Search Results

Search found 36981 results on 1480 pages for 'string formatting'.

Page 583/1480 | < Previous Page | 579 580 581 582 583 584 585 586 587 588 589 590  | Next Page >

  • Get Attribute value in ViewEngine ASP.NET MVC 3

    - by Kushan Fernando
    I'm writting my own view engine. public class MyViewEngine : RazorViewEngine { public override ViewEngineResult FindView(ControllerContext controllerContext, string viewName, string masterName, bool useCache) { // Here, how do I get attributes defined on top of the Action ? } } ASP.NET MVC Custom Attributes within Custom View Engine Above SO Question has how to get attributes defined on top of the Controller. But I need to get attributes defined on Action.

    Read the article

  • ASP.NET MVC BaseController to dynamically set MasterPage file

    - by rockinthesixstring
    I've built a Base Controller that all of my Controllers inherit from, and I've got it setup so that it checks the browser type and returns the appropriate MasterPageFile on the fly. I'm wondering if this is an efficient way to do this or if I should optimize it another way. Public Class BaseController : Inherits System.Web.Mvc.Controller Protected Overrides Function View(ByVal viewName As String, ByVal masterName As String, ByVal model As Object) As System.Web.Mvc.ViewResult If Request.Browser.IsMobileDevice Then Return MyBase.View(viewName, "Mobile", model) Else Return MyBase.View(viewName, "Site", model) End If End Function End Class

    Read the article

  • Regex in Python

    - by newToProgramming
    SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

    Read the article

  • Regular expression to extract text between either square or curly brackets

    - by ObiWanKenobi
    Related to my previous question, I have a string on the following format: this {is} a [sample] string with [some] {special} words. [another one] What is the regular expression to extract the words within either square or curly brackets, ie. {is} [sample] [some] {special} [another one] Note: In my use case, brackets cannot be nested. I would also like to keep the enclosing characters, so that I can tell the difference between them when processing the results.

    Read the article

  • regex split problem

    - by sunil-mand99
    I have javascript string variable with var sttr="We prefer questions that can be answered --------------------- not just discussed --------------------- Provide details ---------------------------- Write clearly and simply --------------------------answer all the question" please suggest how to split the string into array of sentences on the basis of dashes(-----) using regex result should be array[0]=We prefer questions that can be answered array[1]=not just discussed array[2]=Provide details array[3]=rite clearly and simply array[4]=answer all the question Note: dash(-----) range after each sentence is between 10 to 50

    Read the article

  • user creating/saving

    - by Xaver
    i want to write 2 program: 1) programm saves all local users to the file. 2) loads file find that users not found on local machine and create user. for searching all users which create on local machine i use next code: foreach (ManagementObject user in userSearcher.Get()) { if ((bool)user["LocalAccount"]) { string UserName = (string)user["FullName"]; } } How can i save the settings of user by name and create user?

    Read the article

  • How can we define more than one table,define columns and write data in xml file ?

    - by Harikrishna
    I am writing my xml file manually. And I am writing that for storing data and retrieving data from that. I have written file like for the table PersonalInfo. <?xml version="1.0" standalone="yes"?> <PersonalInfo> <xs:schema id="PersonalInfo" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="PersonalInfo" msdata:IsDataSet="true" msdata:UseCurrentLocale="true"> <xs:complexType> <xs:choice minOccurs="0" maxOccurs="unbounded"> <xs:element name="PesonalInfo."> <xs:complexType> <xs:sequence> <!--Define Column Here....--> <xs:element name="name" type="xs:string" /> <xs:element name="address" type="xs:string" /> </xs:sequence> </xs:complexType> </xs:element> </xs:choice> </xs:complexType> </xs:element> </xs:schema> <!--First Row--> <PersonalInfo.> <name>Harikrishna</name> <address>India</address> </PersonalInfo.> <!--Second Row--> <PersonalInfo.> <name>Jatin</name> <address>India</address> </PersonalInfo.> </PersonalInfo> Please suggest any mistake with writing file here. And now I want define more than table in this file. And here I have to write data for the table like <PersonalInfo.> <name>Harikrishna</name> <address>India</address> </PersonalInfo.> <PersonalInfo.> <name>Jatin</name> <address>India</address> </PersonalInfo.> Is not possible some thing writing data when defining columns EDIT : <xs:element name="name" type="xs:string",Harikrishna,Jatin.... /> <xs:element name="address" type="xs:string",India,India.... /> And how to define more than one table in a single xml file ?

    Read the article

  • How to create a 2D map in Java?

    - by Roman
    I would like to have a mapping which maps two string into one string. For example: map["MainServer","Status"] return "active". What is the best way to do it in Java. Should I use HashMap which include another HashMap as its elements?

    Read the article

  • Help with storing/accessing user access roles C# Winforms

    - by user222453
    Hello, firstly I would like to thank you in advance for any assistance provided. I am new to software development and have designed several Client/Server applications over the last 12 months or so, I am currently working on a project that involves a user logging in to gain access to the application and I am looking at the most efficient and "simple" method of storing the users permissions once logged in to the application which can be used throughout restricting access to certain tabs on the main form. I have created a static class called "User" detailed below: static class User { public static int _userID; public static string _moduleName; public static string _userName; public static object[] UserData(object[] _dataRow) { _userID = (int)_dataRow[0]; _userName = (string)_dataRow[1]; _moduleName = (string)_dataRow[2]; return _moduleName; } } When the user logs in and they have been authenticated, I wish to store the _moduleName objects in memory so I can control which tabs on the main form tab control they can access, for example; if the user has been assigned the following roles in the database: "Sales Ledger", "Purchase Ledger" they can only see the relevant tabs on the form, by way of using a Switch - Case block once the login form is hidden and the main form is instantiated. I can store the userID and userName variables in the main form once it loads by means of say for example: Here we process the login data from the user: DataAccess _dal = new DataAccess(); switch (_dal.ValidateLogin(txtUserName.Text, txtPassword.Text)) { case DataAccess.ValidationCode.ConnectionFailed: MessageBox.Show("Database Server Connection Failed!"); break; case DataAccess.ValidationCode .LoginFailed: MessageBox.Show("Login Failed!"); _dal.RecordLogin(out errMsg, txtUserName.Text, workstationID, false); break; case DataAccess.ValidationCode .LoginSucceeded: frmMain frmMain = new frmMain(); _dal.GetUserPrivList(out errMsg,2); //< here I access my DB and get the user permissions based on the current login. frmMain.Show(); this.Hide(); break; default: break; } private void frmMain_Load(object sender, EventArgs e) { int UserID = User._userID; } That works fine, however the _modules object contains mutiple permissions/roles depending on what has been set in the database, how can I store the multiple values and access them via a Switch-Case block? Thank you again in advance.

    Read the article

  • Display html text in uitextview

    - by milanjansari
    Hello, How to display html text in textview for example string <h1>Krupal testing <span style="font-weight: bold;">Customer WYWO</span></h1> Suppose text is bold so it display in textview as bold string but i want display normal text.is this possible in iphone sdk. Thanks you,

    Read the article

  • please help turn a simple Python2 code to PHP

    - by user296516
    Hi guys, Sorry to bother again, but I really need help transforming this Python2 code into PHP. net, cid, lac = 25002, 9164, 4000 import urllib a = '000E00000000000000000000000000001B0000000000000000000000030000' b = hex(cid)[2:].zfill(8) + hex(lac)[2:].zfill(8) c = hex(divmod(net,100)[1])[2:].zfill(8) + hex(divmod(net,100)[0])[2:].zfill(8) string = (a + b + c + 'FFFFFFFF00000000').decode('hex') data = urllib.urlopen('http://www.google.com/glm/mmap',string) r = data.read().encode('hex') print float(int(r[14:22],16))/1000000, float(int(r[22:30],16))/1000000 Would be great if someone could help, thanks in advance!

    Read the article

  • Need help for a complex linq query

    - by Jipy
    Ok so I've got a DataTable here's the schema DataTable dt = new DataTable(); dt.Columns.Add("word", typeof(string)); dt.Columns.Add("pronunciation", typeof(string)); The table is filled already and I'm trying to make a linq query so that i can output to the console or anywhere something like : Pronunciation : akses9~R => (list of words) I want to output the pronunciations the most common and all the words that use it.

    Read the article

  • How to make a parameter optional in WSDL?

    - by user305069
    I have a WebService API which needs 2 of its parameters to be optional in the WSDL public wsProxy[] Insert(wsProxy[] proxies, string loginname, string password, bool returnNewData) { //code here } I need to a way to show loginname and password as optional in the WSDL. Is there any way to do this in C#. Can I maybe add an tag in front of the parameters like this [optional]loginname? I have been looking around but haven't been able to find anything so far.

    Read the article

  • Query Results Not Expected

    - by E-Madd
    I've been a CF developer for 15 years and I've never run into anything this strange or frustrating. I've pulled my hair out for hours, googled, abstracted, simplified, prayed and done it all in reverse. Can you help me? A cffunction takes one string argument and from that string I build an array of "phrases" to run a query with, attempting to match a location name in my database. For example, the string "the republic of boulder" would produce the array: ["the","republic","of","boulder","the republic","the republic of","the republic of boulder","republic of","republic of boulder","of boulder"]. Another cffunction uses the aforementioned cffunction and runs a cfquery. A query based on the previously given example would be... select locationid, locationname, locationaliasname from vwLocationsWithAlias where LocationName in ('the','the republic','the republic of','republic','republic of','republic of boulder','of','of boulder','boulder') or LocationAliasName in ('the','the republic','the republic of','republic','republic of','republic of boulder','of','of boulder','boulder') This returns 2 records... locationid - locationname - locationalias 99 - 'Boulder' - 'the republic' 68 - 'Boulder' - NULL This is good. Works fine and dandy. HOWEVER... if the string is changed to "the republic", resulting in the phrases array ["the","republic","the republic"] which is then used to produce the query... select locationid, locationname, locationaliasname from vwLocationsWithAlias where LocationName in ('the','the republic','republic') or LocationAliasName in ('the','the republic','republic') This returns 0 records. Say what?! OK, just to make sure I'm not involuntarily HIGH I run that very same query in my SQL console against the same database in the cf datasource. 1 RECORD! locationid - locationname - locationalias 99 - 'Boulder' - 'the republic' I can even hard-code that sql within the same cffunction and get that one result, but never from the dynamically generated SQL. I can get my location phrases from another cffunction of a different name that returns hard-coded array values and those work, but never if the array is dynamically built. I've tried removing cfqueryparams, triple-checking my datatypes, datasource setups, etc., etc., etc. NO DICE WTF!? Is this an obscure bug? Am I losing my mind? I've tried everything I can think of and others (including Ray Camden) can think of. ColdFusion 8 (with all the latest hotfixes) SQL Server 2005 (with all the greatest service packs) Windows 2003 Server (with all the latest updates, service packs and nightly MS voodoo)

    Read the article

  • Date arithmetic using integer values

    - by Dave Jarvis
    Problem String concatenation is slowing down a query: date(extract(YEAR FROM m.taken)||'-1-1') d1, date(extract(YEAR FROM m.taken)||'-1-31') d2 This is realized in code as part of a string, which follows (where the p_ variables are integers): date(extract(YEAR FROM m.taken)||''-'||p_month1||'-'||p_day1||''') d1, date(extract(YEAR FROM m.taken)||''-'||p_month2||'-'||p_day2||''') d2 This part of the query runs in 3.2 seconds with the dates, and 1.5 seconds without, leading me to believe there is ample room for improvement. Question What is a better way to create the date (presumably without concatenation)? Many thanks!

    Read the article

  • Bash: Correct way to Iterate over Map

    - by Lars Tackmann
    In Bash I can create a map (hashtable) with this common construction hput() { eval "$1""$2"='$3' } hget() { eval echo '${'"$1$2"'#hash}' } and then use it like this: hput capitols France Paris hput capitols Spain Madrid echo "$(hget capitols France)" But how do I best iterate over the entries in the map ?. For instance, in Java I would do: for (Map.Entry<String, String> entry : capitols.entrySet()) { System.out.println("Country " + entry.getKey() + " capital " + entry.getValue()); } is there a common way of accomplishing something similar in Bash ?.

    Read the article

  • Error creating bean with name 'sessionFactory'

    - by Sunny Mate
    hi i am getting the following exception while running my application and my applicationContext.xml is <?xml version="1.0" encoding="UTF-8"?> <beans xmlns="http://www.springframework.org/schema/beans" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:p="http://www.springframework.org/schema/p" xsi:schemaLocation="http://www.springframework.org/schema/beans http://www.springframework.org/schema/beans/spring-beans-2.5.xsd"> <bean id="dataSource" class="org.apache.commons.dbcp.BasicDataSource"> <property name="driverClassName" value="com.mysql.jdbc.Driver"> </property> <property name="url" value="jdbc:mysql://localhost/SureshDB"></property> <property name="username" value="root"></property> <property name="password" value="root"></property> </bean> <bean id="sessionFactory" class="org.springframework.orm.hibernate3.LocalSessionFactoryBean"> <property name="dataSource"> <ref bean="dataSource" /> </property> <property name="hibernateProperties"> <props> <prop key="hibernate.dialect"> org.hibernate.dialect.MySQLDialect </prop> </props> </property> <property name="mappingResources"> <list> <value>com/jsfcompref/register/UserTa.hbm.xml</value></list> </property></bean> <bean id="UserTaDAO" class="com.jsfcompref.register.UserTaDAO"> <property name="sessionFactory"> <ref bean="sessionFactory" /> </property> </bean> <bean id="UserTaService" class="com.jsfcompref.register.UserTaServiceImpl"> <property name="userTaDao"> <ref bean="UserTaDAO"/> </property> </bean> </beans> Error creating bean with name 'sessionFactory' defined in class path resource [applicationContext.xml]: Invocation of init method failed; nested exception is java.lang.NoSuchMethodError: org.objectweb.asm.ClassVisitor.visit(IILjava/lang/String;Ljava/lang/String;[Ljava/lang/String;Ljava/lang/String;)V any suggestion would be heplful

    Read the article

  • Turn class "Interfaceable"

    - by scooterman
    Hi folks, On my company system, we use a class to represent beans. It is just a holder of information using boost::variant and some serialization/deserialization stuff. It works well, but we have a problem: it is not over an interface, and since we use modularization through dlls, building an interface for it is getting very complicated, since it is used in almost every part of our app, and sadly interfaces (abstract classes ) on c++ have to be accessed through pointers, witch makes almost impossible to refactor the entire system. Our structure is: dll A: interface definition through abstract class dll B: interface implementation there is a painless way to achieve that (maybe using templates, I don't know) or I should forget about making this work and simply link everything with dll B? thanks Edit: Here is my example. this is on dll A BeanProtocol is a holder of N dataprotocol itens, wich are acessed by a index. class DataProtocol; class UTILS_EXPORT BeanProtocol { public: virtual DataProtocol& get(const unsigned int ) const { throw std::runtime_error("Not implemented"); } virtual void getFields(std::list<unsigned int>&) const { throw std::runtime_error("Not implemented"); } virtual DataProtocol& operator[](const unsigned int ) { throw std::runtime_error("Not implemented"); } virtual DataProtocol& operator[](const unsigned int ) const { throw std::runtime_error("Not implemented"); } virtual void fromString(const std::string&) { throw std::runtime_error("Not implemented"); } virtual std::string toString() const { throw std::runtime_error("Not implemented"); } virtual void fromBinary(const std::string&) { throw std::runtime_error("Not implemented"); } virtual std::string toBinary() const { throw std::runtime_error("Not implemented"); } virtual BeanProtocol& operator=(const BeanProtocol&) { throw std::runtime_error("Not implemented"); } virtual bool operator==(const BeanProtocol&) const { throw std::runtime_error("Not implemented"); } virtual bool operator!=(const BeanProtocol&) const { throw std::runtime_error("Not implemented"); } virtual bool operator==(const char*) const { throw std::runtime_error("Not implemented"); } virtual bool hasKey(unsigned int field) const { throw std::runtime_error("Not implemented"); } }; the other class (named GenericBean) implements it. This is the only way I've found to make this work, but now I want to turn it in a truly interface and remove the UTILS_EXPORT (which is an _declspec macro), and finally remove the forced linkage of B with A.

    Read the article

  • C# Spell checker Problem

    - by reggie
    I've incorporated spell check into my win forms C# project. This is my code. public void CheckSpelling() { try { // declare local variables to track error count // and information int SpellingErrors = 0; string ErrorCountMessage = string.Empty; // create an instance of a word application Microsoft.Office.Interop.Word.Application WordApp = new Microsoft.Office.Interop.Word.Application(); // hide the MS Word document during the spellcheck //WordApp.WindowState = WdWindowState.wdWindowStateMinimize; // check for zero length content in text area if (this.Text.Length > 0) { WordApp.Visible = false; // create an instance of a word document _Document WordDoc = WordApp.Documents.Add(ref emptyItem, ref emptyItem, ref emptyItem, ref oFalse); // load the content written into the word doc WordDoc.Words.First.InsertBefore(this.Text); // collect errors form new temporary document set to contain // the content of this control Microsoft.Office.Interop.Word.ProofreadingErrors docErrors = WordDoc.SpellingErrors; SpellingErrors = docErrors.Count; // execute spell check; assumes no custom dictionaries WordDoc.CheckSpelling(ref oNothing, ref oIgnoreUpperCase, ref oAlwaysSuggest, ref oNothing, ref oNothing, ref oNothing, ref oNothing, ref oNothing, ref oNothing, ref oNothing, ref oNothing, ref oNothing); // format a string to contain a report of the errors detected ErrorCountMessage = "Spell check complete; errors detected: " + SpellingErrors; // return corrected text to control's text area object first = 0; object last = WordDoc.Characters.Count - 1; this.Text = WordDoc.Range(ref first, ref last).Text; } else { // if nothing was typed into the control, abort and inform user ErrorCountMessage = "Unable to spell check an empty text box."; } WordApp.Quit(ref oFalse, ref emptyItem, ref emptyItem); System.Runtime.InteropServices.Marshal.ReleaseComObject(WordApp); // return report on errors corrected // - could either display from the control or change this to // - return a string which the caller could use as desired. // MessageBox.Show(ErrorCountMessage, "Finished Spelling Check"); } catch (Exception e) { MessageBox.Show(e.ToString()); } } The spell checker works well, the only problem is when I try to move the spell checker the main form blurs up for some reason. Also when I close the spell checker the main form is back to normal. It seems like it is opening up Microsoft word then hiding the window, only allowing the spell checker to be seen. Please help.

    Read the article

  • Visual Studio Add in.

    - by Eric Brown - Cal
    I was looking to write/get a visual studio add in. I want to be able to write descriptive log calls at the top and bottom of a function. like this log.debug("TheClass.TheMethod(string TheStringParam ="+TheStringParam+") - in"); log.debug("TheClass.TheMethod(string TheStringParam ="+TheStringParam+") - out"); Is there an adin that does this? Is there source anywhere for an add in like Ghost Doc that does reflection(or whatever) to parse the parameters and such? Thanks, Eric-

    Read the article

  • iPhone colorize UILabel substrings

    - by Janosch R
    Hey, I’m parsing a twitter rss feed, and I just need to show tweets, so I don't need MGTwitterEngine. I have already set it up so I can see the complete tweet, the only thing I want it to colorize hashtags and urls. So I would need to slice up the string in different substrings, colorize the hashtags and urls and glue it together in various UILabels Is there an easier way to accomplish this? In short I need some parts of a string colored differently than others.

    Read the article

  • use bouncy castle to create public key on j2me

    - by mike
    I got the public key from the certificate, keypair is a java.security.KeyPair object String public_key = keypair.getPublic().toString(); I want to send this to the via an http connection to a J2me application. I cannot find any documentation to convert the transmitted string to a Public key that can be used to encrypt Strings. I also want the J2me to verify signed strings from the server. I want to then send the encrypted strings back to the server.

    Read the article

  • need to display proper JP char in the output

    - by Amit
    Hello All, I am creating a string containing HTML tags and some data and storing it in 2 diff formats ( eng and Jp) and finally saving complete stirng using streamwriter in a file as HTML. Output written in English is perfect but JP output is not coming as expected ? Issue: I need to display proper JP char in the output, as of now thay are not appearing as expected..any suggestion ? Thanks in advance... Not sure but could this b b/c of encoding supported by string/stringbuilder ?

    Read the article

< Previous Page | 579 580 581 582 583 584 585 586 587 588 589 590  | Next Page >