Search Results

Search found 40165 results on 1607 pages for 'function pointers'.

Page 579/1607 | < Previous Page | 575 576 577 578 579 580 581 582 583 584 585 586  | Next Page >

  • Jquery Serialization not working

    - by RussP
    Have a simple form (only extract fields here) but for some reason the JQserilization is not working; looks fine in alert() but only the first form field gets posts. Suggestions please - thanks in advance Form: <form id="neweventform" method="post" action=""> <div class="grid_4 alpha">Setup date *</div> <div class="grid_7 omega"> <select name="setup_day" id="setup_day"><?php days_list(); ?></select> <select name="setup_month" id="setup_month"><?php month_list(); ?></select> <select name="setup_year" id="setup_year"><?php year_list(); ?></select> <div class="grid_11"> <input type="submit" name="createevent" value="Create" id="createevent" /> </div> </form> Jquery $j(document).ready(function(){ $j('#neweventform').live('submit',function () { var data= $j('#neweventform').serialize(); alert(data); $j.ajax({type: "POST", url: "scripts/process.php",data: "newevent=newevent&event_options=" + data, cache: false, complete: function(data){ $j('#neweventform').fadeOut(2000),loading.fadeOut('slow'),$j('#content').fadeIn(2000), $j('#content').load('scripts/events.php #eventslist'); } }); return false; }); }); And the PHP processing if(isset($_POST['newevent'])) : $insert = mysql_query("INSERT INTO events (event_options) VALUES ('".$_POST['event_options']."')"); endif; Any suggestions?

    Read the article

  • Java reflection appropriateness

    - by jsn
    This may be a fairly subjective question, but maybe not. My application contains a bunch of forms that are displayed to the user at different times. Each form is a class of its own. Typically the user clicks a button, which launches a new form. I have a convenience function that builds these buttons, you call it like this: buildButton( "button text", new SelectionAdapter() { @Override public void widgetSelected( SelectionEvent e ) { showForm( new TasksForm( args... ) ); } } ); I do this dozens of times, and it's really cumbersome having to make a SelectionAdapter every time. Really all I need for the button to know is what class to instantiate when it's clicked and what arguments to give the constructor, so I built a function that I call like this instead: buildButton( "button text", TasksForm.class, args... ); Where args is an arbitrary list of objects that you could use to instantiate TasksForm normally. It uses reflection to get a constructor from the class, match the argument list, and build an instance when it needs to. Most of the time I don't have to pass any arguments to the constructor at all. The downside is obviously that if I'm passing a bad set of arguments, it can't detect that at compilation time, so if it fails, a dialog is displayed at runtime. But it won't normally fail, and it'll be easy to debug if it does. I think this is much cleaner because I come from languages where the use of function and class literals is pretty common. But if you're a normal Java programmer, would seeing this freak you out, or would you appreciate not having to scan a zillion SelectionAdapters?

    Read the article

  • Youtube video on load through Jquery/JS

    - by jonthecoder2346
    My goal is to display a youtube video through a javascript function that will read the embedded code and load the video automatically in the div assigned. But I am not getting anything shown in the div assigned for the video. Is it because it has to be triggered by a button click? <script type="text/javascript"> var last_cnad_text_1 = ''; var options_cnad_text_1 = { embedMethod:'fill', maxWidth:320, maxHeight: 320 }; function loadVideo() { val = $('#cnad_text_1').val(); if ( val != '' && val != last_cnad_text_1 ) { last_cnad_text_1 = val; $("#embed_cnad_text_1").oembed(val,options_cnad_text_1); } } $(function(){ $('#cnad_text_1').keydown(loadVideo()); $('#cnad_text_1').click(loadVideo()); $('#cnad_text_1').change(loadVideo()); }); </script> <body> <input id="cnad_text_1" type="text" value="" size="60" name="cnad[text_1]"> <div id="embed_cnad_text_1"></div> </body> </html>

    Read the article

  • Dom Nodes manipulations, how remove tags which wrap my selection?

    - by sanceray3
    Hi, I try to explain you my "problem". I would like to know when I select a part of text, if this text is “wrapped” by html tags, and in function delete them. For example with this sentence : The car is <strong>green</strong>, and the boat is black If I select “green” and click on a button, I would like verify if green is wrapped by <strong>(for that it’s ok), and in function delete <strong> tags without delete containing “green”. I have tried to do it, but when I remove child and recreate one, my new node is empty and if I try to put directly text in document.createTextNode, my new node appears but the <strong> tags stay. // Bouton CLICK $('input[type=button].btn_transform').click(function(){ var selObj = window.getSelection(); var parent=selObj.anchorNode.parentNode; if (parent.nodeName=='STRONG'){ parent.removeChild(selObj.anchorNode); var theText = document.createTextNode(selObj); parent.appendChild(theText); } }); I’m not a DOM manipulation specialist. Could you help me to solve this? Thanks very much for your precious help.

    Read the article

  • How to Refresh / Reload a KML layer in OpenLayers. Dynamic KML Layer.

    - by Ozaki
    TLDR See my answer below on how to refresh the layer. So far I have tried action function as follows: function RefreshKMLData(layer) { layer.loaded = false; layer.setVisibility(true); layer.redraw({ force: true }); } set interval of the function: window.setInterval(RefreshKMLData, 5000, KMLLAYER); the layer itself: var KMLLAYER = new OpenLayers.Layer.Vector("MYKMLLAYER", { projection: new OpenLayers.Projection("EPSG:4326"), strategies: [new OpenLayers.Strategy.Fixed()], protocol: new OpenLayers.Protocol.HTTP({ url: MYKMLURL, format: new OpenLayers.Format.KML({ extractStyles: true, extractAttributes: true }) }) }); the url for KMLLAYER with Math random so it doesnt cache: var MYKMLURL = var currentanchorpositionurl = 'http://' + host + '/data?_salt=' + Math.random(); I would have thought that this would Refresh the layer. As by setting its loaded to false unloads it. Visibility to true reloads it and with the Math random shouldn't allow it to cache? So has anyone done this before or know how I can get this to work? TLDR See my answer below on how to refresh the layer.

    Read the article

  • Is DOM not being loaded ?

    - by Daniel
    I went through episode 88 (Dynamic menus) of the railscasts and when I try to load my *js.erb file in the browser shows me that my fetched data from the controller is getting there Controller def dynamic_departments @departments = Department.all end localhost:3000/javascripts/dynamic_departments.js var departments = new Array(); departments.push(new Array(1,'????',1)); departments.push(new Array(2,'???-???',2)); function facultySelected(){ faculty_id = $('falculty_id').getValue(); options = $('department_id').options; options.length = 1; departments.each(function(department){ if(department[0] == faculty_id){ options[options.length] = new Option(department[1],department[2]) } }); if(options.length == 1){ $('department_field').hide(); } else { $('department_field').show(); } } document.observe('dom:loaded', function(){ alert("DOM loaded"); //$('department_field').hide(); //$('faculty_id').observe('change',facultySelected); }); My routes.rb has the match ':controller/:action.:format' Still...after the page's loaded and I change the value of my collection_select or select nothing happens.What am I missing? *I called the 'alert' and commented the rest to test it....still nothing.

    Read the article

  • How can i implemente LoadComplete Funtion in Jquery

    - by kumar
    I need to do the popup message for the grid.. after the grid as been load? this is the code I am using to load the grid.. <script type="text/javascript"> $(document).ready(function() { var RegisterGridEvents = function(excGrid) { //Register column chooser $(excGrid).jqGrid('navButtonAdd', excGrid + '_pager', { caption: "Columns", title: "Reorder Columns", onClickButton: function() { $(excGrid).jqGrid('columnChooser'); } }); $(".ui-pg-selbox").hide(); $('.ui-jqgrid-htable th:first').prepend('Select All').attr('style', 'font-size:7px'); //Register grid resize $(excGrid).jqGrid('gridResize', { minWidth: 350, maxWidth: 1500, minHeight: 400, maxHeight: 12000 }); }; $('#specialist-tab').tabs("option", "disabled", [2, 3, 4]); $('.button').button(); RegisterButtonEvents(); RegisterGridEvents("#ExceptionsGrid") }); </script> can anybody help me out where do i need write the pop messge to dispaly after the grid has been load.. do I need to use LoadComplete or getComplete for jquery grid to do this? if so where do I need to keep that piece of functinality in this? thanks

    Read the article

  • Reading from an write-only(OUT) parameter in pl/sql

    - by sqlgrasshopper5
    When I tried writing to an read-only parameter(IN) of a function, Oracle complains with an error. But that is not the case when reading from an write-only(OUT) parameter of a function. Oracle silently allows this without any error. What is the reason for this behaviour?. The following code executes without any assignment happening to "so" variable: create or replace function foo(a OUT number) return number is so number; begin so := a; --no assignment happens here a := 42; dbms_output.put_line('HiYA there'); dbms_output.put_line('VAlue:' || so); return 5; end; / declare somevar number; a number := 6; begin dbms_output.put_line('Before a:'|| a); somevar := foo(a); dbms_output.put_line('After a:' || a); end; / Here's the output I got: Before a:6 HiYA there VAlue: After a:42

    Read the article

  • Visual Studio 2008 linker wants all symbols to be resolved, not only used ones

    - by user343011
    We recently upgraded to Visual Studio 2008 from 2005, and I think those error started after that. In our solution, we have a multitude of projects. Many of those are utility projects, or projects containing core functionality used by other projects. The output of those is lib files that are linked to when building the projects generating the final binaries using the "Project dependencies..." option. One of the other projects---Let us call it ResultLib---generates a DLL, and it needs one single function from the core project. This function uses only static function from its own source file, but the project in its entirety uses a lot of low-level Windows functions and also imports a DLL---Let us call it Driver.dll. Our problem is that when building ExtLib, the linker complains about a multitude of unresolved externals, for example all functions exported from Driver.dll, since its lib file is not specified when linking. If we try to fix this by adding all lib files used by other projects that use all of the core project, our resulting ResultLib DLL ends up importing Driver.dll and also exporting all functions defined in it. How do we tell Visual Studio to only try to resolve symbols that are actually used?

    Read the article

  • force refresh of part of page in browser

    - by Jeremy
    I have the following html: <ul class="scr"> <li class="scr"> <input type="checkbox" class="chkscr"/> <h3>Item Name</h3> <div class="scr">Contents</div> </li> .... </ul> And the following jQuery: //Set initial state of each scr section $('.chkscr input, input.chkscr').each(function() { chkSCR_Click($(this)); }); //Setup click event $('.chkscr input, input.chkscr').click(function() { chkSCR_Click($(this)); }); //Toggle corresponding scr section for the checkbox function chkSCR_Click(ctl) { if (ctl.attr('checked')) { ctl.parents('li.scr').find('div.scr').stop().show(); } else { ctl.parents('li.scr').find('div.scr').stop().hide(); } } My issue is that when I toggle the last li element to display, the h3 element contents disapear, until I click somewhere else on the page, or scroll the page up and down to cause the browse to repaint that portion of the window. I don't get this behavior in Opera for example, and even in IE the behavior only happens on the last li element, so I'm pretty sure it's an IE quirk and not my code. Is there any workaround I can do through jquery/javascript to force it to repaint the h3 element?

    Read the article

  • JS: Object itteration fails

    - by Newbie
    Hello! In my JS, I have an object called box_object. It looks like this: ({ id:"3", text:"this is a box object", connection_parent:["1", "2"], connection_child:["5", "6"], connectiondata_child:{ 0:{id:"5", linepoint:"bottom"}, 1:{id:"6", linepoint:"bottom"}}, connectiondata_parent:{ 0:{id:"1", linepoint:"top"}, 1:{id:"2", linepoint:"top"}} }) Now, I want to add some position values to box_object.connectiondata_parent. Using jQuery I can use the .each() method. So I tried it, but it failed. In my function I do the following: $(box_object.connectiondata_parent).each(function(it, obj){ if(typeof(obj[it]) != "undefined" && obj[it].linepoint == "top"){ var point_position_top = new Object(); point_position_top.left = startingpoint_left; point_position_top.top = startingpoint_top; obj[it].position = point_position_top; }else if(typeof(obj[it]) != "undefined" && obj[it].linepoint == "bottom"){ var point_position_bottom = new Object(); point_position_bottom.left = startingpoint_left; point_position_bottom.top = startingpoint_bottom; obj[it].position = point_position_bottom; }else{} }); After the function my box_object looks like this: ({ id:"3", text:"this is third box", connection_parent:["1", "2"], connection_child:["5", "6"], connectiondata_child:{ 0:{id:"5", linepoint:"bottom"}, 1:{id:"6", linepoint:"bottom"}}, connectiondata_parent:{ 0:{id:"1", linepoint:"top", position:{left:500, top:104}}, 1:{id:"2", linepoint:"top"}} }) It seems it only writes the values to the first "value". Any Ideas why?

    Read the article

  • C++ read registry string value in char*

    - by Sunny
    I'm reading a registry value like this: char mydata[2048]; DWORD dataLength = sizeof(mydata); DWORD dwType = REG_SZ; ..... open key, etc ReqQueryValueEx(hKey, keyName, 0, &dwType, (BYTE*)mydata, &dataLength); My problem is, that after this, mydata content looks like: [63, 00, 3A, 00, 5C, 00...], i.e. this looks like a unicode?!?!. I need to convert this somehow to be a normal char array, without these [00], as they fail a simple logging function I have. I.e. if I call like this: WriteMessage(mydata), it outputs only "c", which is the first char in the registry. I have calls to this logging function all over the place, so I'd better of not modify it, but somehow "fix" the registry value. Here is the log function: void Logger::WriteMessage(const char *msg) { time_t now = time(0); struct tm* tm = localtime(&now); std::ofstream logFile; logFile.open(filename, std::ios::out | std::ios::app); if ( logFile.is_open() ) { logFile << tm->tm_mon << '/' << tm->tm_mday << '/' << tm->tm_year << ' '; logFile << tm->tm_hour << ':' << tm->tm_min << ':' << tm->tm_sec << "> "; logFile << msg << "\n"; logFile.close(); } }

    Read the article

  • how to display two li in time intervel using jquery

    - by abc
    <html> <head> <script type="text/javascript" src="http://code.jquery.com/jquery-1.4.4.js"></script> <style type="text/css"> body { color:green; } </style> <script type="text/javascript"> $(document).ready(function() { setInterval(findYellow,1000); function findYellow() { $("ul").each(function() { var $this = $(this); if($this.css("color") != "green") { $this.css("color", "green"); $this.text("abcd blue"); } else { $this.css("color", "blue"); $this.text("abcd green"); } }); } }); </script> </head> <body> <ul>This is a sample set <li>1</li> <li>3</li> <li>5</li> <li>7</li> <li>9</li> </ul> </body> </html>

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • PHP modifying and combining array

    - by Industrial
    Hi everyone, I have a bit of an array headache going on. The function does what I want, but since I am not yet to well acquainted with PHP:s array/looping functions, so thereby my question is if there's any part of this function that could be improved from a performance-wise perspective? I tried to be as complete as possible in my descriptions in each stage of the functions which shortly described prefixes all keys in an array, fill up eventual empty/non-valid keys with '' and removes the prefixes before returning the array: $var = myFunction ( array('key1', 'key2', 'key3', '111') ); function myFunction ($keys) { $prefix = 'prefix_'; $keyCount = count($keys); // Prefix each key and remove old keys for($i=0;$i<$keyCount; $i++){ $keys[] = $prefix.$keys[$i]; unset($keys[$i]); } // output: array('prefix_key1', 'prefix_key2', 'prefix_key3', '111) // Get all keys from memcached. Only returns valid keys $items = $this->memcache->get($keys); // output: array('prefix_key1' => 'value1', 'prefix_key2' => 'value2', 'prefix_key3'=>'value3) // note: key 111 was not found in memcache. // Fill upp eventual keys that are not valid/empty from memcache $return = $items + array_fill_keys($keys, ''); // output: array('prefix_key1' => 'value1', 'prefix_key2' => 'value2', 'prefix_key3'=>'value3, 'prefix_111' => '') // Remove the prefixes for each result before returning array to application foreach ($return as $k => $v) { $expl = explode($prefix, $k); $return[$expl[1]] = $v; unset($return[$k]); } // output: array('key1' => 'value1', 'key2' => 'value2', 'key3'=>'value3, '111' => '') return $return; } Thanks a lot!

    Read the article

  • mysql stored funtion usage

    - by shikhar
    I just wrote a stored function to calculate the working days between two dates. This works select CountWeekDays('2010-03-07','2010-04-07') This doesn't work select CountWeekDays(o.order_date,o.created_date) from orders o; Any idea how to make this one work ?? function definition delimiter $$; CREATE FUNCTION CountWeekDays (sdate VARCHAR(50), edate VARCHAR(50)) RETURNS INT BEGIN DECLARE wdays, tdiff, counter, thisday smallint; DECLARE newdate DATE; SET newdate := sdate; SET wdays = 0; if DATEDIFF(edate, sdate) = 0 THEN RETURN 1; END IF; if DATEDIFF(edate, sdate) < 0 THEN RETURN 0; END IF; label1: LOOP SET thisday = DAYOFWEEK(newdate); IF thisday BETWEEN 2 AND 6 THEN SET wdays := wdays + 1; END IF; SET newdate = DATE_ADD(newdate, INTERVAL 1 DAY); IF DATEDIFF(edate, newdate) < 0 THEN LEAVE label1; END IF; END LOOP label1; RETURN wdays; END

    Read the article

  • Jquery tabs with cookie support restore wrong tab position after page refresh.

    - by zenonych
    Hello, all. I have tricky problem which I can't completely understand... It's jquery tabs with cookie support. I've following code: $(document).ready(function() { var $tabs = $("#tabs").tabs(); $tabs.tabs('select', $.cookie("tabNumber")); $('#tabs ul li a').click(function() { $.cookie("tabNumber", $tabs.tabs('option', 'selected')); }); $('#btnSelect').click(function() { //alert($.cookie("tabNumber")); //$tabs.tabs('select', 2); $tabs.tabs('select', $.cookie("tabNumber")); }); }); So, I've 3 tabs (with positions 0,1,2) inside div named "tabs". When user selects one tab, then tab position stores in cookie. After that if user refresh page, active tab position must be restored. But each time I refresh page I get active tab in previous position (if I select 2nd tab, then after refresh I got active tab in position 1, etc.). I add some test in code (button btnSelect with onclick handler which duplicates load position functionality). So, if I uncomment and use $tabs.tabs('select', 2); Then after I click btnSelect I've got right position. Ok, that's right. Then I comment that line and uncomment next one: alert($.cookie("tabNumber")); So, I select tab, click button, get dialog message "2", and after that tab in position 1 became active. Why?? In both cases I call 'select' method with parameter 2... I know I can use aliases for tabs, but I want to understate why my code doesn't work properly.

    Read the article

  • autocomplete: how do I avoid a duplicate search?

    - by dnagirl
    I use JQuery plugin autocomplete as a kind of dataset chooser. If the user chooses a value from the autocomplete lookup, the database is queried for the matching dataset. If the user types in a new value, the user can enter a new dataset. An issue arises when the user types in an existing value rather than choosing it from the autocomplete lookup. When this is done, the autocomplete .result() method is not called and no dataset is retrieved. To fix this I added a .blur(function(){$(this).search();}); to the input element. This fixed the original problem. Now I have the problem that .result() fires on selection from lookup AND on blur. I would like .result() to fire on selection from lookup OR on blur. How do I make that happen? Here is my code: $('#groupset').autocomplete('ajax/php/leeruns.php'); $('#groupset').result( function(event, data, formatted) { if(data){ $('#groupsetdesc').val(formatted); groups.load(data[1]); //retrieve matching dataset } else { $('#groupsetdesc').val(''); } } ).blur(function(){$(this).search();});

    Read the article

  • Load iframe in html, only with jquery

    - by phpExe
    In this jquery code: $(document).ready(function(){ $list = $(".channeList li"); $list.click(function(){ var $this = $(this); var $mainDesc = $(".ply"); var iframe = $("a", $this).attr("rel"); $("iframe", $mainDesc).attr("src", iframe); } ); } ); There is a list o channels in left that iframe loads from a rel's. I want to load first iframe in <div class="ply"></div> In html, I dont want insert the first item. Can we do this without load first item in html and do this only with jquery? The php function channel() { if (is_numeric($_GET['kanalID'])) { $kanalID = $_GET['kanalID']; } if ($_GET['kanalID'] == "") { $kanalID = 1;} $channel = '<ul class="channeList">'; foreach ($tv as $id => $kanal) { $class = $kanalID == $id ? $class = "currentt": ''; $channel .= '<li> <a href="#" rel="http://mysite.com/index.php?id='.$id.'&w=500&h=320" >'.$kanal.'</a></li>'; } $channel .= '</ul>'; $channel .= '<div class="ply"><iframe frameborder=0 width="500" height="320"></iframe></div>'; return $channel; } Thanks in advance

    Read the article

  • Core jQuery event modification problem

    - by DSKVR
    I am attempting to overwrite a core jQuery event, in this case the keydown event. My intention is to preventDefault() functionality of Left(37), Up(38), Right(39) and Down(40) to maintain the consistency of hot keys in my web application. I am using the solution provided here for the conditional charCode preventDefault problem. For some reason, my function overwrite is simply not firing, and I cannot put my finger on the problem. I am afraid that over the past 30 minutes this issue has resulted in some hair loss. Anybody have the remedy? /* Modify Keydown Event to prevent default PageDown and PageUp functionality */ (function(){ var charCodes = new Array(37,38,39,40); var original = jQuery.fn.keydown; jQuery.fn.keydown = function(e){ var key=e.charCode ? e.charCode : e.keyCode ? e.keyCode : 0; alert('now why is my keydown mod not firing?'); if($.inArray(key,charCodes)) { alert('is one of them, do not scroll page'); e.preventDefault(); return false; } original.apply( this, arguments ); } })();

    Read the article

  • Drupal - Search box not working - custom theme template

    - by vr3690
    Hello, I am using a customised version of search-theme-from.tpl When I use the search box, I do get transferred to the search page. But the search does not actually take place. The search box on the search results page does work though. This is my search-them-form.tpl.php file (demo : <input type="text" name="search_theme_form_keys" id="edit-search-theme-form-keys" value="Search" title="Enter the terms you wish to search for" class="logininput" height="24px" onblur="restoreSearch(this)" onfocus="clearInput(this)" /> <input type="submit" name="op" id="edit-submit" value="" class="form-submit" style="display: none;" /> <input type="hidden" name="form_token" id="edit-search-theme-form-form-token" value="<?php print drupal_get_token('search_theme_form'); ?>" /> <input type="hidden" name="form_id" id="edit-search-theme-form" value="search_theme_form" /> There is also a javascript file involved. I guess it's use is pretty clear from the code: function trim(str) { return str.replace(/^\s+|\s+$/g, ''); } function clearInput(e) { e.value=""; // clear default text when clicked e.className="longininput_onfocus"; //change class } function restoreSearch(e) { if (trim(e.value) == '') { { e.value="Search"; // reset default text onBlur e.className="logininput"; //reset class } } } What can be the problem and how can I fix it?

    Read the article

  • Handling Apache Thrift list/map Return Types in C++

    - by initzero
    First off, I'll say I'm not the most competent C++ programmer, but I'm learning, and enjoying the power of Thrift. I've implemented a Thrift Service with some basic functions that return void, i32, and list. I'm using a Python client controlled by a Django web app to make RPC calls and it works pretty well. The generated code is pretty straight forward, except for list returns: namespace cpp Remote enum N_PROTO { N_TCP, N_UDP, N_ANY } service Rcon { i32 ping() i32 KillFlows() i32 RestartDispatch() i32 PrintActiveFlows() i32 PrintActiveListeners(1:i32 proto) list<string> ListAllFlows() } The generated signatures from Rcon.h: int32_t ping(); int32_t KillFlows(); int32_t RestartDispatch(); int32_t PrintActiveFlows(); int32_t PrintActiveListeners(const int32_t proto); int64_t ListenerBytesReceived(const int32_t id); void ListAllFlows(std::vector<std::string> & _return); As you see, the ListAllFlows() function generated takes a reference to a vector of strings. I guess I expect it to return a vector of strings as laid out in the .thrift description. I'm wondering if I am meant to provide the function a vector of strings to modify and then Thrift will handle returning it to my client despite the function returning void. I can find absolutely no resources or example usages of Thrift list< types in C++. Any guidance would be appreciated.

    Read the article

  • waiting for a signal

    - by Umesha MS
    Hi, I am working on an application which uploads the content of the file to server. To upload the file to server I am using ‘QNetworkAccessManager’ class. Since it works as asynchronous way, I changed it to work as synchronous way by using QEventLoop. Class FileTransfer { Public : QNetworkAccessManager mNetworkManager; Void Upload(QNetworkRequest request, QIODevice *data) { responce = mNetworkManager.put(request, data); EventLoop.exec(); ReadResponce(responce); } Void Stop() { responce ->close(); } } In my sample application I have 2 windows. 1st to select the files and 2nd to show the progress. When user click on upload button in the first window, the 2nd window will be displayed and then I create the FileTransfer object and start uploading. While uploading the file if user closes the form then in the destructor of the window I call the stop of ‘FileTransfer’ after that I delete the ‘FileTransfer’ object. But here the Upload() function is not yet completed so it will crash. Please help me to: How to wait in 'stop()' function until the Upload() function is completed

    Read the article

  • Loading city/state from SQL Server to Google Maps?

    - by knawlejj
    I'm trying to make a small application that takes a city & state and geocodes that address to a lat/long location. Right now I am utilizing Google Map's API, ColdFusion, and SQL Server. Basically the city and state fields are in a database table and I want to take those locations and get marker put on a Google Map showing where they are. This is my code to do the geocoding, and viewing the source of the page shows that it is correctly looping through my query and placing a location ("Omaha, NE") in the address field, but no marker, or map for that matter, is showing up on the page: function codeAddress() { <cfloop query="GetLocations"> var address = document.getElementById(<cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput>).value; if (geocoder) { geocoder.geocode( {<cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput>: address}, function(results, status) { if (status == google.maps.GeocoderStatus.OK) { var marker = new google.maps.Marker({ map: map, position: results[0].geometry.location, title: <cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput> }); } else { alert("Geocode was not successful for the following reason: " + status); } }); } </cfloop> } And here is the code to initialize the map: var geocoder; var map; function initialize() { geocoder = new google.maps.Geocoder(); var latlng = new google.maps.LatLng(42.4167,-90.4290); var myOptions = { zoom: 5, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP } var marker = new google.maps.Marker({ position: latlng, map: map, title: "Test" }); map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); } I do have a map working that uses lat/long that was hard coded into the database table, but I want to be able to just use the city/state and convert that to a lat/long. Any suggestions or direction? Storing the lat/long in the database is also possible, but I don't know how to do that within SQL.

    Read the article

  • Noobie Jquery Question

    - by piratebill
    I've been working with Jquery fro a grand total of two hours now. Up until this point I have made this really simple FAQ page. <script type="text/javascript" src="jquery.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#void").click(function(event) { event.preventDefault(); }); $('#faq').find('dd').hide().end().find('dt').click(function() { $(this).next().slideToggle(); }); }); </script> <dl id="faq"> <dt><a href="" id="void">Coffee</a></dt> <dd>- black hot drink</dd> <dt><a href="" id="void">Milk</a></dt> <dd>- white cold drink</dd> </dl> The problem is only the first item is working. My questions are, why is only the first entree working and how do I fix it? I've tried using an each() but I am unsure where to put it.

    Read the article

< Previous Page | 575 576 577 578 579 580 581 582 583 584 585 586  | Next Page >