Search Results

Search found 51282 results on 2052 pages for 'empty class'.

Page 586/2052 | < Previous Page | 582 583 584 585 586 587 588 589 590 591 592 593  | Next Page >

  • Getting 'this' pointer inside dependency property changed callback

    - by mizipzor
    I have the following dependency property inside a class: class FooHolder { public static DependencyProperty CurrentFooProperty = DependencyProperty.Register( "CurrentFoo", typeof(Foo), typeof(FooHandler), new PropertyMetadata(OnCurrentFooChanged)); private static void OnCurrentFooChanged(DependencyObject d, DependencyPropertyChangedEventArgs e) { FooHolder holder = (FooHolder) d.Property.Owner; // <- something like this // do stuff with holder } } I need to be able to retrieve a reference to the class instance in which the changed property belongs. This is since FooHolder has some event handlers that needs to be hooked/unhooked when the value of the property is changed. The property changed callback must be static, but the event handler is not.

    Read the article

  • what is the programmatic parlance for this phenomenon?

    - by deostroll
    Here is javascript code (jquery) for adding a row of images: var tr = $('<tr>'); var td = '<td><img src="myimg.jpg"/></td>'; tr.append(td).append(td).append(td); $('#mytable tbody tr:eq(0)').before(tr); tr.empty(); //I really don't need this line... Technically tr.empty() shouldn't have worked. It actually does the opposite of what I want. What is the techinical term for this behaviour - You've added tr to the DOM, but any jquery function calls to that object still works, where as you'd normally not expect it to work i.e. make changes to the DOM?

    Read the article

  • Implementing sub fields in a PropertyGrid

    - by evolve
    Alright so my terminology when it comes to C# isn't great, so I'll attempt to explain this with a small example. If you create a class which you are using within a PropertyGrid and you have the following values: class Test { public Point example { get; set; } } This will produce a PropertyGrid which has an expandable object "example" which has fields X and Y in order to create a "Point". I'm attempting to create an object "name" which has fields "firstname" and "lastname", so I have: class Test { public Name example { get; set; } } public struct Name { public string firstname { get; set; } public string lastname { get; set; } } This however isn't working as intended. I think I need to override some method(s) in order to get this working, however since I don't really have the terminology down for PropertyGrids it is difficult for me to find a solution. Any help would be great.

    Read the article

  • Databinding in windows forms on an object graph with possible null properties?

    - by Fredrik
    If I have an object graph like this: class Company { public Address MainAddress {...} } class Address { public string City { ... } } Company c = new Company(); c.MainAddress = new Address(); c.MainAddress.City = "Stockholm"; and databind to a control using: textBox1.DataBinding.Add( "Text", c, "MainAddress.City" ); Everything is fine, but If I bind to: Company c2 = new Company(); c2 using the same syntax it crashes since the MainAddress property is null. I wonder if there is a custom Binding class that can set up listeners for all the possible paths here and bind to the actual object dynamically when/if I sometime later in the application set the MainAddress property.

    Read the article

  • How to mock WCF Web Services with Rhino Mocks.

    - by Will
    How do I test a class that utilizes proxy clients generated by a Web Service Reference? I would like to mock the client, but the generated client interface doesn't contain the close method, which is required to properly terminate the proxy. If I don't use the interface, but instead a concrete reference, I get access to the close method but loose the ability to mock the proxy. I'm trying to test a class similar to this: public class ServiceAdapter : IServiceAdapter, IDisposable { // ILoggingServiceClient is generated via a Web Service reference private readonly ILoggingServiceClient _loggingServiceClient; public ServiceAdapter() : this(new LoggingServiceClient()) {} internal ServiceAdapter(ILoggingServiceClient loggingServiceClient) { _loggingServiceClient = loggingServiceClient; } public void LogSomething(string msg) { _loggingServiceClient.LogSomething(msg); } public void Dispose() { // this doesn't compile, because ILoggingServiceClient doesn't contain Close(), // yet Close is required to properly terminate the WCF client _loggingServiceClient.Close(); } }

    Read the article

  • Using a delegate to populate a listbox

    - by Leroy Jenkins
    Ive been playing around with delegates trying to learn and I ran into one small problem Im hoping you can help me with. class myClass { OtherClass otherClass = new OtherClass(); // Needs Parameter otherClass.SendSomeText(myString); } class OtherClass { public delegate void TextToBox(string s); TextToBox textToBox; public OtherClass(TextToBox ttb) // ***Problem*** { textToBox = ttb; } public void SendSomeText(string foo) { textToBox(foo); } } the form: public partial class MainForm : Form { OtherClass otherClass; public MainForm() { InitializeComponent(); otherClass = new OtherClass(this.TextToBox); } public void TextToBox(string aString) { listBox1.Items.Add(aString); } } Obviously this doesnt compile because the OtherClass constructor is looking for TextToBox as a parameter. How would you recommend getting around the issue so I can get an object from myClass into the textbox in the form?

    Read the article

  • Why isn't the "this." command needed in this constructor? (java)

    - by David
    I'm reading a book about java. It just got to explaining how you create a class called "deck" which contains an array of cards as its instance variable(s). Here is the code snippit: class Deck { Card[] cards; public Deck (int n) { cards = new Card[n]; } } why isn't the this. command used? for example why isn't the code this: class Deck { Card[[] cards; public Deck (int n) { this.cards = new Card[n]; } }

    Read the article

  • Singleton constructor question

    - by gillyb
    Hi, I created a Singleton class in c#, with a public property that I want to initialize when the Singleton is first called. This is the code I wrote : public class BL { private ISessionFactory _sessionFactory; public ISessionFactory SessionFactory { get { return _sessionFactory; } set { _sessionFactory = value; } } private BL() { SessionFactory = Dal.SessionFactory.CreateSessionFactory(); } private object thisLock = new object(); private BL _instance = null; public BL Instance { get { lock (thisLock) { if (_instance == null) { _instance = new BL(); } return _instance; } } } } As far as I know, when I address the Instance BL object in the BL class for the first time, it should load the constructor and that should initialize the SessionFactory object. But when I try : BL.Instance.SessionFactory.OpenSession(); I get a Null Reference Exception, and I see that SessionFactory is null... why?

    Read the article

  • open iphone Mail from Actionsheet..

    - by totato
    hi .. I want to open Mail app from my app when the one button in actionsheet is pressed, I know this way : -(IBAtion)openClick:(id)sender { [[UIApplication sharedApplication] openURL:[NSURL URLWithString:@”mailto:[email protected]”]]; } but can I write this method inside if statement or switch case?(in ControlView class NOT NSObject class , because I use actionsheet for this propose) like this: - (void)actionSheet:(UIActionSheet *)modalView clickedButtonAtIndex:(NSInteger)buttonIndex { switch (buttonIndex) { case 0: { [[UIApplication sharedApplication] openURL:[NSURL URLWithString:@”mailto:[email protected]”]]; break; } I can't test my code because simulator doesn't have the Mail app.. So I need to know is this will work in controlView or must write it in NSObject class ? + seconde question : I want to open Mail app from my app and copy the content in the view to mail body,then the user choice the contact from his contacts list ! Is this way achieve my goal?

    Read the article

  • adding Buttons to Columns in Datagride view

    - by kasunmit
    HiHi, I wrote C# application for import unread e-mails from outlook 2007, I could import sender name, sender mail address,subject and body to data grid view as following foreach (Microsoft.Office.Interop.Outlook._MailItem mailItem in fldEmails.Items) { if (mailItem.UnRead) { UnreadEmails mail = new UnreadEmails(); // mail.AttachmentContent = (mailItem.UnRead == false) ? string.Empty : mailItem.Attachments.Session.OpenSharedItem; foreach (Microsoft.Office.Interop.Outlook.Attachment Atmt in mailItem.Attachments) { mail.AttachmentContent = (mailItem.UnRead == false) ? string.Empty : Atmt.DisplayName; } emails.Add(mail); } } UnreadEmails is a separte class. but couldn't find a way to import attachments (word pdf ppt excel) because i need it for my filter pls help me about it but i could import inly name of the attachment but i need to import attachment content (word, pdf , ppt .. atc. ) to this data grid pls tell how i can do it ... with the code

    Read the article

  • Reverse Expression.Like criterion

    - by Joel Potter
    How should I go about writing a backwards like statement using NHibernate criteria? WHERE 'somestring' LIKE [Property] + '%' Sub Question: Can you access the abstract root alias in a SQLCriterion expression? This is somewhat achievable using the SQLCriterion expression Expression.Sql("? like {alias}.[Property] + '.%'", value, NHibernateUtil.String); However, in the case of class inheritance, {alias} is replaced with the incorrect alias for the column. Example (these classes are stored in separate tables): public abstract class Parent { public virtual string Property { get; set; } } public class Child : Parent { } The above query executed with Child as the root type will replace {alias} with the alias to the Child table rather than the Parent table. This results in an invalid column exception. I need to execute a like statement as above where the property exists on the parent table rather than on the root type table.

    Read the article

  • Implementing operator< in C++

    - by Vulcan Eager
    I have a class with a few numeric fields such as: class Class1 { int a; int b; int c; public: // constructor and so on... bool operator<(const Class1& other) const; }; I need to use objects of this class as a key in an std::map. I therefore implement operator<. What is the simplest implementation of operator< to use here?

    Read the article

  • How to deserialize from json to ActiveRecord objects with associations?

    - by Carmine Paolino
    In my Rails application there is a model that has some has_one associations (this is a fabricated example): class Person::Admin < ActiveRecord::Base has_one :person_monthly_revenue has_one :dude_monthly_niceness accepts_nested_attributes_for :person_monthly_revenue, :dude_monthly_niceness end class Person::MonthlyRevenue < ActiveRecord::Base belongs_to :person_admin end class Dude::MonthlyNiceness < ActiveRecord::Base belongs_to :person_admin end The application talks to a backend that computes some data and returns a piece of JSON like this: { "dude_monthly_niceness": { "february": 1.1153232569518972, "october": 1.1250217200558268, "march": 1.3965786869658541, "august": 1.6293418014601631, "september": 1.4062771500697835, "may": 1.7166279693955291, "january": 1.0086401628086725, "june": 1.5711510228365859, "april": 1.5614525597326563, "december": 0.99894169970474289, "july": 1.7263264324994585, "november": 0.95044938418509506 }, "person_monthly_revenue": { "february": 10.585596551505297, "october": 10.574823016656749, "march": 9.9125274764852787, "august": 9.2111604702328922, "september": 9.7905249446675153, "may": 9.1329712474607962, "january": 10.479614016604238, "june": 9.3710235926961936, "april": 9.5897372624830304, "december": 10.052587677671438, "july": 8.9508877843925561, "november": 10.925339756096172 }, } To deserialize it, I use ActiveRecord's from_json, but instead of a Person::Admin object with all the associations in place, I get this error: >> Person::Admin.new.from_json(json) NameError: uninitialized constant Person::Admin::DudeMonthlyNiceness Am I doing something wrong? Is there a better way to deserialize data? (I can modify the backend easily)

    Read the article

  • C# listbox,params

    - by Oyeme
    As Andrew Hare suggested in his answer: Create a field to store all the ListBox instances and then change the constructor to accept an arbitrary number of them: by I tried the following class scaner { readonly IEnumerable<ListBox> listBoxes; public IEnumerable<ListBox> ListBoxes { get { return this.listBoxes; } } public scaner(params ListBox[] listBoxes) { this.listBoxes = listBoxes; } } This will allow you to do this: scaner Comp = new scaner(listBox1, listBox2); How can i access listbox1? In class scaner i'm trying to call this.listBoxes. (I need to call the listbox1 in scaner class.How can i do/call it? Thanks for answers.

    Read the article

  • Hibernate Bi-Directional ManyToMany Updates with Second Level cache

    - by DD
    I have a bidirectional many-to-many class: public class A{ @ManyToMany(mappedBy="listA") private List<B> listB; } public class B{ @ManyToMany private List<A> listA; } Now I save a listA into B: b.setListA(listA); This all works fine until I turn on second-level caching on the collection a.ListB. Now, when I update the list in B, a.listB does not get updated and remains stale. How do you get around this? Thanks, Dwayne

    Read the article

  • Weak reference and Strong reference

    - by theband
    package uk.co.bigroom.utils { import flash.utils.Dictionary; /** * Class to create a weak reference to an object. A weak reference * is a reference that does not prevent the object from being * garbage collected. If the object has been garbage collected * then the get method will return null. */ public class WeakRef { private var dic:Dictionary; /** * The constructor - creates a weak reference. * * @param obj the object to create a weak reference to */ public function WeakRef( obj:* ) { dic = new Dictionary( true ); dic[obj] = 1; } /** * To get a strong reference to the object. * * @return a strong reference to the object or null if the * object has been garbage collected */ public function get():* { for ( var item:* in dic ) { return item; } return null; } } } In this Class, how they denote one as Weak Reference and one as Strong reference.

    Read the article

  • Working with the Objective-C/Cocoa flat namespace

    - by Stephen Blinkhorn
    I've not found anything that addresses my specific name space question as yet. I am working on some AudioUnit plug-ins featuring Cocoa based GUIs. The plug-ins use a common library of user interface classes (sliders, buttons etc) which are simply added to each Xcode project. When I recompile and distribute updates it is pretty much guaranteed that at least one user interface class will have been updated since the last release. If the user launches an older plug-in before an updated plug-in then the old Cocoa classes are already loaded into the run time and the plug-in attempts to use the older implementations - often resulting in a failure one way or another. I know frameworks are the intended solution but the overhead and backwards compatibility issues are not ideal. I prefix all class names where possible but what options do I have to ensure that each plug-in contains unique class names for the shared user interface classes?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Question regarding C++ Templates

    - by Isuru
    I used a simple class for a test program about templates, this is what I did: template <typename T> class test { public: test<T>::test(); T out(); }; template <typename T> test<T>::test() { } T test<T>::out() { } int main() { //test<int> t; } But when I try to compile it says 'T' : undeclared identifier and use of class template requires template argument list , pointing to the same line, where I have implemented the method out() . Can anyone please explain what the problem is?? I'm using visual studio 2008.

    Read the article

  • Does a C++ destructor always or only sometimes call data member destructors?

    - by Magnus
    I'm trying to validate my understanding of C++ destructors. I've read many times that C++ supplies a default destructor if I don't write one myself. But does this mean that if I DO write a destructor that the compiler WON'T still provide the default cleanup of stack-allocated class fields? My hunch is that the only sane behavior would be that all class fields are destroyed no matter what, whether I provide my own destructor or not. In which case the statement I've read so many times is actually a little misleading and could be better stated as: "Whether or not you write your own destructor, the C++ compiler always writes a default destructor-like sequence to deallocate the member variables of your class. You may then specify additional deallocations or other tasks as needed by defining your own destructor" Is this correct?

    Read the article

  • Unittest and mock

    - by user1410756
    I'm testing with unittest in python and it's ok. Now, I have introduced mock and I need to resolve a question. This is my code: from mock import Mock import unittest class Matematica(object): def __init__(self, op1, op2): self.op1 = op1 self.op2 = op2 def adder(self): return self.op1 + self.op2 def subs(self): return abs(self.op1 - self.op2) def molt(self): return self.op1 * self.op2 def divid(self): return self.op1 / self.op2 class TestMatematica(unittest.TestCase): """Test della classe Matematica""" def testing(self): """Somma""" mat = Matematica(10,20) self.assertEqual(mat.adder(),30) """Sottrazione""" self.assertEqual(mat.subs(),10) class test_mock(object): def __init__(self, matematica): self.matematica = matematica def execute(self): self.matematica.adder() self.matematica.adder() self.matematica.subs() if __name__ == "__main__": result = unittest.TextTestRunner(verbosity=2).run(TestMatematica('testing')) a = Matematica(10,20) b = test_mock(a) b.execute() mock_foo = Mock(b.execute)#return_value = 'rafa') mock_foo() print mock_foo.called print mock_foo.call_count print mock_foo.method_calls This code is functionally and result of print is: True, 1, [] . Now, I need to count how many times are called self.matematica.adder() and self.matematica.subs() . THANKS

    Read the article

  • What's the straightforward way to implement one to many editing in list_editable in django admin?

    - by Nate Pinchot
    Given the following models: class Store(models.Model): name = models.CharField(max_length=150) class ItemGroup(models.Model): group = models.CharField(max_length=100) code = models.CharField(max_length=20) class ItemType(models.Model): store = models.ForeignKey(Store, on_delete=models.CASCADE, related_name="item_types") item_group = models.ForeignKey(ItemGroup) type = models.CharField(max_length=100) Inline's handle adding multiple item_types to a Store nicely when viewing a single Store. The content admin team would like to be able to edit stores and their types in bulk. Is there a simple way to implement Store.item_types in list_editable which also allows adding new records, similar to horizontal_filter? If not, is there a straightforward guide that shows how to implement a custom list_editable template? I've been Googling but haven't been able to come up with anything. Also, if there is a simpler or better way to set up these models that would make this easier to implement, feel free to comment.

    Read the article

  • Java interface design

    - by Nayn
    Hi, I had an interface initially as below. public interface testMe { public Set<String> doSomething(); } public class A implements testMe { public Set<String> doSomething() { return // Set<String> } } I had similar classes implementing testMe. Now I have to add one more class which returns Set<Some Object> public class X implements testMe() { public Set<Some OBject> doSomething() { } } How could i add this mehtod in the interface without breaking existing classes? Thanks Nayn

    Read the article

  • Access ConfigurationSection from ConfigurationElement

    - by shivesh
    I have a configuration class that maps web.config, something like that: public class SiteConfigurationSection : ConfigurationSection { [ConfigurationProperty("defaultConnectionStringName", DefaultValue = "LocalSqlServer")] public string DefaultConnectionStringName { get { return (string)base["defaultConnectionStringName"]; } set { base["defaultConnectionStringName"] = value; } } [ConfigurationProperty("Module", IsRequired = true)] public ModuleElement Module { get { return (ModuleElement)base["Module"]; } } } public class ModuleElement : ConfigurationElement { [ConfigurationProperty("connectionStringName")] public string ConnectionStringName { get { return (string)base["connectionStringName"]; } set { base["connectionStringName"] = value; } } public string ConnectionString { get { string str; if (string.IsNullOrEmpty(this.ConnectionStringName)) { str =//GET THE DefaultConnectionStringName from SiteConfigurationSection; } else str = this.ConnectionStringName; return WebConfigurationManager.ConnectionStrings[str].ConnectionString; } } } Meaning if connection string name value is missing in Module section in web.config file, the value should be read from configurationsection. How to do that?

    Read the article

  • Caching result of setUp() using Python unittest

    - by dbr
    I currently have a unittest.TestCase that looks like.. class test_appletrailer(unittest.TestCase): def setup(self): self.all_trailers = Trailers(res = "720", verbose = True) def test_has_trailers(self): self.failUnless(len(self.all_trailers) > 1) # ..more tests.. This works fine, but the Trailers() call takes about 2 seconds to run.. Given that setUp() is called before each test is run, the tests now take almost 10 seconds to run (with only 3 test functions) What is the correct way of caching the self.all_trailers variable between tests? Removing the setUp function, and doing.. class test_appletrailer(unittest.TestCase): all_trailers = Trailers(res = "720", verbose = True) ..works, but then it claims "Ran 3 tests in 0.000s" which is incorrect.. The only other way I could think of is to have a cache_trailers global variable (which works correctly, but is rather horrible): cache_trailers = None class test_appletrailer(unittest.TestCase): def setUp(self): global cache_trailers if cache_trailers is None: cache_trailers = self.all_trailers = all_trailers = Trailers(res = "720", verbose = True) else: self.all_trailers = cache_trailers

    Read the article

< Previous Page | 582 583 584 585 586 587 588 589 590 591 592 593  | Next Page >