Search Results

Search found 3518 results on 141 pages for 'arguments'.

Page 59/141 | < Previous Page | 55 56 57 58 59 60 61 62 63 64 65 66  | Next Page >

  • haskell recursive function

    - by snorlaks
    Hello, Please help me with writing function which takes two arguments : list of ints and index (int) and returns list of integers with negative of value on specified index position in the table MyReverse :: [Int]-Int-[Int] for example myReverse [1,2,3,4,5] 3 = [1,2,-3,4,5] if index is bigger then length of the list or smaller then 0 return the same list. Thanks for help

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Keyboard input with timeout in Python

    - by J. Pablo Fernández
    How would you prompt the user for some input but timing out after N seconds? Google is pointing to a mail thread about it at http://mail.python.org/pipermail/python-list/2006-January/533215.html but it seems not to work. The statement in which the timeout happens, no matter whether it is a sys.input.readline or timer.sleep(), I always get: <type 'exceptions.TypeError'>: [raw_]input expected at most 1 arguments, got 2 which somehow the except fails to catch.

    Read the article

  • Passing BLOB/CLOB as parameter to PL/SQL function

    - by Ula Krukar
    I have this procedure i my package: PROCEDURE pr_export_blob( p_name IN VARCHAR2, p_blob IN BLOB, p_part_size IN NUMBER); I would like for parameter p_blob to be either BLOB or CLOB. When I call this procedure with BLOB parameter, everything is fine. When I call it with CLOB parameter, I get compilation error: PLS-00306: wrong number or types of arguments in call to 'pr_export_blob' Is there a way to write a procedure, that can take either of those types as parameter? Some kind of a superclass maybe?

    Read the article

  • Prolog - generate correct bracketing

    - by Henrik Bak
    I'd like to get some help in the following exam problem, i have no idea how to do this: Input: a list of numbers, eg.: [1,2,3,4] Output: every possible correct bracketing. Eg.: (in case of input [1,2,3,4]): ((1 2) (3 4)) ((1 (2 3)) 4) (1 ((2 3) 4)) (1 (2 (3 4))) (((1 2) 3) 4) Bracketing here is like a method with two arguments, for example multiplication - then the output is the possible multiplication orders. Please help, i'm stuck with this one. Any help is appreciated, thanks!

    Read the article

  • Windows 7 - pydoc from cmd

    - by Random_Person
    Okay, I'm having one of those moments that makes me question my ability to use a computer. This is not the sort of question I imagined asking as my first SO post, but here goes. Started on Zed's new "Learn Python the Hard Way" since I've been looking to get back into programming after a 10 year hiatus and python was always what I wanted. This book has really spoken to me. That being said, I'm having a serious issue with pydoc from the command. I've got all the directories in c:/python26 in my system path and I can execute pydoc from the command line just fine regardless of pwd - but it accepts no arguments. Doesn't matter what I type, I just get the standard pydoc output telling me the acceptable arguments. Any ideas? For what it's worth, I installed ActivePython as per Zed's suggestion. C:\Users\Chevee>pydoc file pydoc - the Python documentation tool pydoc.py <name> ... Show text documentation on something. <name> may be the name of a Python keyword, topic, function, module, or package, or a dotted reference to a class or function within a module or module in a package. If <name> contains a '\', it is used as the path to a Python source file to document. If name is 'keywords', 'topics', or 'modules', a listing of these things is displayed. pydoc.py -k <keyword> Search for a keyword in the synopsis lines of all available modules. pydoc.py -p <port> Start an HTTP server on the given port on the local machine. pydoc.py -g Pop up a graphical interface for finding and serving documentation. pydoc.py -w <name> ... Write out the HTML documentation for a module to a file in the current directory. If <name> contains a '\', it is treated as a filename; if it names a directory, documentation is written for all the contents. C:\Users\Chevee> EDIT: New information, pydoc works just fine in PowerShell. As a linux user, I have no idea why I'm trying to use cmd anyways--but I'd still love to figure out what's up with pydoc and cmd. EDIT 2: More new information. In cmd... c:\>python c:/python26/lib/pydoc.py file ...works just fine. Everything works just fine with just pydoc in PowerShell without me worrying about pwd, or extensions or paths.

    Read the article

  • How do I use a custom #theme function to a fieldset in a drupal module?

    - by Rob Crowell
    I have a module that builds a form that includes a fieldset. Instead of using the <legend> element to render the fieldset title, I want to place this content in a <div> element instead. But I want to change the behavior only for the form returned by my module, so I don't want to place any new functionality into my theme's template.php file. In mymod.module I have defined: // custom rendering function for fieldset elements function theme_mymod_fieldset($element) { return 'test'; } // implement hook_theme function mymod_theme() { return array( 'mymod_fieldset' => array('arguments' => array('element' => NULL)), 'mymod_form' => array('arguments' => array()) ); } // return a form that is based on the 'Basic Account Info' category of the user profile function mymod_form() { // load the user's profile global $user; $account = user_load($user->uid); // load the profile form, and then edit it $form_state = array(); $form = drupal_retrieve_form('user_profile_form', $form_state, $account, 'Basic Account Info'); // set the custom #theme function for this fieldset $form['Basic Account Info']['#theme'] = 'mymod_fieldset'; // more form manipulations // ... return $form; } When my page gets rendered, I expected to see the fieldset representing 'Basic Account Info' to be wholly replaced by my test message 'test'. Instead what happens is that the <fieldset> and <legend> elements are rendered as normal, but with the body of the fieldset replaced by the test message instead, like this: <fieldset> <legend>Basic Account Info</legend> test </fieldset> Why doesn't my #theme function have the chance to replace the entire <fieldset> element? If I wrap a textfield in this function instead, I am able to completely replace the <input> element along with its label. Furthermore, if I provide an override in my site's template.php for theme_fieldset, it works as expected and I am able to completely replace the <fieldset>, so I know it is possible. What's different about providing #theme functions to fieldsets inside a module?

    Read the article

  • Running Java CORBA Client on Unix

    - by Benny
    I'm trying to run a Java application I wrote to subscribe to a CORBA event service. It runs OK on my Windows machine, but as soon as I deploy it to the UNIX server, it gives me an org.omg.CORBA.NO_IMPLEMENT exception. Any ideas as to why this might be happening? I'm using JacORB on my Windows machine and passing VM arguments to initialize the client ORB, but I'm not sure how to do that on UNIX and if it's even necessary. Thanks in advance!

    Read the article

  • Filling an Area in .NET

    - by lajoo
    I'm drawing a circle in C# and i have divided it into some parts,i want to fill different parts with different colors,is there anyway to do this? and how?i tried using fillpie() but i couldn't get the arguments to work.

    Read the article

  • Serve external template in Django

    - by AlexeyMK
    Hey, I want to do something like return render_to_response("http://docs.google.com/View?id=bla", args) and serve an external page with django arguments. Django doesn't like this (it looks for templates in very particular places). What's the easiest way make this work? Right now I'm thinking to use urllib to save the page to somewhere locally on my server and then serve with the templates pointing to there. Note: I'm not looking for anything particularly scalable here, I realize my proposal above is a little dirty.

    Read the article

  • Simulating "focus" and "blur" in jQuery .live() method...

    - by Jonathan Sampson
    Update: As of jQuery 1.4, $.live() now supports focusin and focusout events. jQuery currently1 doesn't support "blur" or "focus" as arguments for the $.live() method. What type of work-around could I implement to achieve the following: $("textarea") .live("focus", function() { foo = "bar"; }) .live("blur", function() { foo = "fizz"; }); 1. 07/29/2009, version 1.3.2

    Read the article

  • Javascript: Inline function vs predefined functions

    - by glaz666
    Can any body throw me some arguments for using inline functions against passing predefined function name to some handler. I.e. which is better: (function(){ setTimeout(function(){ /*some code here*/ }, 5); })(); versus (function(){ function invokeMe() { /*code*/ } setTimeout(invokeMe, 5); })(); Strange question, but we are almost fighting in the team about this

    Read the article

  • Are GUID primary keys bad in theory, or just practice?

    - by Yarin
    Whenever I design a database I automatically start with an auto-generating GUID primary key for each of my tables (excepting look-up tables) I know I'll never lose sleep over duplicate keys, merging tables, etc. To me it just makes sense philosophically that any given record should be unique across all domains, and that that uniqueness should be represented in a consistent way from table to table. I realize it will never be the most performant option, but putting performance aside, I'd like to know if there are philosophical arguments against this practice?

    Read the article

  • Other ternary operators besides ternary conditional (?:)

    - by Malcolm
    The "ternary operator" expression is now almost equivalent to the ternary conditional operator: condition ? trueExpression : falseExpression; However, "ternary operator" only means that it takes three arguments. I'm just curious, are there any languages with any other built-in ternary operators besides conditional operator and which ones?

    Read the article

  • Remove first and last characters from a string in Lisp

    - by powerj1984
    I am passing in command line arguments to my Lisp program and they are formatted like this when they hit my main function: ("1 1 1" "dot" "2 2 2") I have a dot function and would like to call it directly from the argument, but first I must strip the " characters. I tried variations of this function: (defun remove-quotes (s) (setf (aref s 0) '"")) to no avail, Lisp complains that "" is not a member of base-char. Thanks!

    Read the article

  • Changing forecolor according to backcolor

    - by strakastroukas
    Dear SO family, I have created an iframe which contains the label, "powered by MyWebsite.site" The "iframe itself" accepts arguments, so other webmasters may customize the appearance of it. The problem is that since the background of the iframe could be customized, anyone can "vanish" the "powered by MyWebsite.site". So what option do i have? How should i dynamically change the label color depending on any background?

    Read the article

  • Execute a Application On The Server Using VBScript

    - by Nathan Campos
    I have an application on my server that is called leaf.exe, that haves two arguments needed to run, they are: inputfile and outputfile, that will be like this example: leaf.exe input.jpg output.leaf They are all on the same directory as my home page file(the executable and the input file). But I need that a VBScript could run the application like that, then I want to know how could I do this.

    Read the article

  • Call trace in Android

    - by DenMark
    I want to know how to do method tracing for Android applications. I mean, a sequence of calls on each object, not a stack trace. It's very similar to this question (Call trace in java), but on different platforms (jvm-PC vs dvm-Android). I have no control over the start arguments of dalvik, thus I cannot specify a java agent (or am I wrong here?). Is there another way to do method tracing? Thanks!

    Read the article

  • Usable mainmenu when sheet is shown

    - by neoneye
    How does one react to menuitems that are clicked via mouse or invoked via keyboard, e.g: CMD+Q ? [NSApp beginSheet:my_sheet ...arguments... ]; /* The sheet is now shown and the mainmenu isn't usable. How does one make it usable? */ [NSApp endSheet:my_sheet returnCode:0];

    Read the article

  • Variable popen calls in C

    - by Bushman
    I'm trying to execute MS-DOS DEL commands inside a Win32 C program, and I already know that system and popen can be used for this. However, the problem is that both require string literals (type const char) for the commands, and I need something like the DOS equivalent of dir ~ | grep -P '/\d{7,8}\.exe$/' | rm, which obviously can't use string literals. Is there some other subprocess function in C that allows for char arrays as arguments for process names?

    Read the article

< Previous Page | 55 56 57 58 59 60 61 62 63 64 65 66  | Next Page >