" break; Case "-.-.": MorsetoChar = "3" break; Case "-..": MorsetoChar = "4" break; Case ".": MorsetoChar = "5" break; } } now the senario is: there are 2 Textbox, one the user will write Morse codes in it and the other is for the output. The user will write dot "." and dash "-" from the keyboard and press Enter then the program will go to ONE of the 2 methods to convert the Morse codes. Now what tells the program where to go to convert?? my question is: I want to create mode key to swich between 2 modes: MorseTochar and MorseToNum. i want the down arrow key to act like a mode, when a user press the down arrow then it the program will be in MorseToChar mode, when ever the user input the program directly use the method convert_MorseToChar to convert to characters. and when the user press the down arrow agian, the prohram will swich to MorseToNum mode here when ever the user input as morsecode, the program will directly use the method Convert_MorseToNum() to convert to numbers. HOW I CAN DO THAT Pleaaaas!!! help me! Please excuse my English, English is not my native language :)

    Read the article

  • C Programming - My program is good enough for my assignment but I know its not good

    - by Joe
    Hi there I'm just starting an assignment for uni and it's raised a question for me. I don't understand how to return a string from a function without having a memory leak. char* trim(char* line) { int start = 0; int end = strlen(line) - 1; /* find the start position of the string */ while(isspace(line[start]) != 0) { start++; } //printf("start is %d\n", start); /* find the position end of the string */ while(isspace(line[end]) != 0) { end--; } //printf("end is %d\n", end); /* calculate string length and add 1 for the sentinel */ int len = end - start + 2; /* initialise char array to len and read in characters */ int i; char* trimmed = calloc(sizeof(char), len); for(i = 0; i < (len - 1); i++) { trimmed[i] = line[start + i]; } trimmed[len - 1] = '\0'; return trimmed; } as you can see I am returning a pointer to char which is an array. I found that if I tried to make the 'trimmed' array by something like: char trimmed[len]; then the compiler would throw up a message saying that a constant was expected on this line. I assume this meant that for some reason you can't use variables as the array length when initialising an array, although something tells me that can't be right. So instead I made my array by allocating some memory to a char pointer. I understand that this function is probably waaaaay sub-optimal for what it is trying to do, but what I really want to know is: 1. Can you normally initialise an array using a variable to declare the length like: char trimmed[len]; ? 2. If I had an array that was of that type (char trimmed[]) would it have the same return type as a pointer to char (ie char*). 3. If I make my array by callocing some memory and allocating it to a char pointer, how do I free this memory. It seems to me that once I have returned this array, I can't access it to free it as it is a local variable. Many thanks in advance Joe

    Read the article

  • Sinatra / Rack fails with non-ascii characters in url

    - by Piotr Zolnierek
    I am getting Encoding::UndefinedConversionError at /find/Wroclaw "\xC5" from ASCII-8BIT to UTF-8 For some mysterious reason sinatra is passing the string as ASCII instead of UTF-8 as it should. I have found some kind of ugly workaround... I don't know why Rack assumes the encoding is ASCII-8BIT ... anyway, a way is to use string.force_encoding("UTF-8")... but doing this for all params is tedious

    Read the article

  • Regex in Python

    - by newToProgramming
    SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

    Read the article

  • Error Galleria IE7

    - by John the horn
    I am using galleria for my site [Minavet.ro][1] [1]: http://minavet.ro and this error comes up is IE7 Line:219079877 Char:2 Error:Expected identifier, string number code:0 url:http://minavet.ro Thx for your time I have given the images width and height and now the error is Line:222704333 Char:2 Error:Expected identifier, string number code:0 url:http://minavet.ro

    Read the article

  • List input and output audio devices in Applet

    - by Jhonny Everson
    I am running a signed applet that needs to provide the ability for the user to select the input and output audio devices ( similar to what skype provides). I borrowed the following code from other thread: import javax.sound.sampled.*; public class SoundAudit { public static void main(String[] args) { try { System.out.println("OS: "+System.getProperty("os.name")+" "+ System.getProperty("os.version")+"/"+ System.getProperty("os.arch")+"\nJava: "+ System.getProperty("java.version")+" ("+ System.getProperty("java.vendor")+")\n"); for (Mixer.Info thisMixerInfo : AudioSystem.getMixerInfo()) { System.out.println("Mixer: "+thisMixerInfo.getDescription()+ " ["+thisMixerInfo.getName()+"]"); Mixer thisMixer = AudioSystem.getMixer(thisMixerInfo); for (Line.Info thisLineInfo:thisMixer.getSourceLineInfo()) { if (thisLineInfo.getLineClass().getName().equals( "javax.sound.sampled.Port")) { Line thisLine = thisMixer.getLine(thisLineInfo); thisLine.open(); System.out.println(" Source Port: " +thisLineInfo.toString()); for (Control thisControl : thisLine.getControls()) { System.out.println(AnalyzeControl(thisControl));} thisLine.close();}} for (Line.Info thisLineInfo:thisMixer.getTargetLineInfo()) { if (thisLineInfo.getLineClass().getName().equals( "javax.sound.sampled.Port")) { Line thisLine = thisMixer.getLine(thisLineInfo); thisLine.open(); System.out.println(" Target Port: " +thisLineInfo.toString()); for (Control thisControl : thisLine.getControls()) { System.out.println(AnalyzeControl(thisControl));} thisLine.close();}}} } catch (Exception e) {e.printStackTrace();}} public static String AnalyzeControl(Control thisControl) { String type = thisControl.getType().toString(); if (thisControl instanceof BooleanControl) { return " Control: "+type+" (boolean)"; } if (thisControl instanceof CompoundControl) { System.out.println(" Control: "+type+ " (compound - values below)"); String toReturn = ""; for (Control children: ((CompoundControl)thisControl).getMemberControls()) { toReturn+=" "+AnalyzeControl(children)+"\n";} return toReturn.substring(0, toReturn.length()-1);} if (thisControl instanceof EnumControl) { return " Control:"+type+" (enum: "+thisControl.toString()+")";} if (thisControl instanceof FloatControl) { return " Control: "+type+" (float: from "+ ((FloatControl) thisControl).getMinimum()+" to "+ ((FloatControl) thisControl).getMaximum()+")";} return " Control: unknown type";} } But what I get: Mixer: Software mixer and synthesizer [Java Sound Audio Engine] Mixer: No details available [Microphone (Pink Front)] I was expecting the get the real list of my devices (My preferences panels shows 3 output devices and 1 Microphone). I am running on Mac OS X 10.6.7. Is there other way to get that info from Java?

    Read the article

  • NHibernate criteria query question

    - by Chris
    I have 3 related objects (Entry, GamePlay, Prize) and I'm trying to find the best way to query them for what I need using NHibernate. When a request comes in, I need to query the Entries table for a matching entry and, if found, get a) the latest game play along with the first game play that has a prize attached. Prize is a child of GamePlay and each Entry object has a GamePlays property (IList). Currently, I'm working on a method that pulls the matching Entry and eagerly loads all game plays and associated prizes, but it seems wasteful to load all game plays just to find the latest one and any that contain a prize. Right now, my query looks like this: var entry = session.CreateCriteria<Entry>() .Add(Restrictions.Eq("Phone", phone)) .AddOrder(Order.Desc("Created")) .SetFetchMode("GamePlays", FetchMode.Join) .SetMaxResults(1).UniqueResult<Entry>(); Two problems with this: It loads all game plays up front. With 365 days of data, this could easily balloon to 300k of data per query. It doesn't eagerly load the Prize child property for each game. Therefore, my code that loops through the GamePlays list looking for a non-null Prize must make a call to load each Prize property I check. I'm not an nhibernate expert, but I know there has to be a better way to do this. Ideally, I'd like to do the following (pseudocode): entry = findEntry(phoneNumber) lastPlay = getLatestGamePlay(Entry) firstWinningPlay = getFirstWinningGamePlay(Entry) The end result of course is that I have the entry details, the latest game play, and the first winning game play. The catch is that I want to do this in as few database calls as possible, otherwise I'd just execute 3 separate queries. The object definitions look like: public class Entry { public Guid Id {get;set;} public string Phone {get;set;} public IList<GamePlay> GamePlays {get;set;} // ... other properties } public class GamePlay { public Guid Id {get;set;} public Entry Entry {get;set;} public Prize Prize {get;set;} // ... other properties } public class Prize { public Guid Id {get;set;} // ... other properties } The proper NHibernate mappings are in place, so I just need help figuring out how to set up the criteria query (not looking for HQL, don't use it).

    Read the article

  • JSON is used only for JavaScript?

    - by Bob Smith
    I am storing a JSON string in the database that represents a set of properties. In the code behind, I export it and use it for some custom logic. Essentially, I am using it only as a storage mechanism. I understand XML is better suited for this but I read that JSON is faster and preferred. Is it a good practice to use JSON if the intention is not to use the string on the client side?

    Read the article

  • MD5 hash with salt for keeping password in DB in C#

    - by abatishchev
    Could you please advise me some easy algorithm for hashing user password by MD5, but with salt for increasing reliability. Now I have this one: private static string GenerateHash(string value) { var data = System.Text.Encoding.ASCII.GetBytes(value); data = System.Security.Cryptography.MD5.Create().ComputeHash(data); return Convert.ToBase64String(data); }

    Read the article

  • Error while creating tests in Visual Studio

    - by Benjol
    When I try to generate a unit test for the following method (in a public static class) private static string[] GetFields(string line, char sep) { char[] totrim = { '"', ' ' }; return line.Split(sep).Select(col => col.Trim(totrim)).ToArray(); } The Tests output says: While trying to generate your tests, the following errors occurred: This method or property cannot be called within an event handler. It works if I make the function public - I've tried running Publicize.exe manually, it doesn't complain, but doesn't make any difference either.

    Read the article

  • How do I require that an element has either one set of attributes or another in an XSD schema?

    - by Eli Courtwright
    I'm working with an XML document where a tag must either have one set of attributes or another. For example, it needs to either look like <tag foo="hello" bar="kitty" /> or <tag spam="goodbye" eggs="world" /> e.g. <root> <tag foo="hello" bar="kitty" /> <tag spam="goodbye" eggs="world" /> </root> So I have an XSD schema where I use the xs:choice element to choose between two different attribute groups: <xsi:schema xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema" attributeFormDefault="unqualified" elementFormDefault="qualified"> <xs:element name="root"> <xs:complexType> <xs:sequence> <xs:element maxOccurs="unbounded" name="tag"> <xs:choice> <xs:complexType> <xs:attribute name="foo" type="xs:string" use="required" /> <xs:attribute name="bar" type="xs:string" use="required" /> </xs:complexType> <xs:complexType> <xs:attribute name="spam" type="xs:string" use="required" /> <xs:attribute name="eggs" type="xs:string" use="required" /> </xs:complexType> </xs:choice> </xs:element> </xs:sequence> </xs:complexType> </xs:element> </xsi:schema> However, when using lxml to attempt to load this schema, I get the following error: >>> from lxml import etree >>> etree.XMLSchema( etree.parse("schema_choice.xsd") ) Traceback (most recent call last): File "<stdin>", line 1, in <module> File "xmlschema.pxi", line 85, in lxml.etree.XMLSchema.__init__ (src/lxml/lxml.etree.c:118685) lxml.etree.XMLSchemaParseError: Element '{http://www.w3.org/2001/XMLSchema}element': The content is not valid. Expected is (annotation?, ((simpleType | complexType)?, (unique | key | keyref)*))., line 7 Since the error is with the placement of my xs:choice element, I've tried putting it in different places, but no matter what I try, I can't seem to use it to define a tag to have either one set of attributes (foo and bar) or another (spam and eggs). Is this even possible? And if so, then what is the correct syntax?

    Read the article

  • regex split problem

    - by sunil-mand99
    I have javascript string variable with var sttr="We prefer questions that can be answered --------------------- not just discussed --------------------- Provide details ---------------------------- Write clearly and simply --------------------------answer all the question" please suggest how to split the string into array of sentences on the basis of dashes(-----) using regex result should be array[0]=We prefer questions that can be answered array[1]=not just discussed array[2]=Provide details array[3]=rite clearly and simply array[4]=answer all the question Note: dash(-----) range after each sentence is between 10 to 50

    Read the article

  • Does MS PnP Unity Scan for Assemblies Like StructureMap?

    - by rasx
    In Using StructureMap 2.5 to scan all assemblies in a folder, we can see that StructureMap uses AssembliesFromPath() to explicitly look for types to resolve. What is the equivalent of this in Microsoft Unity? Because Unity is such a generic term, searching for documents about this online is not that easy. Update: Unity has something called an Assembly Matching Rule but its description does not communicate to me that it scans folders.

    Read the article

  • Filter a form using a command button on another form

    - by Shaun
    I have a form with a cmdbutton that at the moment opens another form and shows all records for several types of PartitionStyles and TrimFinishs (486 at present), I need to be able to filter the second form to show only the TrimFinish I need. Private Sub lbl600SeriesS_Click() Dim stDocName As String Dim stLinkCriteria As String stDocName = "frmModules" stLinkCriteria = "Forms!frmModules![TrimFinish] = 1" DoCmd.OpenForm stDocName, , , stLinkCriteria End Sub At the moment it shows only a new record, I know there should be 162 records using 1, what have I missed or done incorrect.

    Read the article

  • How can we define more than one table,define columns and write data in xml file ?

    - by Harikrishna
    I am writing my xml file manually. And I am writing that for storing data and retrieving data from that. I have written file like for the table PersonalInfo. <?xml version="1.0" standalone="yes"?> <PersonalInfo> <xs:schema id="PersonalInfo" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="PersonalInfo" msdata:IsDataSet="true" msdata:UseCurrentLocale="true"> <xs:complexType> <xs:choice minOccurs="0" maxOccurs="unbounded"> <xs:element name="PesonalInfo."> <xs:complexType> <xs:sequence> <!--Define Column Here....--> <xs:element name="name" type="xs:string" /> <xs:element name="address" type="xs:string" /> </xs:sequence> </xs:complexType> </xs:element> </xs:choice> </xs:complexType> </xs:element> </xs:schema> <!--First Row--> <PersonalInfo.> <name>Harikrishna</name> <address>India</address> </PersonalInfo.> <!--Second Row--> <PersonalInfo.> <name>Jatin</name> <address>India</address> </PersonalInfo.> </PersonalInfo> Please suggest any mistake with writing file here. And now I want define more than table in this file. And here I have to write data for the table like <PersonalInfo.> <name>Harikrishna</name> <address>India</address> </PersonalInfo.> <PersonalInfo.> <name>Jatin</name> <address>India</address> </PersonalInfo.> Is not possible some thing writing data when defining columns EDIT : <xs:element name="name" type="xs:string",Harikrishna,Jatin.... /> <xs:element name="address" type="xs:string",India,India.... /> And how to define more than one table in a single xml file ?

    Read the article

< Previous Page | 568 569 570 571 572 573 574 575 576 577 578 579  | Next Page >