Search Results

Search found 38961 results on 1559 pages for 'boost function'.

Page 581/1559 | < Previous Page | 577 578 579 580 581 582 583 584 585 586 587 588  | Next Page >

  • Segmentation fault on certain inputs and not others

    - by Brandon Schwandt
    Heres a function I wrote that has some debugging elements in it already. When i enter either a "y" or a "Y" as the input I get a segmentation fault during runtime. When I enter any other value the code runs. The seg fault kicks out after it scans and gives me the response but before the "scan worked" line is output. DOn't know why it would act like this only on these values. If anyone needs the function call I have that as well. query_user(char *response [10]) { printf("response after query call before clear=%s\n",response); strcpy(response,""); printf("response after clearing before scan=%s\n",response); printf("Enter another person into the line? y or n\n"); scanf("%s", response); printf("response after scan=%s\n",response); printf("scan worked"); } main() { char response [10]; strcpy(response,"y"); printf("response=%s\n",response); printf("When finished with program type \"done\" to exit\n"); while (strcmp(response,"done") != 0) { printf("response after while loop and before query call=%s\n",response); query_user(&response); } } output on error: response after query call before clear=y response after clearing before scan= Enter another person into the line? y or n y response after scan=y Segmentation Fault (core dumped) output on non-error: response after query call before clear=y response after clearing before scan= Enter another person into the line? y or n n response after scan=n scan worked Cycle number 0 (program continues to run outside this function)

    Read the article

  • Modify columns in a data frame in R more cleanly - maybe using with() or apply()?

    - by Mittenchops
    I understand the answer in R to repetitive things is usually "apply()" rather than loop. Is there a better R-design pattern for a nasty bit of code I create frequently? So, pulling tabular data from HTML, I usually need to change the data type, and end up running something like this, to convert the first column to date format (from decimal), and columns 2-4 from character strings with comma thousand separators like "2,400,000" to numeric "2400000." X[,1] <- decYY2YY(as.numeric(X[,1])) X[,2] <- as.numeric(gsub(",", "", X[,2])) X[,3] <- as.numeric(gsub(",", "", X[,3])) X[,4] <- as.numeric(gsub(",", "", X[,4])) I don't like that I have X[,number] repeated on both the left and ride sides here, or that I have basically the same statement repeated for 2-4. Is there a very R-style way of making X[,2] less repetitive but still loop-free? Something that sort of says "apply this to columns 2,3,4---a function that reassigns the current column to a modified version in place?" I don't want to create a whole, repeatable cleaning function, really, just a quick anonymous function that does this with less repetition.

    Read the article

  • chrome extension: get specific part of the current tab page in DOM object and display it in either popup.html or new html page?

    - by sandeep
    IS there any way so that i can convert any DOM object into HTML page within the script ? suppose I have dom object like this: content script.js chrome.extension.onRequest.addListener(function(request, sender, sendResponse) { if (request.method == "fromPopup") { console.log("got Request from Popup"); var myDivObj = document.getElementById("definition"); //sendResponse({data: "from Content Script to Popup"}); if ( myDivObj ) { sendResponse({data:myDivObj}); } else{ sendResponse({data:"Empty or No Tag"}); } console.log("sent Response1"); } else { sendResponse({}); // snub them. console.log("sent Response2"); } }); here is my popup.html <body> <Div>Searching..</Div> <Div id="output">Response??</Div> <script> console.log("Pop UP Clicked"); chrome.tabs.getSelected(null, function(tab) { chrome.tabs.sendRequest(tab.id, {method: "fromPopup", tabid: tab.id}, function(response) { console.log("got Response from Content Script"); document.getElementById("output").innerHTML=response.data; }); }); </script> </body> I know we can send onaly JSON type of data to the popup.html page.. am i right ? If yes is ther any way that I can creat HTML page with DOM Object( myDivObj ) which I collected.. Any alternative solution..? In short i want get only specific part of the current tab page in DOM object and display it in either popup.html or separate html page..

    Read the article

  • Broken JS Loop with Google Maps...

    - by Oscar Godson
    My code is below, and I had an issue with nearly the same code, and it was fixed here on StackOverflow, but, again, its not working. I haven't changed the working code, but i did wrap it in the for...in loop youll see below. The issue is that no matter what marker I click it always triggers the last marker/infoWindow that was placed. $(function(){ var latlng = new google.maps.LatLng(45.522015,-122.683811); var settings = { zoom: 10, center: latlng, disableDefaultUI:true, mapTypeId: google.maps.MapTypeId.SATELLITE }; var map = new google.maps.Map(document.getElementById("map_canvas"), settings); $.getJSON('api',function(json){ for (var property in json) { if (json.hasOwnProperty(property)) { var json_data = json[property]; var the_marker = new google.maps.Marker({ title:json_data.item.headline, map:map, clickable:true, position:new google.maps.LatLng( parseFloat(json_data.item.geoarray[0].latitude), parseFloat(json_data.item.geoarray[0].longitude) ) }); var infowindow = new google.maps.InfoWindow({ content: '<div><h1>'+json_data.item.headline+'</h1><p>'+json_data.item.full_content+'</p></div>' }); new google.maps.event.addListener(the_marker, 'click', function() { infowindow.open(map,the_marker); }); } } }); }); Thank you for whoever figures this out!

    Read the article

  • Handling Apache Thrift list/map Return Types in C++

    - by initzero
    First off, I'll say I'm not the most competent C++ programmer, but I'm learning, and enjoying the power of Thrift. I've implemented a Thrift Service with some basic functions that return void, i32, and list. I'm using a Python client controlled by a Django web app to make RPC calls and it works pretty well. The generated code is pretty straight forward, except for list returns: namespace cpp Remote enum N_PROTO { N_TCP, N_UDP, N_ANY } service Rcon { i32 ping() i32 KillFlows() i32 RestartDispatch() i32 PrintActiveFlows() i32 PrintActiveListeners(1:i32 proto) list<string> ListAllFlows() } The generated signatures from Rcon.h: int32_t ping(); int32_t KillFlows(); int32_t RestartDispatch(); int32_t PrintActiveFlows(); int32_t PrintActiveListeners(const int32_t proto); int64_t ListenerBytesReceived(const int32_t id); void ListAllFlows(std::vector<std::string> & _return); As you see, the ListAllFlows() function generated takes a reference to a vector of strings. I guess I expect it to return a vector of strings as laid out in the .thrift description. I'm wondering if I am meant to provide the function a vector of strings to modify and then Thrift will handle returning it to my client despite the function returning void. I can find absolutely no resources or example usages of Thrift list< types in C++. Any guidance would be appreciated.

    Read the article

  • Chrome extension javascript array bug?

    - by Wayne Werner
    Hi, I'm working on a Google Chrome extension. In the popup I have the following code: var bookmarks = []; function appendBMTnode(node){ bookmarks.push([node[0].title, node[0].id]); } function addchildren(results){ for(x = 0; x < results.length; x++){ bookmarks.push([results[x].title, results[x].id]); chrome.bookmarks.getChildren(results[x].id, addchildren); } } function getallbookmarks(){ chrome.bookmarks.get('0', appendBMTnode); chrome.bookmarks.getChildren('0', addchildren); } console.debug(bookmarks.length); console.debug(bookmarks); Now, I would assume that the first command would issue the # of bookmarks I have. Indeed, when I use Chrome's debugger and add bookmarks.length to the watch list, 418 is the value. In the console of the debugger I can write bookmarks.length and it will give me the correct length. I can type for(x = 0; x < bookmarks.length; x++){ console.debug(bookmarks[x]); } and I get string representations of each inner array. However, that original console.debug(bookmarks.length) gives an output of zero. And if I add console.debug(bookmarks[0]); to the popup.html it tells me that the value is undefined. This seems like a bug to me, but my real question is how can I iterate over this list? Thanks

    Read the article

  • Reading from an write-only(OUT) parameter in pl/sql

    - by sqlgrasshopper5
    When I tried writing to an read-only parameter(IN) of a function, Oracle complains with an error. But that is not the case when reading from an write-only(OUT) parameter of a function. Oracle silently allows this without any error. What is the reason for this behaviour?. The following code executes without any assignment happening to "so" variable: create or replace function foo(a OUT number) return number is so number; begin so := a; --no assignment happens here a := 42; dbms_output.put_line('HiYA there'); dbms_output.put_line('VAlue:' || so); return 5; end; / declare somevar number; a number := 6; begin dbms_output.put_line('Before a:'|| a); somevar := foo(a); dbms_output.put_line('After a:' || a); end; / Here's the output I got: Before a:6 HiYA there VAlue: After a:42

    Read the article

  • <input type="file"> reads only file name not full path

    - by Deep
    I am using Glassfish Server.I have seen the apache file upload to solve it...but i want to implement it in glassfish server. image.html <form action="" method="post" enctype="multipart/form-data"> Select a file: <input type="file" name="first" id="first"/> <br /> <input type="button" name="button" value="upload" id="button" /> <p id="test"></p> <img src='Unknown.png' id="profile_img" height="200px" width="150px"/> </form> test.js $(document).ready(function() { var filepath= $("#first"); $('#button').click(function() { $.ajax({ type: "post", url: "imageservlet", data: "user="+filepath.val(), success: function(msg) { $("#profile_img").attr('src',msg); $("#test").html(msg) .fadeIn("fast"); } }); }); }); imageservlet.java String user=request.getParameter("user"); out.print(user); the output is file name not full path.

    Read the article

  • Use string to store statement (or part of a statement), and then add it to the code

    - by Dean
    I use multidimensional arrays to store product attributes (well Virtuemart does, to be precise). When I tried to echo the sub-arrays value, if the sub-array did not exist PHP threw: Fatal error: Cannot use string offset as an array To get around this, I attempted to create a function to check on every array level if it is an actual array, and if it is empty (when trying on the whole thing at once such as: is_array($array['level1']['level2']['level3']), I got the same error if level1 or level2 are not actual arrays). This is the function ($array contains the array to check, $array_levels is an array containing the names of the sub-arrays, in the order they should apper): function check_md_array($array,$array_levels){ if(is_array($array)){ $dimension = null; //This will store the dimensions string foreach($array_levels as $level){ $dimension .= "['" . $level . "']"; //Add the current dimension to the dimensions string if(!is_array($array/* THE CONTENT OF $dimension SHOULD BE INSERTED HERE*/)){ return false; } } return true; } } How can I take the string contained in $dimensions, and insert it into the code, to be part of the statement?

    Read the article

  • jQuery indexOf select box manipulation

    - by kenny99
    Hi, I'm trying to figure out how to remove options from a select box when that option has been selected in an adjacent select box. Basically the user has the option to add multiple records here via select boxes, but I want to remove the list of options available to them so that, for example, they can't enter the same value in two select boxes. When an Add More button is clicked, I fade in the next select box container. A number of select boxes have been generated by PHP and I use JS to hide them. Each select box has a unique number appended to the ID, so i want to access those select boxes which contain the string "other_pet_types", then I want to iterate through the currently visible ones and build an array of the values which have been selected, which I will then remove from the list of options in the newly displayed select box. This is what I have so far, but it's definitely not right - I can't get the initial test on the ID to work. Any pointers greatly appreciated as i realise i'm pretty wide of the mark at the moment! var vals = new Array(); //build array with currently selected options $('p.mult_entries select').each(function(){ vals += $(this).val(); }); $("p.mult_entries:hidden:first").fadeIn("slow", function() { $(this).find(('select').attr('id').indexOf('other_pet_types') > 0).each(function(){ console.log($(this).val()); //as expected prints nothing - need to iterate through the options of the above select //once i extract the correct values, iterate through new select box and use inArray to remove options where that value already exists in one of previous select boxes }); });

    Read the article

  • Flex customized Horizental List

    - by muzammal
    i have customized Horizontal List (items are image and some text) of a reel with some no of clips . i have customized highlight , un highlight and select style , which will be implemented dynamically and mouse over and out. now pproblem is to make un highlight previously playing clip. enter code here styleName="unhighlightedClip" updateComplete="currentlyPlaying();" rollOver="highlighted();" rollOut="unhighlighted();" .currentlyPlayingClip{ borderColor: #95123E; borderStyle: solid; borderThickness: 2; } .unhighlightedClip{ borderStyle: none; } .highlightedClip{ borderColor: #70BAE7; borderStyle: solid; borderThickness: 2; } </mx:Style> <mx:Script> <![CDATA[ import mx.controls.Alert; import mx.controls.HorizontalList; private var prevIndex:int = -1; protected function unhighlighted():void{ var selected:Boolean = HorizontalList(this.owner).isItemSelected(this.data); clipDesription.useHandCursor = false; clipStartTime.useHandCursor = false; this.useHandCursor = false; if(!selected) this.setStyle('styleName', 'unhighlightedClip'); } protected function highlighted():void{ clipDesription.useHandCursor = true; clipStartTime.useHandCursor = true; this.useHandCursor = true; var selected:Boolean = HorizontalList(this.owner).isItemSelected(this.data); if(!selected) this.setStyle('styleName', 'highlightedClip'); } protected function currentlyPlaying():void{ var selected:Boolean = HorizontalList(this.owner).isItemSelected(this.data); var currentIndex:int = HorizontalList(this.owner).selectedIndex; if(selected) this.setStyle('styleName', 'currentlyPlayingClip'); // else if(prevIndex != currentIndex ) // this.setStyle('styleName', 'unhighlightedClip'); // // prevIndex = currentIndex; } ]]

    Read the article

  • Access is denied. Javascript error on request to secured page

    - by ihorko
    On SomePage.aspx page by javascript (XMLHttpRequest) I call SecuredPage.aspx used next code: var httpRequest = GetXmlHttp(); var url = "https://myhost.com/SecuredPage.aspx"; var params = "param1=" + document.getElementById('param1').value + "&param2=" + document.getElementById('param2').value; httpRequest.open("POST", url, true); httpRequest.setRequestHeader("Content-Type", "application/x-www-form-urlencoded"); httpRequest.onreadystatechange = function() { //Call a function when the state changes. if (httpRequest.readyState == 4 && httpRequest.status == 200) { alert(httpRequest.responseText); } } httpRequest.send(params); // HERE ACCESS IS DENIED //--------------------------------------------- function GetXmlHttp() { var xmlhttp = false; if (window.XMLHttpRequest) { xmlhttp = new XMLHttpRequest(); } else if (window.ActiveXObject) // code for IE { try { xmlhttp = new ActiveXObject("Msxml2.XMLHTTP"); } catch (e) { try { xmlhttp = new ActiveXObject("Microsoft.XMLHTTP"); } catch (E) { xmlhttp = false; } } } return xmlhttp; } It throws Access is denied error. if send to http (http://myhost.com/SecuredPage.aspx), it works fine. How is it possible to resolve that problem. Thanks!

    Read the article

  • JS: Object itteration fails

    - by Newbie
    Hello! In my JS, I have an object called box_object. It looks like this: ({ id:"3", text:"this is a box object", connection_parent:["1", "2"], connection_child:["5", "6"], connectiondata_child:{ 0:{id:"5", linepoint:"bottom"}, 1:{id:"6", linepoint:"bottom"}}, connectiondata_parent:{ 0:{id:"1", linepoint:"top"}, 1:{id:"2", linepoint:"top"}} }) Now, I want to add some position values to box_object.connectiondata_parent. Using jQuery I can use the .each() method. So I tried it, but it failed. In my function I do the following: $(box_object.connectiondata_parent).each(function(it, obj){ if(typeof(obj[it]) != "undefined" && obj[it].linepoint == "top"){ var point_position_top = new Object(); point_position_top.left = startingpoint_left; point_position_top.top = startingpoint_top; obj[it].position = point_position_top; }else if(typeof(obj[it]) != "undefined" && obj[it].linepoint == "bottom"){ var point_position_bottom = new Object(); point_position_bottom.left = startingpoint_left; point_position_bottom.top = startingpoint_bottom; obj[it].position = point_position_bottom; }else{} }); After the function my box_object looks like this: ({ id:"3", text:"this is third box", connection_parent:["1", "2"], connection_child:["5", "6"], connectiondata_child:{ 0:{id:"5", linepoint:"bottom"}, 1:{id:"6", linepoint:"bottom"}}, connectiondata_parent:{ 0:{id:"1", linepoint:"top", position:{left:500, top:104}}, 1:{id:"2", linepoint:"top"}} }) It seems it only writes the values to the first "value". Any Ideas why?

    Read the article

  • HREF link that targets nothing, does not want to use hash or void(0)

    - by Mattis
    I have a link that I want to be able to click to trigger a piece of jQuery code. Currently I have <a href="#" id="foo">Link</a> and $('#foo').click(function(){ // Do stuff }); which works well. But, I have always hated using hash in this way. The page flickers and the hash is added to the page url. One alternative is to use <a href="javascript:void(0);" id="foo">Link</a> but I also dislike seeing that piece of code in the browser status bar. It looks tacky. What I'd rather have is an explanatory javascript placeholder that does nothing, like <a href="javascript:zoom();" id="foo">Link</a> which actually works, but throws an ReferenceError in the javascript console since there are no such function. What's the minimum definition of a function that does nothing? Are there any other alternatives? Should I just skip the link and use something like <span id="foo" style="cursor:pointer;cursor:hand;">Link</span> instead?

    Read the article

  • JSON to javaScript array

    - by saturn_research
    I'm having a problem handling JSON data within JavaScript, specifically in regards to using the data as an array and accessing and iterating through individual values. The JSON file is structured as follows: { "head": { "vars": [ "place" , "lat" , "long" , "page" ] } , "results": { "bindings": [ { "place": { "type": "literal" , "value": "Building A" } , "lat": { "datatype": "http://www.w3.org/2001/XMLSchema#float" , "type": "typed-literal" , "value": "10.3456" } , "long": { "datatype": "http://www.w3.org/2001/XMLSchema#float" , "type": "typed-literal" , "value": "-1.2345" } , "page": { "type": "uri" , "value": "http://www.example.com/a.html" } } , { "place": { "type": "literal" , "value": "Building B" } , "lat": { "datatype": "http://www.w3.org/2001/XMLSchema#float" , "type": "typed-literal" , "value": "11.3456" } , "long": { "datatype": "http://www.w3.org/2001/XMLSchema#float" , "type": "typed-literal" , "value": "-2.2345" } , "page": { "type": "uri" , "value": "http://www.example.com/b.html" } } , { "place": { "type": "literal" , "value": "Building C" } , "lat": { "datatype": "http://www.w3.org/2001/XMLSchema#float" , "type": "typed-literal" , "value": "12.3456" } , "long": { "datatype": "http://www.w3.org/2001/XMLSchema#float" , "type": "typed-literal" , "value": "-3.2345" } , "page": { "type": "uri" , "value": "http://www.example.com/c.html" } } ] } } I want to be able to convert this into a JavaScript array as follows in order that I can iterate through it and pull out the values for each location in order: var locations = [ ['Building A',10.3456,-1.2345,'http://www.example.com/a.html'], ['Building B',11.3456,-2.2345,'http://www.example.com/b.html'], ['Building C',12.3456,-3.2345,'http://www.example.com/c.html'] ]; Does anyone have any advice on how to achieve this? I have tried the following, but it picks up the "type" within the JSON, rather than just the value: $.each(JSONObject.results.bindings, function(i, object) { $.each(object, function(property, object) { $.each(object, function(property, value) { value; }); }); }); Any help, suggestions, advice or corrections would be greatly appreciated.

    Read the article

  • Jquery Ajax + PHP

    - by Kris.Mitchell
    I am having problems with jQuery Ajax and PHP I have my php file set up to echo the data I am gathering from a mysql database. I have verified that the database is returning something and that the string at the end of the function actually contains data. What is happening though, is that it looks like the php echo is happening before the ajax call, causing the php data to be displayed at the top of the page, and not below in proper div. I think it might have something to do with timing of the ajax and the php call, but I am not sure. So, why is the data not getting caught by the .ajax and thrown into the div? Thanks for the help! jQuery $(document).ready(function() { $.ajax({ url: "../database_functions.php", type: "GET", data: "cat=jw&sub=pi&sort=no", cache: false, success: function (html) { alert("Success!"); $('#product-list').html(html); } }); }); PHP echo "Hello World";

    Read the article

  • Symfony2 entity field type alternatives to "property" or "__toString()"?

    - by Polmonino
    Using Symfony2 entity field type one should specify property option: $builder->add('customers', 'entity', array( 'multiple' => true, 'class' => 'AcmeHelloBundle:Customer', 'property' => 'first', )); But sometimes this is not sufficient: think about two customers with the same name, so display the email (unique) would be mandatory. Another possibility is to implement __toString() into the model: class Customer { public $first, $last, $email; public function __toString() { return sprintf('%s %s (%s)', $this->first, $this->last, $this->email); } } The disadvances of the latter is that you are forced to display the entity the same way in all your forms. Is there any other way to make this more flexible? I mean something like a callback function: $builder->add('customers', 'entity', array( 'multiple' => true, 'class' => 'AcmeHelloBundle:Customer', 'property' => function($data) { return sprintf('%s %s (%s)', $data->first, $data->last, $data->email); }, ));

    Read the article

  • qTip pop ups come in from top left of screen (on first load)

    - by franko75
    Hi, not sure if i'm set things up incorrectly - I don't seem to see anyone else with this problem, but my qTip popups (all ajax loaded content) are loading quite erratically, in that they are often animating in from off screen before appearing in the correct position. Is there a simple solution to this which I may have missed? Thanks again for your help. HTML markup: <span class="formInfo"> <a href="http://localhost/httpdocs/index.php/help/kc_dob" class="jTip" name="" id="dob_help">?</a> </span> qTip initialisation.. //set up for qtip function initQtip() { $('a.jTip').each(function() { $(this).qtip( { content: { // Set the text to an image HTML string with the correct src URL to the loading image you want to use text: '<img src="/media/images/wait.gif" alt="Loading..." />', url: $(this).attr('href') // Use the rel attribute of each element for the url to load }, position: { adjust: { screen: true // Keep the tooltip on-screen at all times } }, show: { when: 'click', solo: true // Only show one tooltip at a time }, hide: 'unfocus', style: { tip: true, // Apply a speech bubble tip to the tooltip at the designated tooltip corner border: { width: 10, radius: 10 }, width: { min: 200, max: 500 }, name: 'light' // Use the default light style } }); //prevent default event on click }).bind('click', function(event){ event.preventDefault(); return false; }); }

    Read the article

  • waiting for a signal

    - by Umesha MS
    Hi, I am working on an application which uploads the content of the file to server. To upload the file to server I am using ‘QNetworkAccessManager’ class. Since it works as asynchronous way, I changed it to work as synchronous way by using QEventLoop. Class FileTransfer { Public : QNetworkAccessManager mNetworkManager; Void Upload(QNetworkRequest request, QIODevice *data) { responce = mNetworkManager.put(request, data); EventLoop.exec(); ReadResponce(responce); } Void Stop() { responce ->close(); } } In my sample application I have 2 windows. 1st to select the files and 2nd to show the progress. When user click on upload button in the first window, the 2nd window will be displayed and then I create the FileTransfer object and start uploading. While uploading the file if user closes the form then in the destructor of the window I call the stop of ‘FileTransfer’ after that I delete the ‘FileTransfer’ object. But here the Upload() function is not yet completed so it will crash. Please help me to: How to wait in 'stop()' function until the Upload() function is completed

    Read the article

  • jQuery Ajax loads URL multiple times, how do I unbind/rebind properly?

    - by gmoz22
    I load a SELECT element via Ajax (list of brands), get its selected value (brand id) and load another SELECT via another Ajax URL (list of templates for currently selected brand). Here's my code: $(document).ready( function() { // DO NOT cache Ajax calls $.ajaxSetup ({ cache: false }); // loader var ajax_load = "Loading..."; // Brands List URL var loadBrandUrl = "getBrandsList.php"; // Templates List URL var loadTemplateUrl = "getTemplatesList.php"; $("#brandslistSelect").html(ajax_load).load(loadBrandUrl) .ajaxComplete(function(){ // Brands select loaded /* Load Templates SELECT the first time since no .change() has happened */ var selectedBrand = $("#brandslistSelect option:selected").attr("value"); // get the value console.log(selectedBrand); // Log selected brand to console // get Templates select, commented for now since it does an infinite loop // $("#templateslistSelect").html(ajax_load).load(loadTemplateUrl, { BrandId: selectedBrand } ); /* End initial load template */ /* On interaction with the Brands SELECT */ $("#brandslistSelect").change(function () { // on interaction with select selectedBrand = $("#brandslistSelect option:selected").attr("value"); // get the value // get Templates SELECT $("#templateslistSelect").html(ajax_load).load(loadTemplateUrl, { BrandId: selectedBrand } ) }); /* End interaction with the Brands SELECT */ }); }); It returns selectedBrand in the console 3 times : selectedBrand = undefined selectedBrand = undefined selectedBrand = 101 Now, if I uncomment the following line, same output as above but it also loads the templates URL indefinitely : // $("#templateslistSelect").html(ajax_load).load(loadTemplateUrl, { BrandId: selectedBrand } ); Any idea how I could modify this code to make it work as intended? Thanks for your help stackOverflow community!

    Read the article

  • Jquery tabs with cookie support restore wrong tab position after page refresh.

    - by zenonych
    Hello, all. I have tricky problem which I can't completely understand... It's jquery tabs with cookie support. I've following code: $(document).ready(function() { var $tabs = $("#tabs").tabs(); $tabs.tabs('select', $.cookie("tabNumber")); $('#tabs ul li a').click(function() { $.cookie("tabNumber", $tabs.tabs('option', 'selected')); }); $('#btnSelect').click(function() { //alert($.cookie("tabNumber")); //$tabs.tabs('select', 2); $tabs.tabs('select', $.cookie("tabNumber")); }); }); So, I've 3 tabs (with positions 0,1,2) inside div named "tabs". When user selects one tab, then tab position stores in cookie. After that if user refresh page, active tab position must be restored. But each time I refresh page I get active tab in previous position (if I select 2nd tab, then after refresh I got active tab in position 1, etc.). I add some test in code (button btnSelect with onclick handler which duplicates load position functionality). So, if I uncomment and use $tabs.tabs('select', 2); Then after I click btnSelect I've got right position. Ok, that's right. Then I comment that line and uncomment next one: alert($.cookie("tabNumber")); So, I select tab, click button, get dialog message "2", and after that tab in position 1 became active. Why?? In both cases I call 'select' method with parameter 2... I know I can use aliases for tabs, but I want to understate why my code doesn't work properly.

    Read the article

  • Loading city/state from SQL Server to Google Maps?

    - by knawlejj
    I'm trying to make a small application that takes a city & state and geocodes that address to a lat/long location. Right now I am utilizing Google Map's API, ColdFusion, and SQL Server. Basically the city and state fields are in a database table and I want to take those locations and get marker put on a Google Map showing where they are. This is my code to do the geocoding, and viewing the source of the page shows that it is correctly looping through my query and placing a location ("Omaha, NE") in the address field, but no marker, or map for that matter, is showing up on the page: function codeAddress() { <cfloop query="GetLocations"> var address = document.getElementById(<cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput>).value; if (geocoder) { geocoder.geocode( {<cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput>: address}, function(results, status) { if (status == google.maps.GeocoderStatus.OK) { var marker = new google.maps.Marker({ map: map, position: results[0].geometry.location, title: <cfoutput>#Trim(hometown)#,#Trim(state)#</cfoutput> }); } else { alert("Geocode was not successful for the following reason: " + status); } }); } </cfloop> } And here is the code to initialize the map: var geocoder; var map; function initialize() { geocoder = new google.maps.Geocoder(); var latlng = new google.maps.LatLng(42.4167,-90.4290); var myOptions = { zoom: 5, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP } var marker = new google.maps.Marker({ position: latlng, map: map, title: "Test" }); map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); } I do have a map working that uses lat/long that was hard coded into the database table, but I want to be able to just use the city/state and convert that to a lat/long. Any suggestions or direction? Storing the lat/long in the database is also possible, but I don't know how to do that within SQL.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Event Source Live streaming in Ruby on rails onError method

    - by kishorebjv
    I'm trying to implement basic rails4 code with eventsource API & Action controller live, Everything is fine but I'm not able to reach event listner . Controller code: class HomeController < ApplicationController include ActionController::Live def tester response.headers["Content-Type"] = "text/event-stream" 3.times do |n| response.stream.write "message: hellow world! \n\n" sleep 2 end end Js code: var evSource = new EventSource("/home/tester"); evSource.onopen = function (e) { console.log("OPEN state \n"+e.data); }; evSource.addEventListener('message',function(e){ console.log("EventListener .. code.."); },false); evSource.onerror = function (e) { console.log("Error State \n\n"+e.data); }; & When i reloading the page, My console output was "OPEN state" & then "Error State" as output.. event-listener code was not displaying . 1.When I'm curling the page, "message: Hellow world!" was displaying. 2.I changed in development.rb config.cache_classes = true config.eager_load = true 3. My browsers are chrome & firefox are latest versions, so no issues with them, Where I'm missing? suggestions please!

    Read the article

  • Noobie Jquery Question

    - by piratebill
    I've been working with Jquery fro a grand total of two hours now. Up until this point I have made this really simple FAQ page. <script type="text/javascript" src="jquery.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#void").click(function(event) { event.preventDefault(); }); $('#faq').find('dd').hide().end().find('dt').click(function() { $(this).next().slideToggle(); }); }); </script> <dl id="faq"> <dt><a href="" id="void">Coffee</a></dt> <dd>- black hot drink</dd> <dt><a href="" id="void">Milk</a></dt> <dd>- white cold drink</dd> </dl> The problem is only the first item is working. My questions are, why is only the first entree working and how do I fix it? I've tried using an each() but I am unsure where to put it.

    Read the article

< Previous Page | 577 578 579 580 581 582 583 584 585 586 587 588  | Next Page >