Search Results

Search found 16385 results on 656 pages for 'fusion applications'.

Page 582/656 | < Previous Page | 578 579 580 581 582 583 584 585 586 587 588 589  | Next Page >

  • How do I create a .NET Web Service that Posts items to a users Facebook Wall?

    - by Jourdan
    I'm currently toying around with the Clarity .NET Facebook API but am finding certain situations with authentication to be kind of limiting. I keep going through the tutorials but always end up hitting a brick wall with what I want to do. Perhaps I just cannot do it? I want to make a Web Service that takes in the require credentials (APIKey, SecretKey, UsersId (or Session Key?) and whatever else I would need), and then do various tasks: Post to users wall, add events etc. The problem I am having is this: The current documentation, examples and support provide a way to do this within the context of a Web site. Within this context, the required "connect" popup can be initiated and allow the user to authenticate and and connect the application. From that point on the Web can go on with its business to do what it needs to do. If I close the browser and come back to the page, I have to push the connect button again. Except this time, since I was already logged into facebook, I don't have to go through the whole connection process. But still ... How do applications like Tweetdeck get around this? They seemingly have you connect once, when you install their application, and you don't have to do it again. I would assume that this same idea would have to applied towards making a web service because: You don't know what context the user is in when making the Web service call. The web service methods being called could be coming from a Windows Form app, or code behind in a workflow.

    Read the article

  • Memory mapped files and "soft" page faults. Unavoidable?

    - by Robert Oschler
    I have two applications (processes) running under Windows XP that share data via a memory mapped file. Despite all my efforts to eliminate per iteration memory allocations, I still get about 10 soft page faults per data transfer. I've tried every flag there is in CreateFileMapping() and CreateFileView() and it still happens. I'm beginning to wonder if it's just the way memory mapped files work. If anyone there knows the O/S implementation details behind memory mapped files I would appreciate comments on the following theory: If two processes share a memory mapped file and one process writes to it while another reads it, then the O/S marks the pages written to as invalid. When the other process goes to read the memory areas that now belong to invalidated pages, this causes a soft page fault (by design) and the O/S knows to reload the invalidated page. Also, the number of soft page faults is therefore directly proportional to the size of the data write. My experiments seem to bear out the above theory. When I share data I write one contiguous block of data. In other words, the entire shared memory area is overwritten each time. If I make the block bigger the number of soft page faults goes up correspondingly. So, if my theory is true, there is nothing I can do to eliminate the soft page faults short of not using memory mapped files because that is how they work (using soft page faults to maintain page consistency). What is ironic is that I chose to use a memory mapped file instead of a TCP socket connection because I thought it would be more efficient. Note, if the soft page faults are harmless please note that. I've heard that at some point if the number is excessive, the system's performance can be marred. If soft page faults intrinsically are not significantly harmful then if anyone has any guidelines as to what number per second is "excessive" I'd like to hear that. Thanks.

    Read the article

  • DDD and Client/Server apps

    - by Christophe Herreman
    I was wondering if any of you had successfully implemented DDD in a Client/Server app and would like to share some experiences. We are currently working on a smart client in Flex and a backend in Java. On the server we have a service layer exposed to the client that offers CRUD operations amongst some other service methods. I understand that in DDD these services should be repositories and services should be used to handle use cases that do not fit inside a repository. Right now, we mimic these services on the client behind an interface and inject implementations (Webservices, RMI, etc) via an IoC container. So some questions arise: should the server expose repositories to the client or do we need to have some sort of a facade (that is able to handle security for instance) should the client implement repositories (and DDD in general?) knowing that in the client, most of the logic is view related and real business logic lives on the server. All communication with the server happens asynchronously and we have a single threaded programming model on the client. how about mapping client to server objects and vice versa? We tried DTO's but reverted back to exposing the state of our objects and mapping directly to them. I know this is considered bad practice, but it saves us an incredible amount of time) In general I think a new generation of applications is coming with the growth of Flex, Silverlight, JavaFX and I'm curious how DDD fits into this.

    Read the article

  • Non RBAC User Roles and Permissions System: checking the user's City

    - by micha12
    We are currently designing a User Roles and Permissions System in our web application (ASP.NET), and it seems that we have several cases that do no fit within the classical Role-Based Access Control (RBAC). I will post several questions, each devoted to a particular case, this being the first post. We have the following case: not to allow a user view a certain page if the user lives in a particular city. This is a simple case that is coded in the following way: if (User.City == “Moscow”) // Allow the user to view the page. else // Do not allow the user to view this page. Though this case is very simple and straightforward, it has nothing to do with the RBAC. On StackOverflow, someone called this an Attribute-based Access Control. Under the classical RBAC, it seems that this case should be designed like this: introduce a permission “City where the person lives”, this permission will have a property City. Then create a role, add a permission of type “City = Moscow” to it and the assign the role to the user. Looks extremely cumbersome. The question is whether it is acceptable to introduce such non-RBAC approaches to our permissions system – does that break the design or not? This might seem a primitive question, but we found that most applications use pure RBAC, and we started to think that we might be doing something wrong. Thank you.

    Read the article

  • iPhone Landscape FAQ and Solutions

    - by Johannes Rudolph
    There has been a lot of confusion and a set of corresponding set of questions here on SO how iPhone applications with proper handling for Landscape/Portrait mode autorotation can be implemented. It is especially difficult to implement such an application when starting in landscape mode is desired. The most common observed effect are scrambled layouts and areas of the screen where touches are no longer recognized. A simple search for questions tagged iphone and landscape reveals these issues, which occur under certain scenarios: Landscape only iPhone app with multiple nibs: App started in Landscape mode, view from first nib is rendered fine, everything view loaded from a different nib is not displayed correctly. Iphone Landscape mode switching to Portraite mode on loading new controller: Self explanatory iPhone: In landscape-only, after first addSubview, UITableViewController doesn’t rotate properly: Same issue as above. iPhone Landscape-Only Utility-Template Application: Layout errors, controller does not seem to recognize the view should be rotated but displays a clipped portrait view in landscape mode, causing half of the screen to stay blank. presentModalViewController in landscape after portrait viewController: Modal views are not correctly rendered either. A set of different solutions have been presented, some of them including completely custom animation via CoreGraphics, while others build on the observation that the first view controller loaded from the main nib is always displayed correct. I have spent a significant amount of time investigating this issue and finally found a solution that is not only a partial solution but should work under all these circumstances. It is my intend with this CW post to provide sort of a FAQ for others having issues with UIViewControllers in Landscape mode. Please provide feedback and help improve the quality of this Post by incorporating any related observations. Feel free to edit and post other/better answers if you know of any.

    Read the article

  • What exactly is the difference between the Dreamhost IDE and Netbeans?

    - by mikemick
    I just started using Netbeans about a week ago, and really like it thus far. Now I'm seeing something about Dreamhost IDE which I guess is a program that is built using the Netbeans platform. I use Dreamhost as the hosting company for many of my projects. What is the benefit of using Dreamhost IDE over Netbeans? Documentation on the software is non-existent from what I can tell (not even a mention in the Dreamhost wiki). All I was able to find was a short description of what it was on a Sourceforge download page, and I found a short silent video on YouTube demoing it. So I guess I'm asking, what features is it bringing to the table, and what is the difference between it and Netbeans? The description on the Sourceforge page is as follows (typos retained)... DreamHost IDE is php and ruby integrated development environment built on NetBeans IDE and provides easy deploy of your applications to the DreamHost services. Also provides you an easy eay hew to setup these services. Maybe the answer is in the description, and I just don't comprehend it?

    Read the article

  • TLS with SNI in Java clients

    - by ftrotter
    There is an ongoing discussion on the security and trust working group for NHIN Direct regarding the IP-to-domain mapping problem that is created with traditional SSL. If an HISP (as defined by NHIN Direct) wants to host thousands of NHIN Direct "Health Domains" for providers, then it will an "artificially inflated cost" to have to purchase an IP for each of those domains. Because Apache and OpenSSL have recently released TLS with support for the SNI extension, it is possible to use SNI as a solution to this problem on the server side. However, if we decide that we will allow server implementations of the NHINDirect transport layer to support TLS+SNI, then we must require that all clients support SNI too. OpenSSL based clients should do this by default and one could always us stunnel to implement an TLS+SNI aware client to proxy if your given programming language SSL implementation does not support SNI. It appears that native Java applications using OpenJDK do not yet support SNI, but I cannot get a straight answer out of that project. I know that there are OpenSSL Java libraries available but I have no idea if that would be considered viable. Can you give me a "state of the art" summary of where TLS+SNI support is for Java clients? I need a Java implementers perspective on this.

    Read the article

  • Better why of looping to detect change.

    - by Dremation
    As of now I'm using a while(true) method to detect changes in memory. The problem with this is it's kill the applications performance. I have a list of 30 pointers that need checked as rapidly as possible for changes, without sacrificing a huge performance loss. Anyone have ideas on this? memScan = new Thread(ScanMem); public static void ScanMem() { int i = addy.Length; while (true) { Thread.Sleep(30000); //I do this to cut down on cpu usage for (int j = 0; j < i; j++) { string[] values = addy[j].Split(new char[] { Convert.ToChar(",") }); //MessageBox.Show(values[2]); try { if (Memory.Scanner.getIntFromMem(hwnd, (IntPtr)Convert.ToInt32(values[0], 16), 32).ToString() != values[1].ToString()) { //Ok, it changed lets do our work //work if (Globals.Working) return; SomeFunction("Results: " + values[2].ToString(), "Memory"); Globals.Working = true; }//end if }//end try catch { } }//end for }//end while }//end void

    Read the article

  • Automatically generating Regex from set of strings residing in DB C#

    - by Muhammad Adeel Zahid
    Hello Everyone i have about 100,000 strings in database and i want to if there is a way to automatically generate regex pattern from these strings. all of them are alphabetic strings and use set of alphabets from English letters. (X,W,V) is not used for example. is there any function or library that can help me achieve this target in C#. Example Strings are KHTK RAZ given these two strings my target is to generate a regex that allows patterns like (k, kh, kht,khtk, r, ra, raz ) case insensitive of course. i have downloaded and used some C# applications that help in generating regex but that is not useful in my scenario because i want a process in which i sequentially read strings from db and add rules to regex so this regex could be reused later in the application or saved on the disk. i m new to regex patterns and don't know if the thing i m asking is even possible or not. if it is not possible please suggest me some alternate approach. Any help and suggestions are highly appreciated. regards Adeel Zahid

    Read the article

  • What are alternatives to Win32 PulseEvent() function?

    - by Bill
    The documentation for the Win32 API PulseEvent() function (kernel32.dll) states that this function is “… unreliable and should not be used by new applications. Instead, use condition variables”. However, condition variables cannot be used across process boundaries like (named) events can. I have a scenario that is cross-process, cross-runtime (native and managed code) in which a single producer occasionally has something interesting to make known to zero or more consumers. Right now, a well-known named event is used (and set to signaled state) by the producer using this PulseEvent function when it needs to make something known. Zero or more consumers wait on that event (WaitForSingleObject()) and perform an action in response. There is no need for two-way communication in my scenario, and the producer does not need to know if the event has any listeners, nor does it need to know if the event was successfully acted upon. On the other hand, I do not want any consumers to ever miss any events. In other words, the system needs to be perfectly reliable – but the producer does not need to know if that is the case or not. The scenario can be thought of as a “clock ticker” – i.e., the producer provides a semi-regular signal for zero or more consumers to count. And all consumers must have the correct count over any given period of time. No polling by consumers is allowed (performance reasons). The ticker is just a few milliseconds (20 or so, but not perfectly regular). Raymen Chen (The Old New Thing) has a blog post pointing out the “fundamentally flawed” nature of the PulseEvent() function, but I do not see an alternative for my scenario from Chen or the posted comments. Can anyone please suggest one? Please keep in mind that the IPC signal must cross process boundries on the machine, not simply threads. And the solution needs to have high performance in that consumers must be able to act within 10ms of each event.

    Read the article

  • Common JNDI resources in Tomcat

    - by Lehane
    Hi, I’m running a couple of servlet applications in Tomcat (5.5). All of the servlets use a common factory resource that is shared out using JNDI. At the moment, I can get everything working by including the factory resource as a GlobalNamingResource in the /conf/server.xml file, and then having each servlet’s META-INF/context.xml file include a ResourceLink to the resource. Snippets from the XML files are included below. NOTE: I’m not that familiar with tomcat, so I’m not saying that this is a good configuration!!! However, I now want to be able install these servlets into multiple tomcat instances automatically using an RPM. The RPM will firstly copy the WARs to the webapps directory, and the jars for the factory into the common/lib directory (which is fine). But it will also need to make sure that the factory resource is included as a resource for all of the servlets. What is the best way add the resource globally? I’m not too keen on writing a script that goes into the server.xml file and adds in the resource that way. Is there any way for me to add in multiple server.xml files so that I can write a new server-app.xml file and it will concatenate my settings to server.xml? Or, better still to add this JNDI resource to all the servlets without using server.xml at all? p.s. Restarting the server will not be an issue, so I don’t mind if the changes don’t get picked up automatically. Thanks Snippet from server.xml <!-- Global JNDI resources --> <GlobalNamingResources> <Resource name="bean/MyFactory" auth="Container" type="com.somewhere.Connection" factory="com.somewhere.MyFactory"/> </GlobalNamingResources> The entire servlet’s META-INF/context.xml file <?xml version="1.0" encoding="UTF-8"?> <Context> <ResourceLink global="bean/MyFactory" name="bean/MyFactory" type="com.somewhere.MyFactory"/> </Context>

    Read the article

  • Is there any way to access files in your source tree in Android?

    - by Chris Thompson
    Hi all, This is a bit unorthodox but I'm trying to figure out if there's a way to access files stored in the src tree of my applications apk in Android. I'm trying to use i-Jetty (Jetty implementation for Android) and rather than use it as a separate application and manually download my war file, I'd rather just bake i-jetty in. However, in order to use (easily) standard html/jsp I need to be able to give it a document root, preferably within my application's apk file. I know Android specifically works to prevent you from accessing (freely) the stuff on the actual system so this may not be possible, but I'm thinking it might be possible to access something within the apk. One option to work around this would be to have all of the files stored in the res directory and then copy them to the sdcard on startup but this wouldn't allow me to automatically remove the files on uninstall. To give you an idea of what I've tried, currently, the html files are stored in org.webtext.android Context rootContext = new Context(server_, "/", Context.SESSIONS); rootContext.setResourceBase("org/webtext/webapp"); Returns a 404 error. final URL url = this.getClassLoader().getResource("org/webtext/webapp"); Context html = new WebAppContext(url.toExternalForm(), "/"); Blows up with a NullPointerException because no URL is returned from the getResource call. Any thoughts would be greatly appreciated! Thanks, Chris

    Read the article

  • Linux System Programming

    - by AJ
    I wanted to get into systems programming for linux and wanted to know how to approach that and where to begin. I come from a web development background (Python, PHP) but I also know some C and C++. Essentially, I would like to know: Which language(s) to learn and pursue (I think mainly C and C++)? How/Where to learn those languages specific to Systems Programming? Books, websites, blogs, tutorials etc. Any other good places where I can start this from basics? Any good libraries to begin with? What environment setup (or approx.) do I need? Assuming linux has to be there but I have a linux box which I rarely log into using GUI (always use SSH). Is GUI a lot more helpful or VI editor is enough? (Please let me know if this part of the question should go to serverfault.com) PS: Just to clarify, by systems programming I mean things like writing device drivers, System tools, write native applications which are not present on Linux platform but are on others, play with linux kernel etc.

    Read the article

  • How can I display the users profile pic using the facebook graph api?

    - by kielie
    Hi, I would like to display the users profile picture inside of my applications canvas page, is there a way to do that using the graph api? I know I can do it using FBML but I would also like to pass the profile pic to a flash game I am making, so I would have to get the profile pic from the api and send it as a variable, here is the code I have thus far, $facebook = new Facebook(array( 'appId' => FACEBOOK_APP_ID, 'secret' => FACEBOOK_SECRET_KEY, 'cookie' => true, 'domain' => 'myurl/facebook-test' )); $session = $facebook->getSession(); $uid = $facebook->getUser(); $me = $facebook->api('/me'); $updated = date("l, F j, Y", strtotime($me['updated_time'])); echo "Hello " . $me['name'] . $me['picture'] . "<br />"; echo "<div style=\"background:url(images/bg.jpg); width:760px; height:630px;\">" . "You last updated your profile on " . $updated . "</div>" . "<br /> your uid is" . $uid; Thanx in advance!

    Read the article

  • How can I call from my PC through my cisco ip phone?

    - by Enjoy coding
    Hi gurus, I am trying to call a telephone number fro my PC through my ip phone once my application completes its work. So I am searching for a way to access my ip phone from my PC. Please correct me if I am wrong or missing the obvious. On my PC in office selecting a phone in Microsoft office communicator and making calls from PC through my Cisco IP Phone is disabled. Is there any way i can programmatically call a external phone or mobile number from my PC as my ip phone is connected to my PC. I tried out etQuickDial and Make/Drop calls. But I am not able to find the appropriate way or setup to make calls. I also googled for any libraries and i saw some TAPI but was not able to get correct way. Please help me out with this. My cisco ip phone is 7940. My environment is Windows XP. Please let me know if you need more details. No problems with me even if you propose a solution involving coding or a non coding way of downloading and installing any applications. Thanks in advance. If you dont want me to post it here and If I need to put it in super user or server fault or some where else please direct me appropriately. I did not use any of these two before so I posted this question here.

    Read the article

  • Django deployment - can't import app.urls

    - by hora
    I just moved a django project to a deployment server from my dev server, and I'm having some issues deploying it. My apache config is as follows: <Location "/"> Order allow,deny Allow from all SetHandler python-program PythonHandler django.core.handlers.modpython SetEnv DJANGO_SETTINGS_MODULE project.settings PythonDebug On PythonPath "['/home/django/'] + sys.path" </Location> Django does work, since it renders the Django debug views, but I get the following error: ImportError at / No module named app.urls And here is all the information Django gives me: Request Method: GET Request URL: http://myserver.com/ Django Version: 1.1.1 Python Version: 2.6.5 Installed Applications: ['django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.sites', 'django.contrib.admin', 'django.contrib.admindocs', 'project.app'] Installed Middleware: ('django.middleware.common.CommonMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware') Traceback: File "/usr/lib64/python2.6/site-packages/django/core/handlers/base.py" in get_response 83. request.path_info) File "/usr/lib64/python2.6/site-packages/django/core/urlresolvers.py" in resolve 218. sub_match = pattern.resolve(new_path) File "/usr/lib64/python2.6/site-packages/django/core/urlresolvers.py" in resolve 216. for pattern in self.url_patterns: File "/usr/lib64/python2.6/site-packages/django/core/urlresolvers.py" in _get_url_patterns 245. patterns = getattr(self.urlconf_module, "urlpatterns", self.urlconf_module) File "/usr/lib64/python2.6/site-packages/django/core/urlresolvers.py" in _get_urlconf_module 240. self._urlconf_module = import_module(self.urlconf_name) File "/usr/lib64/python2.6/site-packages/django/utils/importlib.py" in import_module 35. __import__(name) Exception Type: ImportError at / Exception Value: No module named app.urls Any ideas as to why I get an import error?

    Read the article

  • Good resources for building web-app in Tapestry

    - by Rich
    Hi, I'm currently researching into Tapestry for my company and trying to decide if I think we can port our pre-existing proprietary web applications to something better. Currently we are running Tomcat and using JSP for our front end backed by our own framework that eventually uses JDBC to connect to an Oracle database. I've gone through the Tapestry tutorial, which was really neat and got me interested, but now I'm faced with what seems to be a common issue of documentation. There are a lot of things I'd need to be sure that I could accomplish with Tapestry before I'd be ready to commit fully to it. Does anyone have any good resources, be it a book or web article or anything else, that go into more detail beyond what the Tapestry tutorial explains? I am also considering integrating with Hibernate, and have read a little bit about Spring too. I'm still having a hard time understanding how Spring would be more useful than cumbersome in tandem with Tapestry,as they seem to have a lot of overlapping features. An example I read seemed to use Spring to interface with Hibernate, and then Tapestry to Spring, but I was under the impression Tapestry integrates to the same degree with Hibernate. The resource I'm speaking of is http://wiki.apache.org/tapestry/Tapstry5First_project_with_Tapestry5,_Spring_and_Hibernate . I was interested because I hadn't found information anywhere else on how to maintain user levels and sessions through a Tapestry application before, but wasn't exactly impressed by the need to use Spring in the example.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • iPhone OpenGL Splash Screen? How?

    - by Kyle
    My app is based pretty much on the EAGLView in the SDK. It doesn't incorporate a ViewController. Rather it simply inits GL and starts painting immediately.. Currently, my app will load a very small PNG and displays it as quickly as possible. On a 3GS this is rather instant, but on a 3G it can take about 2 seconds. In the latter case of the 3G, the user is looking at a black screen for that time. Is this behavior allowed by Apple? Is there any way to alter this SDK example so that it makes use of 'default.png'? It doesn't seem so straight forward to me. I want my user to see an image as quickly as possible, and I also don't want to be rejected for such a little quirk like this as well. In the guidelines, they encourage you to use default.png for standard applications to show a sort of mockup of the interface while it actually loads. I want to initialize OpenGL, and ALSO display this. This default.png is loaded before the app screen launches. This is EXACLTY what I want to make use of. Any help is appreciated. Thanks!

    Read the article

  • Help setting up command line gist

    - by smotchkkiss
    setup I'm following defunkt's gist setup guide. [smotchkkiss ~]$ sudo gem install gist [smotchkkiss ~]$ git config --global github.user "my github name" [smotchkkiss ~]$ git config --global github.token "my github token" [smotchkkiss ~]$ echo "puts 'hello, gist.'" > hello.rb [smotchkkiss ~]$ gist hello.rb output Usage: open [-e] [-t] [-f] [-W] [-n] [-g] [-h] [-b <bundle identifier>] [-a <application>] [filenames] Help: Open opens files from a shell. By default, opens each file using the default application for that file. If the file is in the form of a URL, the file will be opened as a URL. Options: -a Opens with the specified application. -b Opens with the specified application bundle identifier. -e Opens with TextEdit. -t Opens with default text editor. -f Reads input from standard input and opens with TextEdit. -W, --wait-apps Blocks until the used applications are closed (even if they were already running). -n, --new Open a new instance of the application even if one is already running. -g, --background Does not bring the application to the foreground. -h, --header Searches header file locations for headers matching the given filenames, and opens them. return value nil help! nil return value? What gives? No new gist appears in my My Gists page on github.

    Read the article

  • Linux Lightweight Distro and X Windows for Development

    - by Fernando Barrocal
    Heyall... I want to build a lightweight linux configuration to use for development. The first idea is to use it inside a Virtual Machine under Windows, or old Laptops with 1Gb RAM top. Maybe even a distributable environment for developers. So the whole idea is to use a LAMP server, Java Application Server (Tomcat or Jetty) and X Windows (any Window manager, from FVWM to Enlightment), Eclipse, maybe jEdit and of course Firefox. Edit: I am changing this post to compile a possible list of distros and window managers that can be used to configure a real lightweight development environment. I am using as base personal experiences on this matter. Info about the distros can be easily found in their sites. So please, focus on personal use of those systems Distros Ubuntu / Xubuntu Pros: Personal Experience in old systems or low RAM environment - @Schroeder, @SCdF Several sugestions based on personal knowledge - @Kyle, @Peter Hoffmann Gentoo Pros: Not targeted to Desktop Users - @paan Don't come with a huge ammount of applications - @paan Slackware Pros: Suggested as best performance in a wise install/configuration - @Ryan Damn Small Linux Pros: Main focus is the lightweight factor - 50MB LiveCD - @Ryan Debian Pros: Very versatile, can be configured for both heavy and lightweight computers - @Ryan APT as package manager - @Kyle Based on compatibility and usability - @Kyle -- Fell Free to add Prós and Cons on this, so we can compile a good Reference. -- X Windows suggestion keep coming about XFCE. If others are to add here, open a session for it Like the distro one :)

    Read the article

  • Objective-C Simple Inheritance and OO Principles

    - by bleeckerj
    I have a subclass SubClass that inherits from baseclass BaseClass. BaseClass has an initializer, like so: -(id)init { self = [super init]; if(self) { [self commonInit]; } return self; } -(void)commonInit { self.goodStuff = [[NSMutableArray alloc]init]; } SubClass does its initializer, like so: -(id)init { self = [super init]; if(self) { [self commonInit]; } return self; } -(void)commonInit { self.extraGoodStuff = [[NSMutableArray alloc]init]; } Now, I've *never taken a proper Objective-C course, but I'm a programmer more from the Electrical Engineering side, so I make do. I've developed server-side applications mostly in Java though, so I may be seeing the OO world through Java principles. When SubClass is initialized, it calls the BaseClass init and my expectation would be — because inheritance to me implies that characteristics of a BaseClass pass through to SubClass — that the commonInit method in BaseClass would be called during BaseClass init. It is not. I can *sorta understand maybe-possibly-stretch-my-imagination why it wouldn't be. But, then — why wouldn't it be based on the principles of OOP? What does "self" represent if not the instance of the class of the running code? Okay, so — I'm not going to argue that what a well-developed edition of Objective-C is doing is wrong. So, then — what is the pattern I should be using in this case? I want SubClass to have two main bits — the goodStuff that BaseClass has as well as the extraGoodStuff that it deserves as well. Clearly, I've been using the wrong pattern in this type of situation. Am I meant to expose commonInit (which makes me wonder about encapsulation principles — why expose something that, in the Java world at least, would be considered "protected" and something that should only ever be called once for each instance)? I've run into a similar problem in the recent past and tried to muddle through it, but now — I'm really wondering if I've got my principles and concepts all straight in my head. Little help, please.

    Read the article

  • Emulating a web browser

    - by Sean
    Hello, we are tasked with basically emulating a browser to fetch webpages, looking to automate tests on different web pages. This will be used for (ideally) console-ish applications that run in the background and generate reports. We tried going with .NET and the WatiN library, but it was built on a Marshalled IE, and so it lacked many features that we hacked in with calls to unmanaged native code, but at the end of the day IE is not thread safe nor process safe, and many of the needed features could only be implemented by changing registry values and it was just terribly unflexible. Proxy support JavaScript support- we have to be able to parse the actual DOM after any javascript has executed (and hopefully an event is raised to handle any ajax calls) Ability to save entire contents of page including images FROM THE loaded page's CACHE to a separate location ability to clear cookies/cache, get the cookies/cache, etc. Ability to set headers and alter post data for any browser call And for the love of drogs, an API that isn't completely cryptic Languages acceptable C++, C#, Python, anything that can be a simple little console application that doesn't have a retarded syntax like Ruby. From my own research, and believe me I am terrible at google searches, I have heard good things about WebKit... would the Qt module QtWebKit handle all these features?

    Read the article

  • How do I get the Silverlight Add-On for Visual Studio 2010 and some example code?

    - by xarzu
    How do I get the Silverlight Add-On for Visual Studio 2010? And where can I find lots of example code? When the interent and html was new, one could find examples of how to build a website on a few trusted web sites. The same web sites might not be the best choice for looking for examples for Silverlight, I guess. What are the best web sites where you can look at examples -- and most importantly -- look at the source code of some examples of Silverlight? Back when MFC existed as a option that programmers might use to develop windows applications, a coder could look at a huge list of sample code and step through that code to find something that somewhat did what he was looking for and use that example code to build his own app. Is there anything like that for Silverlight? I have found the http://gallery.expression.microsoft.com/ Expression Blend Gallery and I have found the http://www.silverlight.net/community/samples/silverlight-samples/ Silverlight dot net community samples. I guess that will keep me busy for a while. Are there other sites? There are video instructions on MSDN's Channel9: http://channel9.msdn.com/tags/curso-silverlight-4/ Are there any videos in English? The video instructions look very good. Where is the links to the English versions? I was suggested this site for learning silverlight: http://channel9.msdn.com/learn/courses/Silverlight4/ This online documentation mentions "The Silverlight 4 Tools for Visual Studio 2010" which "is an add-on for Visual Studio 2010 that provides tooling for Microsoft Silverlight 4 and WCF RIA Services. It can be installed on top of either Visual Studio 2010 or Visual Web Developer 2010 Express" where can I find this? Is it shipped with Visual Studio 2010?

    Read the article

  • Why Java language does not offer a way to declare getters and setters of a given "field" through ann

    - by zim2001
    I actually happily design and develop JEE Applications for quite 9 years, but I realized recently that as time goes by, I feel more and more fed up of dragging all these ugly bean classes with their bunch of getters and setters. Considering a basic bean like this : public class MyBean { // needs getter AND setter private int myField1; // needs only a getter, no setter private int myField2; // needs only a setter, no getter private int myField3; /** * Get the field1 * @return the field1 */ public int getField1() { return myField1; } /** * Set the field1 * @param value the value */ public void setField1(int value) { myField1 = value; } /** * Get the field2 * @return the field2 */ public int getField2() { return myField2; } /** * Set the field3 * @param value the value */ public void setField3(int value) { myField3 = value; } } I'm dreaming of something like this : public class MyBean { @inout(public,public) private int myField1; @out(public) private int myField2; @in(public) private int myField3; } No more stupid javadoc, just tell the important thing... It would still be possible to mix annotation and written down getters or setters, to cover cases when it should do non-trivial sets and gets. In other words, annotation would auto-generate the getter / setter code piece except when a literate one is provided. Moreover, I'm also dreaming of replacing things like that : MyBean b = new MyBean(); int v = b.getField1(); b.setField3(v+1); by such : MyBean b = new MyBean(); int v = b.field1; b.field3 = v+1; In fact, writing "b.field1" on the right side of an expression would be semantically identical to write "b.getField1()", I mean as if it has been replaced by some kind of a preprocessor. It's just an idea but I'm wondering if I'm alone on that topic, and also if it has major flaws. I'm aware that this question doesn't exactly meet the SO credo (we prefer questions that can be answered, not just discussed) so I flag it community wiki...

    Read the article

< Previous Page | 578 579 580 581 582 583 584 585 586 587 588 589  | Next Page >